diff --git a/examples/dragen/config/config.yaml b/examples/dragen/config/config.yaml index 34ba6ac..2d14405 100644 --- a/examples/dragen/config/config.yaml +++ b/examples/dragen/config/config.yaml @@ -41,9 +41,7 @@ derep: ############# ### ALIGN ### ############# -prefilter: - taxa: "Bacteria,Archaea,Viruses" - +taxon: taxonomy: nodes: "data/taxdump/nodes.dmp" names: "data/taxdump/names.dmp" @@ -52,46 +50,16 @@ prefilter: hires_organelles_viruses_smags: n_shards: 2 path: "/staging/hash_tables/hires-organelles-viruses-smags.{n_shard}" - map: + map: &map_prok_dragen tool: dragen - params: "--Mapper.edit-mode=1" + params: "--Aligner.global=1 --Aligner.match-score=0 --Aligner.match-n-score=-1 --Aligner.mismatch-pen=4 --Aligner.gap-open-pen=0 --Aligner.gap-ext-pen=4 --Aligner.aln-min-score=0 --Aligner.min-score-coeff=-0.4 --Aligner.sec-aligns=2000 --Aligner.supp-aligns=0 --Aligner.hard-clips=0 --Aligner.sec-score-delta=100 --Mapper.edit-mode=1 --Mapper.max-seed-freq=256 --Mapper.reduce-seed-ext=1 --Mapper.intvl-target-hits=256 --Mapper.intvl-max-hits=256 --Mapper.intvl-sample-hits=256 --Mapper.seed-density=1.0 --Mapper.edit-seed-num=80 --Mapper.edit-read-len=100 --Mapper.edit-chain-limit=29 --filter-flags-from-output=4" acc2taxid: "data/prok.acc2taxid.gz" human_genome: n_shards: 1 path: "/staging/hash_tables/GCF_000001405.40_GRCh38.p14_genomic" map: - tool: dragen - params: "--Aligner.global=1 --Aligner.match-score=0 --Aligner.match-n-score=-1 --Aligner.mismatch-pen=4 --Aligner.gap-open-pen=0 --Aligner.gap-ext-pen=4 --Aligner.aln-min-score=0 --Aligner.min-score-coeff=-0.4 --Aligner.sec-aligns=2000 --Aligner.supp-aligns=0 --Aligner.hard-clips=0 --Aligner.sec-score-delta=100 --Mapper.edit-mode=1 --Mapper.max-seed-freq=256 --Mapper.reduce-seed-ext=1 --Mapper.intvl-target-hits=256 --Mapper.intvl-max-hits=256 --Mapper.intvl-sample-hits=256 --Mapper.seed-density=1.0 --Mapper.edit-seed-num=80 --Mapper.edit-read-len=100 --Mapper.edit-chain-limit=29 --filter-flags-from-output=4" + <<: *map_prok_dragen acc2taxid: "data/human.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 500 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 25 --weight_type 1 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2" - - -euk: - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: refseq_mitoch: n_shards: 1 path: "/staging/hash_tables/refseq_mitochondrion.genomic/" diff --git a/examples/dragen/dag.svg b/examples/dragen/dag.svg index c868f81..7cf4d1c 100644 --- a/examples/dragen/dag.svg +++ b/examples/dragen/dag.svg @@ -1,3158 +1,2352 @@ - - - + + snakemake_dag - + 0 - -target_taxon + +multiqc_taxon_upload 1 - -multiqc_taxon + +multiqc_taxon 1->0 - - + + 2 - -trim_fastqc_raw + +trim_fastqc_raw - + 2->1 - - + + 3 - -trim_get_fastq_raw -lane: L002 -library: LVsim1 -read_type_raw: R2 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim1 +read_type_raw: R2 +sample: Lib - + 3->2 - - + + 15 - -trim_adapterremoval_fastq_pe + +trim_adapterremoval_fastq_pe - + 3->15 - - + + 4 - -trim_fastqc_raw + +trim_fastqc_raw - + 4->1 - - + + 5 - -trim_get_fastq_raw -lane: L001 -library: LVsim2 -read_type_raw: R2 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim1 +read_type_raw: R1 +sample: Lib - + 5->4 - - - - - -14 - -trim_adapterremoval_fastq_pe + + - - -5->14 - - + + +5->15 + + 6 - -trim_fastqc_raw + +trim_fastqc_raw - + 6->1 - - + + 7 - -trim_get_fastq_raw -lane: L001 -library: LVsim1 -read_type_raw: R1 -sample: Lib + +trim_get_fastq_raw +lane: L002 +library: LVsim1 +read_type_raw: R2 +sample: Lib - + 7->6 - - + + 16 - -trim_adapterremoval_fastq_pe + +trim_adapterremoval_fastq_pe - + 7->16 - - + + 8 - -trim_fastqc_raw + +trim_fastqc_raw - + 8->1 - - + + 9 - -trim_get_fastq_raw -lane: L001 -library: LVsim1 -read_type_raw: R2 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim2 +read_type_raw: R2 +sample: Lib - + 9->8 - - + + - - -9->16 - - + + +14 + +trim_adapterremoval_fastq_pe + + + +9->14 + + 10 - -trim_fastqc_raw + +trim_fastqc_raw - + 10->1 - - + + 11 - -trim_get_fastq_raw -lane: L002 -library: LVsim1 -read_type_raw: R1 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim2 +read_type_raw: R1 +sample: Lib - + 11->10 - - + + - - -11->15 - - + + +11->14 + + 12 - -trim_fastqc_raw + +trim_fastqc_raw - + 12->1 - - + + 13 - -trim_get_fastq_raw -lane: L001 -library: LVsim2 -read_type_raw: R1 -sample: Lib + +trim_get_fastq_raw +lane: L002 +library: LVsim1 +read_type_raw: R1 +sample: Lib - + 13->12 - - + + - - -13->14 - - + + +13->16 + + - + 14->1 - - + + 17 - -trim_fastqc_trim -read_type_trim: R1 + +trim_fastqc_trim +read_type_trim: R1 - + 14->17 - - + + 19 - -trim_fastqc_trim -read_type_trim: collapsed + +trim_fastqc_trim +read_type_trim: collapsed - + 14->19 - - + + 22 - -trim_fastqc_trim -read_type_trim: R2 + +trim_fastqc_trim +read_type_trim: singleton - + 14->22 - - + + - - -23 - -trim_fastqc_trim -read_type_trim: singleton + + +24 + +trim_fastqc_trim +read_type_trim: R2 - - -14->23 - - + + +14->24 + + - - -30 - -trim_fastqc_trim -read_type_trim: collapsedtrunc + + +28 + +trim_fastqc_trim +read_type_trim: collapsedtrunc - - -14->30 - - + + +14->28 + + - - -35 - -derep_merge_lanes -read_type_trim: collapsed + + +33 + +derep_merge_lanes +read_type_trim: collapsed - - -14->35 - - + + +14->33 + + - + 15->1 - - - - - -20 - -trim_fastqc_trim -read_type_trim: singleton - - - -15->20 - - + + - - -21 - -trim_fastqc_trim -read_type_trim: collapsedtrunc + + +18 + +trim_fastqc_trim +read_type_trim: singleton - - -15->21 - - + + +15->18 + + 25 - -trim_fastqc_trim -read_type_trim: R2 + +trim_fastqc_trim +read_type_trim: collapsed - + 15->25 - - + + + + + +26 + +trim_fastqc_trim +read_type_trim: R2 + + + +15->26 + + 27 - -trim_fastqc_trim -read_type_trim: collapsed + +trim_fastqc_trim +read_type_trim: collapsedtrunc - + 15->27 - - + + - - -29 - -trim_fastqc_trim -read_type_trim: R1 + + +30 + +trim_fastqc_trim +read_type_trim: R1 - - -15->29 - - + + +15->30 + + - - -33 - -derep_merge_lanes -read_type_trim: collapsed + + +35 + +derep_merge_lanes +read_type_trim: collapsed - - -15->33 - - + + +15->35 + + - + 16->1 - - + + - - -18 - -trim_fastqc_trim -read_type_trim: singleton + + +20 + +trim_fastqc_trim +read_type_trim: singleton - - -16->18 - - + + +16->20 + + - - -24 - -trim_fastqc_trim -read_type_trim: R2 + + +21 + +trim_fastqc_trim +read_type_trim: collapsed - - -16->24 - - + + +16->21 + + - - -26 - -trim_fastqc_trim -read_type_trim: collapsed + + +23 + +trim_fastqc_trim +read_type_trim: R2 - - -16->26 - - + + +16->23 + + - - -28 - -trim_fastqc_trim -read_type_trim: collapsedtrunc + + +29 + +trim_fastqc_trim +read_type_trim: collapsedtrunc - - -16->28 - - + + +16->29 + + 31 - -trim_fastqc_trim -read_type_trim: R1 + +trim_fastqc_trim +read_type_trim: R1 - + 16->31 - - + + - - -16->33 - - + + +16->35 + + - + 17->1 - - + + - + 18->1 - - + + - + 19->1 - - + + - + 20->1 - - + + - + 21->1 - - + + - + 22->1 - - + + - + 23->1 - - + + - + 24->1 - - + + - + 25->1 - - + + - + 26->1 - - + + - + 27->1 - - + + - + 28->1 - - + + - + 29->1 - - + + - + 30->1 - - + + - + 31->1 - - + + 32 - -derep_fastqc -tool: merge_lanes + +derep_fastqc +tool: merge_lanes - + 32->1 - - + + - + 33->32 - - + + - - -39 - -derep_nonpareil_infer -tool: merge_lanes + + +37 + +derep_nonpareil_infer +tool: merge_lanes - - -33->39 - - + + +33->37 + + - - -43 - -derep_seqkit + + +41 + +derep_seqkit - - -33->43 - - + + +33->41 + + 34 - -derep_fastqc -tool: merge_lanes + +derep_fastqc +tool: merge_lanes - + 34->1 - - + + - + 35->34 - - + + - - -37 - -derep_nonpareil_infer -tool: merge_lanes + + +39 + +derep_nonpareil_infer +tool: merge_lanes - - -35->37 - - + + +35->39 + + - - -41 - -derep_seqkit + + +43 + +derep_seqkit - - -35->41 - - + + +35->43 + + 36 - -derep_nonpareil_plot + +derep_nonpareil_plot - + 36->1 - - + + - + 37->36 - - + + 38 - -derep_nonpareil_plot + +derep_nonpareil_plot - + 38->1 - - + + - + 39->38 - - + + 40 - -derep_fastqc -tool: derep + +derep_fastqc +tool: derep - + 40->1 - - + + - + 41->40 - - + + 45 - -derep_low_complexity + +derep_low_complexity - + 41->45 - - + + 42 - -derep_fastqc -tool: derep + +derep_fastqc +tool: derep - + 42->1 - - + + - + 43->42 - - + + 47 - -derep_low_complexity + +derep_low_complexity - + 43->47 - - + + 44 - -derep_fastqc -tool: low_complexity + +derep_fastqc +tool: low_complexity - + 44->1 - - + + - + 45->44 - - - - - -73 - -prefilter_reads_extract - - - -45->73 - - + + - - -80 - -taxon_prefilter_shard_dragen - - - -45->80 - - - - - -81 - -taxon_prefilter_shard_dragen_csv -n_shard: 1 -read_type_map: collapsed -ref: hires_organelles_viruses_smags -tot_shards: 2 - - - -45->81 - - - - - -84 - -taxon_prefilter_shard_dragen - - - -45->84 - - - - - -85 - -taxon_prefilter_shard_dragen_csv -n_shard: 1 -read_type_map: collapsed -ref: human_genome -tot_shards: 1 - - - -45->85 - - - - - -87 - -taxon_prefilter_shard_dragen - - - -45->87 - - - - - -88 - -taxon_prefilter_shard_dragen_csv -n_shard: 2 -read_type_map: collapsed -ref: hires_organelles_viruses_smags -tot_shards: 2 - - - -45->88 - - - - - -104 - -taxon_shard_dragen + + +49 + +taxon_shard_dragen +n_shard: 2 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +45->49 + + - - -45->104 - - + + +50 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: hires_organelles_viruses_smags +tot_shards: 2 + + + +45->50 + + - - -106 - -taxon_shard_dragen + + +52 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +45->52 + + - - -45->106 - - + + +53 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: refseq_mitoch +tot_shards: 1 + + + +45->53 + + - - -108 - -taxon_shard_dragen + + +54 + +taxon_shard_dragen +n_shard: 2 +read_type_map: collapsed +ref: hires_organelles_viruses_smags +tot_shards: 2 + + + +45->54 + + - - -45->108 - - + + +55 + +taxon_shard_dragen +n_shard: 3 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +45->55 + + - - -116 - -taxon_shard_dragen + + +60 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: human_genome +tot_shards: 1 + + + +45->60 + + - - -45->116 - - + + +61 + +taxon_shard_dragen +n_shard: 4 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +45->61 + + - - -120 - -taxon_shard_dragen + + +129 + +taxon_shard_saturated_reads_extract - - -45->120 - - - - - -177 - -taxon_prefilter_shard_saturated_reads_extract - - - -45->177 - - - - - -181 - -taxon_shard_saturated_reads_extract - - - -45->181 - - + + +45->129 + + 46 - -derep_fastqc -tool: low_complexity + +derep_fastqc +tool: low_complexity - + 46->1 - - + + - + 47->46 - - + + - - -49 - -prefilter_reads_extract + + +48 + +taxon_shard_dragen +n_shard: 2 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +47->48 + + - - -47->49 - - + + +51 + +taxon_shard_dragen +n_shard: 2 +read_type_map: collapsed +ref: hires_organelles_viruses_smags +tot_shards: 2 + + + +47->51 + + 56 - -taxon_prefilter_shard_dragen + +taxon_shard_dragen +n_shard: 3 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 - + 47->56 - - + + 57 - -taxon_prefilter_shard_dragen_csv -n_shard: 1 -read_type_map: collapsed -ref: hires_organelles_viruses_smags -tot_shards: 2 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: refseq_mitoch +tot_shards: 1 - + 47->57 - - + + - - -60 - -taxon_prefilter_shard_dragen + + +58 + +taxon_shard_dragen +n_shard: 4 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +47->58 + + - - -47->60 - - + + +59 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: human_genome +tot_shards: 1 + + + +47->59 + + - - -61 - -taxon_prefilter_shard_dragen_csv -n_shard: 1 -read_type_map: collapsed -ref: human_genome -tot_shards: 1 - - - -47->61 - - + + +62 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +47->62 + + 63 - -taxon_prefilter_shard_dragen + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: hires_organelles_viruses_smags +tot_shards: 2 - + 47->63 - - + + - - -64 - -taxon_prefilter_shard_dragen_csv -n_shard: 2 -read_type_map: collapsed -ref: hires_organelles_viruses_smags -tot_shards: 2 - - - -47->64 - - + + +128 + +taxon_shard_saturated_reads_extract - - -110 - -taxon_shard_dragen + + +47->128 + + - - -47->110 - - + + +48->1 + + - - -112 - -taxon_shard_dragen + + +67 + +taxon_shard_saturated_reads_remove - - -47->112 - - + + +48->67 + + - - -114 - -taxon_shard_dragen + + +76 + +taxon_shard_count_alns - - -47->114 - - + + +48->76 + + - - -118 - -taxon_shard_dragen + + +49->1 + + - - -47->118 - - + + +94 + +taxon_shard_saturated_reads_remove - - -122 - -taxon_shard_dragen + + +49->94 + + - - -47->122 - - - - - -176 - -taxon_prefilter_shard_saturated_reads_extract - - - -47->176 - - - - - -180 - -taxon_shard_saturated_reads_extract - - - -47->180 - - + + +103 + +taxon_shard_count_alns - - -48 - -prefilter_fastqc + + +49->103 + + - - -48->1 - - + + +50->1 + + - - -49->48 - - + + +100 + +taxon_shard_count_alns - - -111 - -taxon_shard_dragen_csv -n_shard: 2 -ref: core_nt -tot_shards: 4 + + +50->100 + + - - -49->111 - - + + +109 + +taxon_shard_saturated_reads_remove - - -113 - -taxon_shard_dragen_csv -n_shard: 1 -ref: core_nt -tot_shards: 4 + + +50->109 + + - - -49->113 - - + + +51->1 + + - - -115 - -taxon_shard_dragen_csv -n_shard: 4 -ref: core_nt -tot_shards: 4 + + +69 + +taxon_shard_count_alns - - -49->115 - - + + +51->69 + + - - -119 - -taxon_shard_dragen_csv -n_shard: 1 -ref: refseq_mitoch -tot_shards: 1 + + +90 + +taxon_shard_saturated_reads_remove - - -49->119 - - + + +51->90 + + - - -123 - -taxon_shard_dragen_csv -n_shard: 3 -ref: core_nt -tot_shards: 4 + + +52->1 + + - - -49->123 - - + + +99 + +taxon_shard_count_alns - - -50 - -prefilter_reads_merge + + +52->99 + + - - -50->49 - - + + +113 + +taxon_shard_saturated_reads_remove - - -51 - -prefilter_reads_taxonomy + + +52->113 + + - - -51->50 - - + + +53->1 + + - - -52 - -taxon_prefilter_align_merge + + +102 + +taxon_shard_count_alns - - -52->51 - - + + +53->102 + + + + + +111 + +taxon_shard_saturated_reads_remove + + + +53->111 + + + + + +54->1 + + 96 - -taxon_prefilter_align_stats + +taxon_shard_count_alns - - -52->96 - - + + +54->96 + + - - -99 - -taxon_prefilter_metadmg_lca + + +117 + +taxon_shard_saturated_reads_remove - - -52->99 - - + + +54->117 + + - - -178 - -taxon_prefilter_metadmg_damage + + +55->1 + + - - -52->178 - - + + +97 + +taxon_shard_count_alns - - -53 - -taxon_prefilter_shard_sort_query + + +55->97 + + - - -53->52 - - + + +115 + +taxon_shard_saturated_reads_remove - - -54 - -taxon_prefilter_shard_unicorn + + +55->115 + + - - -54->53 - - + + +56->1 + + - - -55 - -taxon_prefilter_shard_saturated_reads_remove + + +70 + +taxon_shard_count_alns - - -55->54 - - + + +56->70 + + - - -56->1 - - + + +88 + +taxon_shard_saturated_reads_remove - - -56->55 - - + + +56->88 + + - - -65 - -taxon_prefilter_shard_count_alns + + +57->1 + + - - -56->65 - - + + +75 + +taxon_shard_count_alns - - -57->56 - - + + +57->75 + + - - -58 - -taxon_prefilter_shard_saturated_reads_filter + + +84 + +taxon_shard_saturated_reads_remove + + + +57->84 + + + + + +58->1 + + - - -58->50 - - + + +74 + +taxon_shard_count_alns - - -58->55 - - + + +58->74 + + - - -68 - -taxon_prefilter_shard_saturated_reads_remove + + +80 + +taxon_shard_saturated_reads_remove - - -58->68 - - + + +58->80 + + + + + +59->1 + + 71 - -taxon_prefilter_shard_saturated_reads_remove + +taxon_shard_count_alns - - -58->71 - - - - - -58->176 - - + + +59->71 + + - - -59 - -taxon_prefilter_shard_count_alns + + +78 + +taxon_shard_saturated_reads_remove - - -59->58 - - + + +59->78 + + - + 60->1 - - + + - - -60->59 - - + + +98 + +taxon_shard_count_alns - - -60->68 - - + + +60->98 + + - - -61->60 - - + + +105 + +taxon_shard_saturated_reads_remove - - -62 - -taxon_prefilter_shard_count_alns + + +60->105 + + - - -62->58 - - + + +61->1 + + - - -63->1 - - + + +101 + +taxon_shard_count_alns - - -63->62 - - + + +61->101 + + - - -63->71 - - + + +107 + +taxon_shard_saturated_reads_remove - - -64->63 - - + + +61->107 + + - - -65->58 - - + + +62->1 + + - - -66 - -taxon_prefilter_shard_sort_query + + +72 + +taxon_shard_count_alns - - -66->52 - - + + +62->72 + + - - -67 - -taxon_prefilter_shard_unicorn + + +86 + +taxon_shard_saturated_reads_remove - + + +62->86 + + + + + +63->1 + + + + + +73 + +taxon_shard_count_alns + + -67->66 - - +63->73 + + - - -68->67 - - + + +82 + +taxon_shard_saturated_reads_remove - - -69 - -taxon_prefilter_shard_sort_query + + +63->82 + + - - -69->52 - - + + +64 + +taxon_align_samtools_stats - - -70 - -taxon_prefilter_shard_unicorn + + +64->1 + + - - -70->69 - - + + +65 + +taxon_align_merge - - -71->70 - - + + +65->64 + + - - -72 - -prefilter_fastqc + + +119 + +taxon_align_sort_taxon - - -72->1 - - + + +65->119 + + - - -73->72 - - + + +123 + +taxon_metadmg_lca - - -105 - -taxon_shard_dragen_csv -n_shard: 4 -ref: core_nt -tot_shards: 4 + + +65->123 + + - - -73->105 - - + + +130 + +taxon_metadmg_damage - - -107 - -taxon_shard_dragen_csv -n_shard: 3 -ref: core_nt -tot_shards: 4 + + +65->130 + + - - -73->107 - - + + +66 + +taxon_shard_unicorn_refstats - - -109 - -taxon_shard_dragen_csv -n_shard: 2 -ref: core_nt -tot_shards: 4 + + +66->65 + + - - -73->109 - - + + +67->66 + + - - -117 - -taxon_shard_dragen_csv -n_shard: 1 -ref: core_nt -tot_shards: 4 + + +68 + +taxon_shard_saturated_reads_filter - - -73->117 - - + + +68->67 + + - - -121 - -taxon_shard_dragen_csv -n_shard: 1 -ref: refseq_mitoch -tot_shards: 1 + + +68->78 + + - - -73->121 - - + + +68->80 + + - - -74 - -prefilter_reads_merge + + +68->82 + + - - -74->73 - - + + +68->84 + + - - -75 - -prefilter_reads_taxonomy + + +68->86 + + - - -75->74 - - + + +68->88 + + - - -76 - -taxon_prefilter_align_merge + + +68->90 + + - - -76->75 - - + + +68->128 + + - - -97 - -taxon_prefilter_align_stats + + +69->68 + + - - -76->97 - - + + +70->68 + + - - -101 - -taxon_prefilter_metadmg_lca + + +71->68 + + - - -76->101 - - - - - -179 - -taxon_prefilter_metadmg_damage - - - -76->179 - - + + +72->68 + + + + + +73->68 + + + + + +74->68 + + + + + +75->68 + + + + + +76->68 + + 77 - -taxon_prefilter_shard_sort_query - - - -77->76 - - + +taxon_shard_unicorn_refstats - - -78 - -taxon_prefilter_shard_unicorn + + +77->65 + + - + 78->77 - - + + 79 - -taxon_prefilter_shard_saturated_reads_remove - - - -79->78 - - + +taxon_shard_unicorn_refstats - - -80->1 - - + + +79->65 + + - + 80->79 - - - - - -89 - -taxon_prefilter_shard_count_alns - - - -80->89 - - - - - -81->80 - - - - - -82 - -taxon_prefilter_shard_saturated_reads_filter - - - -82->74 - - - - - -82->79 - - - - - -92 - -taxon_prefilter_shard_saturated_reads_remove - - - -82->92 - - + + - - -95 - -taxon_prefilter_shard_saturated_reads_remove + + +81 + +taxon_shard_unicorn_refstats - - -82->95 - - + + +81->65 + + - - -82->177 - - + + +82->81 + + 83 - -taxon_prefilter_shard_count_alns - - - -83->82 - - + +taxon_shard_unicorn_refstats - - -84->1 - - + + +83->65 + + - + 84->83 - - - - - -84->92 - - - - - -85->84 - - + + - - -86 - -taxon_prefilter_shard_count_alns + + +85 + +taxon_shard_unicorn_refstats - - -86->82 - - + + +85->65 + + - - -87->1 - - + + +86->85 + + - - -87->86 - - + + +87 + +taxon_shard_unicorn_refstats - - -87->95 - - + + +87->65 + + - + 88->87 - - + + - - -89->82 - - + + +89 + +taxon_shard_unicorn_refstats - - -90 - -taxon_prefilter_shard_sort_query + + +89->65 + + - - -90->76 - - + + +90->89 + + 91 - -taxon_prefilter_shard_unicorn + +taxon_align_samtools_stats - - -91->90 - - + + +91->1 + + + + + +92 + +taxon_align_merge - + 92->91 - - + + + + + +121 + +taxon_align_sort_taxon + + + +92->121 + + + + + +125 + +taxon_metadmg_lca + + + +92->125 + + + + + +131 + +taxon_metadmg_damage + + + +92->131 + + 93 - -taxon_prefilter_shard_sort_query - - - -93->76 - - + +taxon_shard_unicorn_refstats - - -94 - -taxon_prefilter_shard_unicorn + + +93->92 + + - + 94->93 - - + + + + + +95 + +taxon_shard_saturated_reads_filter - + 95->94 - - + + - - -96->1 - - - - - -97->1 - - + + +95->105 + + - - -98 - -taxon_prefilter_metadmg_dfit + + +95->107 + + - - -98->1 - - + + +95->109 + + - - -102 - -taxon_prefilter_metadmg_aggregate + + +95->111 + + - - -98->102 - - + + +95->113 + + - - -99->98 - - + + +95->115 + + - - -99->102 - - + + +95->117 + + - - -100 - -taxon_prefilter_metadmg_dfit + + +95->129 + + - - -100->1 - - + + +96->95 + + - - -103 - -taxon_prefilter_metadmg_aggregate + + +97->95 + + - - -100->103 - - + + +98->95 + + - - -101->100 - - + + +99->95 + + - - -101->103 - - + + +100->95 + + - - -102->0 - - + + +101->95 + + - - -102->1 - - + + +102->95 + + - - -103->0 - - + + +103->95 + + - - -103->1 - - + + +104 + +taxon_shard_unicorn_refstats - - -104->1 - - - - - -153 - -taxon_shard_count_alns - - - -104->153 - - - - - -169 - -taxon_shard_saturated_reads_remove - - - -104->169 - - + + +104->92 + + - + 105->104 - - + + - - -106->1 - - - - - -155 - -taxon_shard_count_alns - - - -106->155 - - - - - -166 - -taxon_shard_saturated_reads_remove - - - -106->166 - - + + +106 + +taxon_shard_unicorn_refstats + + + +106->92 + + - + 107->106 - - + + - - -108->1 - - - - - -157 - -taxon_shard_count_alns - - - -108->157 - - - - - -160 - -taxon_shard_saturated_reads_remove - - - -108->160 - - + + +108 + +taxon_shard_unicorn_refstats + + + +108->92 + + - + 109->108 - - + + - - -110->1 - - - - - -134 - -taxon_shard_count_alns - - - -110->134 - - - - - -137 - -taxon_shard_saturated_reads_remove - - - -110->137 - - + + +110 + +taxon_shard_unicorn_refstats + + + +110->92 + + - + 111->110 - - + + - - -112->1 - - + + +112 + +taxon_shard_unicorn_refstats - - -131 - -taxon_shard_count_alns - - - -112->131 - - - - - -140 - -taxon_shard_saturated_reads_remove - - - -112->140 - - + + +112->92 + + - + 113->112 - - + + - - -114->1 - - + + +114 + +taxon_shard_unicorn_refstats - - -130 - -taxon_shard_count_alns - - - -114->130 - - - - - -146 - -taxon_shard_saturated_reads_remove - - - -114->146 - - + + +114->92 + + - + 115->114 - - + + - - -116->1 - - - - - -154 - -taxon_shard_count_alns - - - -116->154 - - - - - -163 - -taxon_shard_saturated_reads_remove - - - -116->163 - - + + +116 + +taxon_shard_unicorn_refstats + + + +116->92 + + - + 117->116 - - + + + + + +118 + +taxon_align_unicorn_taxstats - + 118->1 - - - - - -128 - -taxon_shard_saturated_reads_remove - - - -118->128 - - - - - -133 - -taxon_shard_count_alns - - - -118->133 - - + + - + 119->118 - - + + + + + +120 + +taxon_align_unicorn_taxstats - + 120->1 - - - - - -151 - -taxon_shard_saturated_reads_remove - - - -120->151 - - - - - -156 - -taxon_shard_count_alns - - - -120->156 - - + + - + 121->120 - - + + + + + +122 + +taxon_metadmg_dfit - + 122->1 - - - - - -132 - -taxon_shard_count_alns - - - -122->132 - - - - - -143 - -taxon_shard_saturated_reads_remove - - - -122->143 - - + + + + + +126 + +taxon_metadmg_aggregate + + + +122->126 + + - + 123->122 - - + + + + + +123->126 + + 124 - -taxon_align_stats + +taxon_metadmg_dfit - + 124->1 - - - - - -125 - -taxon_align_merge - - - -125->124 - - - - - -171 - -taxon_metadmg_lca - - - -125->171 - - - - - -182 - -taxon_metadmg_damage - - - -125->182 - - - - - -126 - -taxon_shard_sort_query - - - -126->125 - - + + 127 - -taxon_shard_unicorn + +taxon_metadmg_aggregate - - -127->126 - - + + +124->127 + + - - -128->127 - - + + +125->124 + + - - -129 - -taxon_shard_saturated_reads_filter - - - -129->128 - - - - - -129->137 - - - - - -129->140 - - - - - -129->143 - - - - - -129->146 - - - - - -129->180 - - - - - -130->129 - - - - - -131->129 - - - - - -132->129 - - - - - -133->129 - - - - - -134->129 - - - - - -135 - -taxon_shard_sort_query - - - -135->125 - - - - - -136 - -taxon_shard_unicorn - - - -136->135 - - - - - -137->136 - - - - - -138 - -taxon_shard_sort_query - - - -138->125 - - - - - -139 - -taxon_shard_unicorn - - - -139->138 - - - - - -140->139 - - - - - -141 - -taxon_shard_sort_query - - - -141->125 - - - - - -142 - -taxon_shard_unicorn - - - -142->141 - - - - - -143->142 - - - - - -144 - -taxon_shard_sort_query - - - -144->125 - - - - - -145 - -taxon_shard_unicorn - - - -145->144 - - - - - -146->145 - - - - - -147 - -taxon_align_stats - - - -147->1 - - - - - -148 - -taxon_align_merge - - - -148->147 - - - - - -173 - -taxon_metadmg_lca - - - -148->173 - - - - - -183 - -taxon_metadmg_damage - - - -148->183 - - - - - -149 - -taxon_shard_sort_query - - - -149->148 - - - - - -150 - -taxon_shard_unicorn - - - -150->149 - - - - - -151->150 - - - - - -152 - -taxon_shard_saturated_reads_filter - - - -152->151 - - - - - -152->160 - - - - - -152->163 - - - - - -152->166 - - - - - -152->169 - - - - - -152->181 - - - - - -153->152 - - - - - -154->152 - - - - - -155->152 - - - - - -156->152 - - - - - -157->152 - - - - - -158 - -taxon_shard_sort_query - - - -158->148 - - - - - -159 - -taxon_shard_unicorn - - - -159->158 - - - - - -160->159 - - - - - -161 - -taxon_shard_sort_query - - - -161->148 - - - - - -162 - -taxon_shard_unicorn - - - -162->161 - - - - - -163->162 - - - - - -164 - -taxon_shard_sort_query - - - -164->148 - - - - - -165 - -taxon_shard_unicorn - - - -165->164 - - - - - -166->165 - - - - - -167 - -taxon_shard_sort_query - - - -167->148 - - - - - -168 - -taxon_shard_unicorn - - - -168->167 - - - - - -169->168 - - - - - -170 - -taxon_metadmg_dfit - - - -170->1 - - - - - -174 - -taxon_metadmg_aggregate - - - -170->174 - - - - - -171->170 - - - - - -171->174 - - - - - -172 - -taxon_metadmg_dfit - - - -172->1 - - - - - -175 - -taxon_metadmg_aggregate - - - -172->175 - - - - - -173->172 - - - - - -173->175 - - - - - -174->0 - - + + +125->127 + + - - -174->1 - - + + +126->0 + + - - -175->0 - - + + +126->1 + + - - -175->1 - - + + +127->0 + + + + + +127->1 + + - + -176->0 - - +128->0 + + - + -177->0 - - +129->0 + + - + -178->0 - - +130->0 + + - + -179->0 - - - - - -180->0 - - - - - -181->0 - - - - - -182->0 - - - - - -183->0 - - +131->0 + + diff --git a/examples/dragen/filegraph.svg b/examples/dragen/filegraph.svg index 990f9ca..c168ee5 100644 --- a/examples/dragen/filegraph.svg +++ b/examples/dragen/filegraph.svg @@ -1,1346 +1,842 @@ - - - + + snakemake_dag - + 0 -target_taxon - -↪ input - -reports/multiqc.taxon.html -reports/multiqc_data.taxon.zip -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/prefilter_reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/prefilter_reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/prefilter_reads/saturated/Lib_LVsim2_collapsed.fastq.gz -results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/reads/saturated/Lib_LVsim2_collapsed.fastq.gz -stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/metadmg/damage/Lib_LVsim2_collapsed.stat.gz -stats/prefilter_metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/prefilter_metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/prefilter_metadmg/damage/Lib_LVsim2_collapsed.stat.gz -   - - - +multiqc_taxon_upload + +↪ input + +reports/multiqc.taxon.html +reports/multiqc_data.taxon.zip +reports/multiqc_data.taxon.zip +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz +results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz +results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz +results/reads/saturated/Lib_LVsim2_collapsed.fastq.gz +stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz +stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz +stats/metadmg/damage/Lib_LVsim2_collapsed.stat.gz + +output → + +stats/reports/multiqc_taxon.upload.flag + + + 1 -multiqc_taxon - -↪ input - -/maps/projects/caeg/people/lnc113/workflows/aeDNA/aeDNA/workflow/resources/multiqc_config.yaml -logs/prefilter_shards/dragen/Lib_LVsim1_collapsed.hires_organelles_viruses_smags.1-of-2.log -logs/prefilter_shards/dragen/Lib_LVsim1_collapsed.hires_organelles_viruses_smags.2-of-2.log -logs/prefilter_shards/dragen/Lib_LVsim1_collapsed.human_genome.1-of-1.log -logs/prefilter_shards/dragen/Lib_LVsim2_collapsed.hires_organelles_viruses_smags.1-of-2.log -logs/prefilter_shards/dragen/Lib_LVsim2_collapsed.hires_organelles_viruses_smags.2-of-2.log -logs/prefilter_shards/dragen/Lib_LVsim2_collapsed.human_genome.1-of-1.log -logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.1-of-4.log -logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.2-of-4.log -logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.3-of-4.log -logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.4-of-4.log -logs/shards/dragen/Lib_LVsim1_collapsed.refseq_mitoch.1-of-1.log -logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.1-of-4.log -logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.2-of-4.log -logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.3-of-4.log -logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.4-of-4.log -logs/shards/dragen/Lib_LVsim2_collapsed.refseq_mitoch.1-of-1.log -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/prefilter_metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/prefilter_metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/prefilter_metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz -stats/aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools_stats/Lib_LVsim2_collapsed.txt -stats/aligns/samtools_stats/Lib_LVsim2_collapsed.txt -stats/prefilter_aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools_stats/Lib_LVsim2_collapsed.txt -stats/prefilter_aligns/samtools_stats/Lib_LVsim2_collapsed.txt -stats/reads/fastqc/derep/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/derep/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/low_complexity/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/low_complexity/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/merge_lanes/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/merge_lanes/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/prefilter/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/prefilter/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/prefilter/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L001_R1.html -stats/reads/fastqc/raw/Lib_LVsim1_L001_R1_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L001_R2.html -stats/reads/fastqc/raw/Lib_LVsim1_L001_R2_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L002_R1.html -stats/reads/fastqc/raw/Lib_LVsim1_L002_R1_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L002_R2.html -stats/reads/fastqc/raw/Lib_LVsim1_L002_R2_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim2_L001_R1.html -stats/reads/fastqc/raw/Lib_LVsim2_L001_R1_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim2_L001_R2.html -stats/reads/fastqc/raw/Lib_LVsim2_L001_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_R1.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_R1_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_R2.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_R1.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_R1_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_R2.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_R1.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_R1_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_R2.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton_fastqc.zip -stats/reads/nonpareil/merge_lanes/Lib_LVsim1_collapsed.json -stats/reads/nonpareil/merge_lanes/Lib_LVsim2_collapsed.json -stats/reads/trim/Lib_LVsim1_L001_pe.settings -stats/reads/trim/Lib_LVsim1_L002_pe.settings -stats/reads/trim/Lib_LVsim2_L001_pe.settings - -output → - -reports/multiqc.taxon.html -reports/multiqc_data.taxon.zip - - - +multiqc_taxon + +↪ input + +/maps/projects/caeg/people/lnc113/workflows/aeDNA/aeDNA/workflow/resources/multiqc_config.yaml +logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.1-of-4.log +logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.2-of-4.log +logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.3-of-4.log +logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.4-of-4.log +logs/shards/dragen/Lib_LVsim1_collapsed.hires_organelles_viruses_smags.1-of-2.log +logs/shards/dragen/Lib_LVsim1_collapsed.hires_organelles_viruses_smags.2-of-2.log +logs/shards/dragen/Lib_LVsim1_collapsed.human_genome.1-of-1.log +logs/shards/dragen/Lib_LVsim1_collapsed.refseq_mitoch.1-of-1.log +logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.1-of-4.log +logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.2-of-4.log +logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.3-of-4.log +logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.4-of-4.log +logs/shards/dragen/Lib_LVsim2_collapsed.hires_organelles_viruses_smags.1-of-2.log +logs/shards/dragen/Lib_LVsim2_collapsed.hires_organelles_viruses_smags.2-of-2.log +logs/shards/dragen/Lib_LVsim2_collapsed.human_genome.1-of-1.log +logs/shards/dragen/Lib_LVsim2_collapsed.refseq_mitoch.1-of-1.log +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz +results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz +results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz +results/metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv +stats/aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv +stats/aligns/unicorn/taxstats/Lib_LVsim2_collapsed.tsv +stats/reads/fastqc/derep/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/derep/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/low_complexity/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/low_complexity/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/merge_lanes/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/merge_lanes/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L001_R1.html +stats/reads/fastqc/raw/Lib_LVsim1_L001_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L001_R2.html +stats/reads/fastqc/raw/Lib_LVsim1_L001_R2_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L002_R1.html +stats/reads/fastqc/raw/Lib_LVsim1_L002_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L002_R2.html +stats/reads/fastqc/raw/Lib_LVsim1_L002_R2_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim2_L001_R1.html +stats/reads/fastqc/raw/Lib_LVsim2_L001_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim2_L001_R2.html +stats/reads/fastqc/raw/Lib_LVsim2_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_R1.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_R2.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_R1.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_R2.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_R1.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_R2.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton_fastqc.zip +stats/reads/nonpareil/merge_lanes/Lib_LVsim1_collapsed.json +stats/reads/nonpareil/merge_lanes/Lib_LVsim2_collapsed.json +stats/reads/trim/Lib_LVsim1_L001_pe.settings +stats/reads/trim/Lib_LVsim1_L002_pe.settings +stats/reads/trim/Lib_LVsim2_L001_pe.settings + +output → + +reports/multiqc.taxon.html +reports/multiqc_data.taxon.zip + + + - + 1->0 - - + + 2 -trim_fastqc_raw - -↪ input - -results/reads/raw/{sample}_{library}_{lane}_{read_type_raw}.fastq.gz - -output → - -stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.html -stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}_fastqc.zip - - - +trim_fastqc_raw + +↪ input + +results/reads/raw/{sample}_{library}_{lane}_{read_type_raw}.fastq.gz + +output → + +stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R1|R2}.html +stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R1|R2}_fastqc.zip + + + - + 2->1 - - + + 3 -trim_get_fastq_raw - -↪ input - -<input function> - -output → - -results/reads/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.fastq.gz - - - +trim_get_fastq_raw + +↪ input + +<input function> + +output → + +results/reads/raw/{sample}_{library}_{lane}_{read_type_raw,R1|R2}.fastq.gz + + + - + 3->2 - - + + 4 -trim_adapterremoval_fastq_pe - -↪ input - -<input function> - -output → - -results/reads/trim/{sample}_{library}_{lane}_R1.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_R2.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_collapsed.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_collapsedtrunc.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_discarded.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_singleton.fastq.gz -stats/reads/trim/{sample}_{library}_{lane}_pe.settings - - - +trim_adapterremoval_fastq_pe + +↪ input + +<input function> + +output → + +results/reads/trim/{sample}_{library}_{lane}_R1.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_R2.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_collapsed.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_collapsedtrunc.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_discarded.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_singleton.fastq.gz +stats/reads/trim/{sample}_{library}_{lane}_pe.settings + + + - + 3->4 - - + + - + 4->1 - - + + 5 -trim_fastqc_trim - -↪ input - -results/reads/trim/{sample}_{library}_{lane}_{read_type_trim}.fastq.gz - -output → - -stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,R1|singleton|collapsedtrunc|R2|collapsed}.html -stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,R1|singleton|collapsedtrunc|R2|collapsed}_fastqc.zip - - - +trim_fastqc_trim + +↪ input + +results/reads/trim/{sample}_{library}_{lane}_{read_type_trim}.fastq.gz + +output → + +stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,R1|collapsedtrunc|collapsed|singleton|R2}.html +stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,R1|collapsedtrunc|collapsed|singleton|R2}_fastqc.zip + + + - + 4->5 - - + + 7 -derep_merge_lanes - -↪ input - -<input function> - -output → - -temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz - - - +derep_merge_lanes + +↪ input + +<input function> + +output → + +temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz + + + - + 4->7 - - + + - + 5->1 - - + + 6 -derep_fastqc - -↪ input - -<input function> - -output → - -stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}.html -stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}_fastqc.zip - - - +derep_fastqc + +↪ input + +<input function> + +output → + +stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}.html +stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}_fastqc.zip + + + 6->1 - - + + - + 7->6 - - + + 9 -derep_nonpareil_infer - -↪ input - -<input function> - -output → - -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.log -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npa -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npc -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo - - - +derep_nonpareil_infer + +↪ input + +<input function> + +output → + +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.log +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npa +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npc +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo + + + - + 7->9 - - + + 10 -derep_seqkit - -↪ input - -temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz - -output → - -stats/reads/derep/{sample}_{library}_{read_type_trim}.dup.tsv -temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz - - - +derep_seqkit + +↪ input + +temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz + +output → + +stats/reads/derep/{sample}_{library}_{read_type_trim}.dup.tsv +temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz + + + - + 7->10 - - + + 8 -derep_nonpareil_plot - -↪ input - -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo - -output → - -reports/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.pdf -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.json -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.tsv - - - +derep_nonpareil_plot + +↪ input + +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo + +output → + +reports/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.pdf +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.json +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.tsv + + + - + 8->1 - - + + - + 9->8 - - + + - + 10->6 - - + + 11 -derep_low_complexity - -↪ input - -temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz - -output → - -results/reads/low_complexity/{sample}_{library}_{read_type_trim}.fastq.gz -stats/reads/low_complexity/{sample}_{library}_{read_type_trim}.txt -temp/reads/low_complexity/{sample}_{library}_{read_type_trim}.discarded.fastq.gz - - - +derep_low_complexity + +↪ input + +temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz + +output → + +results/reads/low_complexity/{sample}_{library}_{read_type_trim}.fastq.gz +stats/reads/low_complexity/{sample}_{library}_{read_type_trim}.txt +temp/reads/low_complexity/{sample}_{library}_{read_type_trim}.discarded.fastq.gz + + + - + 10->11 - - + + - + 11->6 - - - - - -13 -prefilter_reads_extract - -↪ input - -<input function> -temp/reads/prefilter/merge/{sample}_{library}_{read_type_map}.read_ids - -output → - -results/reads/prefilter/extract/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.fastq.gz - - - - - - -11->13 - - - - - -20 -taxon_prefilter_shard_dragen - -↪ input - -<input function> -temp/prefilter_shards/dragen/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.csv - -output → - -temp/prefilter_shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -11->20 - - - - - -21 -taxon_prefilter_shard_dragen_csv - -↪ input - -<input function> - -output → - -temp/prefilter_shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.csv - - - - - - -11->21 - - - - - -28 -taxon_shard_dragen - -↪ input - -<input function> -temp/shards/dragen/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.csv - -output → - -temp/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -11->28 - - - - - -40 -taxon_prefilter_shard_saturated_reads_extract - -↪ input - -<input function> -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -results/prefilter_reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz - - - - - - -11->40 - - - - - -42 -taxon_shard_saturated_reads_extract - -↪ input - -<input function> -temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -results/reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz - - - - - - -11->42 - - + + 12 -prefilter_fastqc - -↪ input - -results/reads/prefilter/extract/{sample}_{library}_{read_type_map}.fastq.gz - -output → - -stats/reads/fastqc/prefilter/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.html -stats/reads/fastqc/prefilter/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}_fastqc.zip - - - +taxon_shard_dragen + +↪ input + +<input function> + +output → + +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.fastqc.csv +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.json +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.map.csv +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.ploidy.csv +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.replay.json +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.time.csv +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.trim.csv +temp/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam +temp/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam.md5sum + + + + + + +11->12 + + + + + +24 +taxon_shard_saturated_reads_extract + +↪ input + +<input function> +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv + +output → + +results/reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz + + + + + + +11->24 + + - + 12->1 - - + + - + + +16 +taxon_shard_saturated_reads_remove + +↪ input + +<input function> +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv + +output → + +temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +12->16 + + + + + +18 +taxon_shard_count_alns + +↪ input + +<input function> + +output → + +temp/shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv + + + + + -13->12 - - - - - -29 -taxon_shard_dragen_csv - -↪ input - -<input function> - -output → - -temp/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.csv - - - - - - -13->29 - - +12->18 + + + + + +13 +taxon_align_samtools_stats + +↪ input + +results/aligns/merge/{sample}_{library}_{read_type_map}.bam + +output → + +stats/aligns/samtools/stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt + + + + + + +13->1 + + 14 -prefilter_reads_merge - -↪ input - -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv -temp/reads/prefilter/taxonomy/{sample}_{library}_{read_type_map}.read_ids - -output → - -temp/reads/prefilter/merge/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.read_ids - - - +taxon_align_merge + +↪ input + +<input function> + +output → + +results/aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam + + + - + 14->13 - - + + + + + +20 +taxon_align_sort_taxon + +↪ input + +results/aligns/merge/{sample}_{library}_{read_type_map}.bam + +output → + +temp/aligns/sort_taxon/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam + + + + + + +14->20 + + + + + +22 +taxon_metadmg_lca + +↪ input + +<function <lambda> at 0x7f7cc7f07950> +data/core_nt.acc2taxid.gz +data/human.acc2taxid.gz +data/mitoch.acc2taxid.gz +data/prok.acc2taxid.gz +data/taxdump/names.dmp +data/taxdump/nodes.dmp + +output → + +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.family.bam +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.used.bam +stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz +stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +14->22 + + + + + +25 +taxon_metadmg_damage + +↪ input + +<function <lambda> at 0x7f7cc7f077f0> + +output → + +results/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz +stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz +stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +14->25 + + 15 -prefilter_reads_taxonomy - -↪ input - -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/names.dmp -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/nodes.dmp -data/human.acc2taxid.gz -data/prok.acc2taxid.gz -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -temp/reads/prefilter/taxonomy/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.read_ids - - - +taxon_shard_unicorn_refstats + +↪ input + +<input function> +data/taxdump/names.dmp +data/taxdump/nodes.dmp +temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam + +output → + +stats/shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv +temp/shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + - + 15->14 - - - - - -16 -taxon_prefilter_align_merge - -↪ input - -<input function> - -output → - -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam - - - + + - + 16->15 - - - - - -24 -taxon_prefilter_align_stats - -↪ input - -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -stats/prefilter_aligns/samtools_stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt - - - - - - -16->24 - - - - - -26 -taxon_prefilter_metadmg_lca - -↪ input - -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/names.dmp -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/nodes.dmp -<function <lambda> at 0x7fef3af5f060> -data/human.acc2taxid.gz -data/prok.acc2taxid.gz - -output → - -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz -stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -16->26 - - - - - -41 -taxon_prefilter_metadmg_damage - -↪ input - -<function <lambda> at 0x7fef3af5f1a0> - -output → - -results/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -results/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.res.gz -stats/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -16->41 - - + + 17 -taxon_prefilter_shard_sort_query - -↪ input - -temp/prefilter_shards/unicorn/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam - -output → - -temp/prefilter_shards/sort_query/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - +taxon_shard_saturated_reads_filter + +↪ input + +temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.1-of-4.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.2-of-4.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.3-of-4.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.4-of-4.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.hires_organelles_viruses_smags.1-of-2.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.hires_organelles_viruses_smags.2-of-2.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.human_genome.1-of-1.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.refseq_mitoch.1-of-1.tsv + +output → + +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv + + + - + 17->16 - - + + - - -18 -taxon_prefilter_shard_unicorn - -↪ input - -temp/prefilter_shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam - -output → - -stats/prefilter_shards/unicorn/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv -temp/prefilter_shards/unicorn/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - + + +17->24 + + - + 18->17 - - + + 19 -taxon_prefilter_shard_saturated_reads_remove - -↪ input - -<input function> -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -temp/prefilter_shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -19->18 - - - - - -20->1 - - +taxon_align_unicorn_taxstats + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +temp/aligns/sort_taxon/{sample}_{library}_{read_type_map}.bam + +output → + +stats/aligns/unicorn/taxstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv + + + + + + +19->1 + + - + 20->19 - - + + + + + +21 +taxon_metadmg_dfit + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz + +output → + +results/metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz + + + + + + +21->1 + + 23 -taxon_prefilter_shard_count_alns - -↪ input - -<input function> - -output → - -temp/prefilter_shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv - - - - - - -20->23 - - - - - -21->20 - - - - - -22 -taxon_prefilter_shard_saturated_reads_filter - -↪ input - -temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.hires_organelles_viruses_smags.1-of-2.tsv -temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.hires_organelles_viruses_smags.2-of-2.tsv -temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.human_genome.1-of-1.tsv - -output → - -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv - - - - - - -22->14 - - - - - -22->19 - - - - - -22->40 - - - - - -23->22 - - - - - -24->1 - - - - - -25 -taxon_prefilter_metadmg_dfit - -↪ input - -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/names.dmp -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/nodes.dmp -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz - -output → - -results/prefilter_metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.boot.stat.gz -results/prefilter_metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz - - - - - - -25->1 - - - - - -27 -taxon_prefilter_metadmg_aggregate - -↪ input - -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/names.dmp -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/nodes.dmp -results/prefilter_metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz -stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz - -output → - -results/prefilter_metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -25->27 - - - - - -26->25 - - - - - -26->27 - - - - - -27->0 - - - - - -27->1 - - +taxon_metadmg_aggregate + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +results/metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz +results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz +stats/metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz + +output → + +results/metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +21->23 + + - - -28->1 - - - - - -34 -taxon_shard_saturated_reads_remove - -↪ input - -<input function> -temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -28->34 - - - - - -36 -taxon_shard_count_alns - -↪ input - -<input function> - -output → - -temp/shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv - - - - - - -28->36 - - - - - -29->28 - - - - - -30 -taxon_align_stats - -↪ input - -results/aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -stats/aligns/samtools_stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt - - - - - - -30->1 - - - - - -31 -taxon_align_merge - -↪ input - -<input function> - -output → - -results/aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam - - - - - - -31->30 - - - - - -38 -taxon_metadmg_lca - -↪ input - -<function <lambda> at 0x7fef3af5fd80> -data/core_nt.acc2taxid.gz -data/mitoch.acc2taxid.gz -data/taxdump/names.dmp -data/taxdump/nodes.dmp - -output → - -results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz -stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -31->38 - - - - - -43 -taxon_metadmg_damage - -↪ input - -<function <lambda> at 0x7fef3af5fce0> - -output → - -results/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -results/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.res.gz -stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -31->43 - - - - - -32 -taxon_shard_sort_query - -↪ input - -temp/shards/unicorn/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam - -output → - -temp/shards/sort_query/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -32->31 - - - - - -33 -taxon_shard_unicorn - -↪ input - -temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam - -output → - -stats/shards/unicorn/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv -temp/shards/unicorn/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -33->32 - - - - - -34->33 - - - - - -35 -taxon_shard_saturated_reads_filter - -↪ input - -temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.1-of-4.tsv -temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.2-of-4.tsv -temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.3-of-4.tsv -temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.4-of-4.tsv -temp/shards/count_alns/{sample}_{library}_collapsed.refseq_mitoch.1-of-1.tsv - -output → - -temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv - - - - - - -35->34 - - - - - -35->42 - - - - - -36->35 - - - - - -37 -taxon_metadmg_dfit - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz - -output → - -results/metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.boot.stat.gz -results/metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz - - - - - - -37->1 - - - - - -39 -taxon_metadmg_aggregate - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -results/metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz -results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz -stats/metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz - -output → - -results/metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -37->39 - - - - - -38->37 - - - - - -38->39 - - - - - -39->0 - - + + +22->21 + + - - -39->1 - - + + +22->23 + + - + -40->0 - - +23->0 + + - - -41->0 - - + + +23->1 + + - - -42->0 - - + + +24->0 + + - - -43->0 - - + + +25->0 + + diff --git a/examples/dragen/rulegraph.svg b/examples/dragen/rulegraph.svg index d9d66a8..7e83681 100644 --- a/examples/dragen/rulegraph.svg +++ b/examples/dragen/rulegraph.svg @@ -1,721 +1,421 @@ - - - + + snakemake_dag - + 0 - -target_taxon + +multiqc_taxon_upload 1 - -multiqc_taxon + +multiqc_taxon - + 1->0 - - + + 2 - -trim_fastqc_raw + +trim_fastqc_raw - + 2->1 - - + + 3 - -trim_get_fastq_raw + +trim_get_fastq_raw - + 3->2 - - + + 4 - -trim_adapterremoval_fastq_pe + +trim_adapterremoval_fastq_pe - + 3->4 - - + + - + 4->1 - - + + 5 - -trim_fastqc_trim + +trim_fastqc_trim - + 4->5 - - + + 7 - -derep_merge_lanes + +derep_merge_lanes - + 4->7 - - + + - + 5->1 - - + + 6 - -derep_fastqc + +derep_fastqc - + 6->1 - - + + - + 7->6 - - + + 9 - -derep_nonpareil_infer + +derep_nonpareil_infer - + 7->9 - - + + 10 - -derep_seqkit + +derep_seqkit - + 7->10 - - + + 8 - -derep_nonpareil_plot + +derep_nonpareil_plot - + 8->1 - - + + - + 9->8 - - + + - + 10->6 - - + + 11 - -derep_low_complexity + +derep_low_complexity - + 10->11 - - + + - + 11->6 - - - - - -13 - -prefilter_reads_extract - - - -11->13 - - - - - -20 - -taxon_prefilter_shard_dragen - - - -11->20 - - - - - -21 - -taxon_prefilter_shard_dragen_csv - - - -11->21 - - - - - -28 - -taxon_shard_dragen - - - -11->28 - - - - - -40 - -taxon_prefilter_shard_saturated_reads_extract - - - -11->40 - - - - - -42 - -taxon_shard_saturated_reads_extract - - - -11->42 - - + + 12 - -prefilter_fastqc + +taxon_shard_dragen + + + +11->12 + + + + + +24 + +taxon_shard_saturated_reads_extract + + + +11->24 + + - + 12->1 - - + + - + + +16 + +taxon_shard_saturated_reads_remove + + + +12->16 + + + + + +18 + +taxon_shard_count_alns + + -13->12 - - - - - -29 - -taxon_shard_dragen_csv - - - -13->29 - - +12->18 + + + + + +13 + +taxon_align_samtools_stats + + + +13->1 + + 14 - -prefilter_reads_merge + +taxon_align_merge - + 14->13 - - + + + + + +20 + +taxon_align_sort_taxon + + + +14->20 + + + + + +22 + +taxon_metadmg_lca + + + +14->22 + + + + + +25 + +taxon_metadmg_damage + + + +14->25 + + 15 - -prefilter_reads_taxonomy + +taxon_shard_unicorn_refstats - + 15->14 - - - - - -16 - -taxon_prefilter_align_merge + + - + 16->15 - - - - - -24 - -taxon_prefilter_align_stats - - - -16->24 - - - - - -26 - -taxon_prefilter_metadmg_lca - - - -16->26 - - - - - -41 - -taxon_prefilter_metadmg_damage - - - -16->41 - - + + 17 - -taxon_prefilter_shard_sort_query + +taxon_shard_saturated_reads_filter - + 17->16 - - + + - - -18 - -taxon_prefilter_shard_unicorn + + +17->24 + + - + 18->17 - - + + 19 - -taxon_prefilter_shard_saturated_reads_remove - - - -19->18 - - + +taxon_align_unicorn_taxstats - - -20->1 - - + + +19->1 + + - + 20->19 - - + + + + + +21 + +taxon_metadmg_dfit + + + +21->1 + + 23 - -taxon_prefilter_shard_count_alns - - - -20->23 - - + +taxon_metadmg_aggregate - - -21->20 - - - - - -22 - -taxon_prefilter_shard_saturated_reads_filter - - - -22->14 - - + + +21->23 + + - - -22->19 - - - - - -22->40 - - - - - -23->22 - - - - - -24->1 - - + + +22->21 + + - - -25 - -taxon_prefilter_metadmg_dfit + + +22->23 + + - - -25->1 - - - - - -27 - -taxon_prefilter_metadmg_aggregate - - - -25->27 - - - - - -26->25 - - - - - -26->27 - - - - + -27->0 - - - - - -27->1 - - +23->0 + + - - -28->1 - - - - - -34 - -taxon_shard_saturated_reads_remove - - - -28->34 - - - - - -36 - -taxon_shard_count_alns - - - -28->36 - - - - - -29->28 - - - - - -30 - -taxon_align_stats - - - -30->1 - - - - - -31 - -taxon_align_merge - - - -31->30 - - - - - -38 - -taxon_metadmg_lca - - - -31->38 - - - - - -43 - -taxon_metadmg_damage - - - -31->43 - - - - - -32 - -taxon_shard_sort_query - - - -32->31 - - - - - -33 - -taxon_shard_unicorn - - - -33->32 - - - - - -34->33 - - - - - -35 - -taxon_shard_saturated_reads_filter - - - -35->34 - - - - - -35->42 - - - - - -36->35 - - - - - -37 - -taxon_metadmg_dfit - - - -37->1 - - - - - -39 - -taxon_metadmg_aggregate - - - -37->39 - - - - - -38->37 - - - - - -38->39 - - - - - -39->0 - - - - - -39->1 - - - - - -40->0 - - - - + -41->0 - - +23->1 + + - + -42->0 - - +24->0 + + - - -43->0 - - + + +25->0 + + diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/config.yaml b/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/config.yaml deleted file mode 100644 index ae3df34..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/config.yaml +++ /dev/null @@ -1,142 +0,0 @@ - -# - Only tested with Phred33 quality scores - -samples: config/samples.tsv - -units: config/units.tsv - - - -############# -### READS ### -############# -trim: - trim: - activate: true - tool: adapterremoval - params: "--trimns --maxns 10 --trimqualities --minlength 30 --mask-degenerate-bases --seed 12345" - - # Ignored for SE - collapse: - activate: true - params: "--collapse-conservatively" - -derep: - extension: - activate: false - k: 16 - params: "ibb=t prefilter=0 el=100 er=100 ecc=f ecco=f ignorebadquality extendrollback=0" - - derep: - activate: true - # vsearch or seqkit - tool: seqkit - params: "" - - low_complex: - params: "entropy=0.7 entropywindow=30 entropyk=4" - - - -############# -### ALIGN ### -############# -prefilter: - taxa: "Bacteria,Archaea,Viruses" - - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: - prok: - n_shards: 2 - path: "data/prok.{n_shard}-of-2.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal -N 1" - bt2l: False - acc2taxid: "data/prok.acc2taxid.gz" - virus: - n_shards: 1 - path: "data/virus.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/virus.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 25 --weight_type 1 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2" - - -euk: - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: - mitoch: - n_shards: 1 - path: "data/mitoch.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/mitoch.acc2taxid.gz" - plastid: - n_shards: 1 - path: "data/plastid.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/plastid.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 15 --sim_score_low 0.95 --weight_type 0 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2 --seed 12345" - - -############ -## REPORT ## -############ -report: - multiqc: "--no-ai --verbose --cl-config 'custom_logo: data/KU_long.png' --cl-config 'custom_logo_title: CAEG - Center for Ancient Environmental Genomics' --cl-config 'custom_logo_url: https://globe.ku.dk/research/caeg/'" - multiqc_db_url: "test_qc.sqlite" diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/samples.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/samples.tsv deleted file mode 100644 index 5994081..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/samples.tsv +++ /dev/null @@ -1,2 +0,0 @@ -sample alias group condition -Lib ancient diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/units.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/units.tsv deleted file mode 100644 index 4a8a376..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/units.tsv +++ /dev/null @@ -1,4 +0,0 @@ -sample library flowcell lane seq_type library_type material data machine run_n sample_n date center platform adapters -Lib LVsim1 BHXXXXXXXX L001 PE ds DNA data/test_L001_R{Read}.fq.gz SIMULATED 0000 S1 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Lib LVsim1 BHXXXXXXXX L002 PE ds DNA data/test_L002_R{Read}.fq.gz SIMULATED 0000 S2 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Lib LVsim2 BHXXXXXXXX L001 PE ds DNA data/test_L003_R{Read}.fq.gz SIMULATED 0000 S3 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/data/results/reads/low_complexity/Lib_LVsim1_collapsed.fastq.gz b/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/data/results/reads/low_complexity/Lib_LVsim1_collapsed.fastq.gz deleted file mode 100644 index 3f41b8b..0000000 Binary files a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/data/results/reads/low_complexity/Lib_LVsim1_collapsed.fastq.gz and /dev/null differ diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/data/temp/reads/prefilter/merge/Lib_LVsim1_collapsed.read_ids b/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/data/temp/reads/prefilter/merge/Lib_LVsim1_collapsed.read_ids deleted file mode 100644 index fa544d4..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/data/temp/reads/prefilter/merge/Lib_LVsim1_collapsed.read_ids +++ /dev/null @@ -1,1300 +0,0 @@ -M_T0_RID0_S0_NC_030117.1:111953-112007_length:55_mod0000 -M_T0_RID0_S0_NZ_JBDYLZ010000006.1:232651-232713_length:63_mod0000 -M_T0_RID0_S0_NZ_JBDYRX010000003.1:638778-638845_length:68_mod0000 -M_T0_RID0_S0_NZ_JBDYSJ010000001.1:480453-480521_length:69_mod0000 -M_T0_RID0_S1_NC_029996.1:52049-52114_length:66_mod0000 -M_T0_RID0_S1_NC_029997.2:98154-98247_length:94_mod0001 -M_T0_RID0_S1_NC_033619.1:5054-5125_length:72_mod0000 -M_T0_RID1_S0_NZ_JBDYLZ010000006.1:89475-89546_length:72_mod0000 -M_T0_RID2_S0_NC_030240.1:124812-124864_length:53_mod0000 -M_T0_RID2_S0_NZ_JBDYLZ010000014.1:79367-79450_length:84_mod0000 -M_T0_RID2_S1_NC_029132.1:78897-78961_length:65_mod0000 -M_T0_RID3_S1_NC_029996.1:125237-125310_length:74_mod0000 -M_T0_RID3_S1_NC_030229.1:666-744_length:79_mod0000 -M_T0_RID4_S0_NZ_JBDYRX010000001.1:960749-960798_length:50_mod0000 -M_T0_RID4_S1_NZ_JBDYSJ010000003.1:80602-80671_length:70_mod0000 -M_T0_RID5_S0_NC_028371.1:3473-3533_length:61_mod0000 -M_T0_RID5_S0_NZ_JBDYLZ010000014.1:31093-31169_length:77_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000003.1:463476-463555_length:80_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000004.1:91279-91382_length:104_mod0000 -M_T0_RID5_S1_NC_031272.1:12737-12796_length:60_mod0000 -M_T0_RID5_S1_NZ_JBDYSJ010000001.1:152930-152976_length:47_mod0000 -M_T0_RID6_S0_NC_018093.1:1833-1947_length:115_mod0000 -M_T0_RID6_S1_NZ_JBDYSJ010000001.1:525478-525555_length:78_mod0000 -M_T0_RID7_S0_NC_027121.1:14835-14908_length:74_mod0000 -M_T0_RID7_S0_NC_030117.1:123232-123357_length:126_mod0000 -M_T0_RID7_S0_NC_033733.1:1775-1866_length:92_mod0000 -M_T0_RID7_S0_NC_033757.1:335-408_length:74_mod0000 -M_T0_RID7_S0_NC_033816.1:2121-2169_length:49_mod0000 -M_T0_RID7_S0_NZ_JBDYRX010000001.1:768041-768147_length:107_mod0000 -M_T0_RID7_S1_NZ_JBDYRX010000003.1:741729-741847_length:119_mod0000 -M_T0_RID8_S0_NC_028255.1:2339-2453_length:115_mod0000 -M_T0_RID8_S0_NC_028362.1:3644-3681_length:38_mod0000 -M_T0_RID8_S0_NC_030295.1:5058-5146_length:89_mod0000 -M_T0_RID8_S0_NZ_JBDYLZ010000011.1:65064-65142_length:79_mod0000 -M_T0_RID8_S1_NC_029996.1:15385-15439_length:55_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000001.1:372140-372170_length:31_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000002.1:184902-185028_length:127_mod0000 -M_T0_RID9_S0_NC_018175.1:751-814_length:64_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000001.1:128705-128756_length:52_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000003.1:717567-717638_length:72_mod0000 -M_T0_RID9_S1_NZ_JBDYRX010000001.1:708791-708875_length:85_mod0001 -M_T0_RID10_S1_NC_034266.1:180760-180821_length:62_mod0000 -M_T0_RID11_S0_NC_027126.1:6629-6712_length:84_mod0000 -M_T0_RID11_S0_NC_027426.1:3579-3717_length:139_mod0000 -M_T0_RID11_S1_NC_030117.1:3968-4065_length:98_mod0000 -M_T0_RID12_S0_NC_027016.1:206020-206105_length:86_mod0000 -M_T0_RID13_S0_NC_027915.1:11194-11270_length:77_mod0000 -M_T0_RID13_S1_NZ_JBDYLZ010000012.1:21748-21797_length:50_mod0000 -M_T0_RID13_S1_NZ_JBDYSJ010000002.1:219548-219618_length:71_mod0000 -M_T0_RID14_S0_NC_033816.1:7896-7995_length:100_mod0000 -M_T0_RID14_S0_NZ_JBDYRX010000001.1:272205-272307_length:103_mod0000 -M_T0_RID14_S0_NZ_JBDYSJ010000001.1:204692-204745_length:54_mod0000 -M_T0_RID14_S1_NC_031321.1:1201-1285_length:85_mod0000 -M_T0_RID14_S1_NC_034217.1:1799-1845_length:47_mod0000 -M_T0_RID15_S0_NZ_JBDYSJ010000001.1:485204-485240_length:37_mod0001 -M_T0_RID15_S1_NC_023442.1:20190-20253_length:64_mod0001 -M_T0_RID15_S1_NC_028259.1:6855-6912_length:58_mod0000 -M_T0_RID15_S1_NZ_JBDYLZ010000014.1:31347-31473_length:127_mod0000 -M_T0_RID16_S0_NC_033718.1:9155-9282_length:128_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000014.1:112132-112219_length:88_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000018.1:30565-30632_length:68_mod0001 -M_T0_RID17_S1_NC_030658.1:888-970_length:83_mod0001 -M_T0_RID17_S1_NC_030873.1:769-848_length:80_mod0000 -M_T0_RID17_S1_NZ_JBDYRX010000004.1:479027-479133_length:107_mod0000 -M_T0_RID17_S1_NZ_JBDYSJ010000002.1:142153-142239_length:87_mod0000 -M_T0_RID18_S0_NC_033830.1:429-498_length:70_mod0000 -M_T0_RID18_S1_NC_027429.1:4469-4544_length:76_mod0000 -M_T0_RID19_S0_NC_028491.1:2563-2618_length:56_mod0000 -M_T0_RID19_S0_NC_031227.1:5693-5751_length:59_mod0000 -M_T0_RID20_S1_NC_029562.1:5000-5036_length:37_mod0000 -M_T0_RID20_S1_NZ_JBDYSJ010000004.1:235888-235979_length:92_mod0000 -M_T0_RID21_S0_NC_028242.1:2691-2737_length:47_mod0000 -M_T0_RID21_S0_NC_029052.1:6412-6494_length:83_mod0000 -M_T0_RID21_S0_NZ_JBDYSJ010000002.1:218541-218623_length:83_mod0000 -M_T0_RID21_S1_NZ_JBDYLZ010000006.1:140228-140329_length:102_mod0000 -M_T0_RID21_S1_NZ_JBDYRX010000001.1:693665-693710_length:46_mod0000 -M_T0_RID22_S0_NC_030402.1:754-835_length:82_mod0000 -M_T0_RID22_S0_NC_034216.1:12941-13048_length:108_mod0000 -M_T0_RID22_S1_NZ_JBDYRX010000001.1:435105-435213_length:109_mod0000 -M_T0_RID23_S0_NC_030701.1:5103-5151_length:49_mod0000 -M_T0_RID23_S0_NC_033762.1:10-98_length:89_mod0000 -M_T0_RID23_S0_NC_037617.1:942-1060_length:119_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000002.1:499806-499888_length:83_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000004.1:201196-201277_length:82_mod0000 -M_T0_RID23_S1_NC_031275.1:7710-7771_length:62_mod0000 -M_T0_RID24_S0_NC_030240.1:57723-57766_length:44_mod0000 -M_T0_RID24_S0_NZ_JBDYLZ010000012.1:969-1002_length:34_mod0000 -M_T0_RID24_S0_NZ_JBDYRX010000001.1:197011-197061_length:51_mod0000 -M_T0_RID24_S1_NC_027121.1:8433-8469_length:37_mod0000 -M_T0_RID24_S1_NZ_JBDYRX010000001.1:668610-668664_length:55_mod0000 -M_T0_RID25_S0_NZ_JBDYSJ010000002.1:6311-6403_length:93_mod0000 -M_T0_RID25_S1_NC_029997.2:85189-85282_length:94_mod0000 -M_T0_RID25_S1_NC_034384.1:2318-2377_length:60_mod0000 -M_T0_RID25_S1_NZ_JBDYRX010000002.1:614807-614869_length:63_mod0000 -M_T0_RID25_S1_NZ_JBDYSJ010000004.1:88035-88153_length:119_mod0000 -M_T0_RID26_S0_NC_028491.1:86460-86530_length:71_mod0000 -M_T0_RID26_S0_NZ_JBDYSJ010000003.1:64065-64167_length:103_mod0000 -M_T0_RID26_S1_NZ_JBDYSJ010000002.1:180789-180849_length:61_mod0001 -M_T0_RID27_S0_NZ_JBDYRX010000002.1:879317-879417_length:101_mod0001 -M_T0_RID27_S0_NZ_JBDYSJ010000002.1:371147-371261_length:115_mod0000 -M_T0_RID27_S1_NC_024911.1:1404-1530_length:127_mod0000 -M_T0_RID27_S1_NC_034266.1:112117-112169_length:53_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000003.1:302019-302061_length:43_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000004.1:327071-327150_length:80_mod0001 -M_T0_RID28_S0_NC_027812.1:1778-1877_length:100_mod0000 -M_T0_RID28_S0_NC_028833.1:23931-24017_length:87_mod0000 -M_T0_RID28_S0_NC_034159.1:870-906_length:37_mod0000 -M_T0_RID28_S0_NZ_JBDYSJ010000003.1:260828-260864_length:37_mod0000 -M_T0_RID29_S0_NC_027137.1:5905-5940_length:36_mod0000 -M_T0_RID29_S0_NC_027208.1:2702-2783_length:82_mod0000 -M_T0_RID29_S0_NC_029996.1:60558-60653_length:96_mod0000 -M_T0_RID29_S0_NC_033722.1:167-248_length:82_mod0000 -M_T0_RID30_S0_NC_017977.1:8983-9015_length:33_mod0000 -M_T0_RID30_S0_NC_034219.1:4140-4199_length:60_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000001.1:753768-753819_length:52_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000002.1:441798-441831_length:34_mod0000 -M_T0_RID30_S0_NZ_JBDYSJ010000001.1:878513-878614_length:102_mod0000 -M_T0_RID30_S1_NC_028492.1:144-210_length:67_mod0000 -M_T0_RID30_S1_NZ_JBDYRX010000004.1:168829-168933_length:105_mod0000 -M_T0_RID30_S1_NZ_JBDYSJ010000002.1:584020-584104_length:85_mod0000 -M_T0_RID31_S0_NZ_JBDYSJ010000002.1:273852-273897_length:46_mod0000 -M_T0_RID31_S1_NC_031450.1:2281-2311_length:31_mod0000 -M_T0_RID31_S1_NZ_JBDYSJ010000002.1:454313-454400_length:88_mod0000 -M_T0_RID32_S0_NC_023442.1:31719-31785_length:67_mod0000 -M_T0_RID32_S1_NC_028133.1:1439-1562_length:124_mod0000 -M_T0_RID32_S1_NZ_JBDYSJ010000002.1:412312-412351_length:40_mod0000 -M_T0_RID33_S1_NC_034266.1:78437-78516_length:80_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000001.1:102672-102747_length:76_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000002.1:784464-784511_length:48_mod0000 -M_T0_RID33_S1_NZ_JBDYSJ010000003.1:324967-325032_length:66_mod0000 -M_T0_RID34_S0_NC_018457.1:737-780_length:44_mod0000 -M_T0_RID34_S0_NC_028253.1:2464-2519_length:56_mod0000 -M_T0_RID34_S0_NZ_JBDYRX010000003.1:19821-19946_length:126_mod0000 -M_T0_RID34_S1_NC_029255.1:103099-103196_length:98_mod0000 -M_T0_RID34_S1_NZ_JBDYRX010000001.1:214312-214398_length:87_mod0001 -M_T0_RID35_S0_NZ_JBDYRX010000001.1:286577-286647_length:71_mod0000 -M_T0_RID35_S0_NZ_JBDYRX010000002.1:303458-303514_length:57_mod0000 -M_T0_RID35_S1_NC_028374.1:16776-16870_length:95_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:363132-363178_length:47_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:829523-829581_length:59_mod0000 -M_T0_RID36_S0_NC_029311.1:99001-99097_length:97_mod0000 -M_T0_RID37_S0_NC_033620.1:94230-94306_length:77_mod0000 -M_T0_RID37_S0_NZ_JBDYLZ010000012.1:26095-26141_length:47_mod0000 -M_T0_RID37_S1_NC_029311.1:32048-32093_length:46_mod0000 -M_T0_RID37_S1_NZ_JBDYSJ010000001.1:902396-902441_length:46_mod0000 -M_T0_RID38_S0_NC_030691.1:6883-6932_length:50_mod0000 -M_T0_RID38_S1_NZ_JBDYRX010000004.1:200501-200575_length:75_mod0000 -M_T0_RID39_S1_NC_028136.1:1274-1340_length:67_mod0000 -M_T0_RID39_S1_NZ_JBDYSJ010000002.1:503066-503117_length:52_mod0000 -M_T0_RID40_S0_NC_030234.1:4344-4414_length:71_mod0000 -M_T0_RID41_S0_NC_031088.1:9201-9299_length:99_mod0000 -M_T0_RID41_S0_NZ_JBDYLZ010000009.1:31815-31852_length:38_mod0000 -M_T0_RID41_S1_NC_028244.1:5988-6042_length:55_mod0000 -M_T0_RID41_S1_NZ_JBDYLZ010000006.1:65238-65362_length:125_mod0000 -M_T0_RID41_S1_NZ_JBDYRX010000003.1:765215-765280_length:66_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:32817-32939_length:123_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:462782-462843_length:62_mod0000 -M_T0_RID43_S0_NZ_JBDYLZ010000008.1:49878-49973_length:96_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000001.1:889979-890062_length:84_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000004.1:406662-406696_length:35_mod0000 -M_T0_RID44_S1_NZ_JBDYLZ010000006.1:90744-90777_length:34_mod0000 -M_T0_RID45_S0_NC_027712.1:10734-10821_length:88_mod0000 -M_T0_RID45_S0_NC_029311.1:44548-44620_length:73_mod0000 -M_T0_RID45_S0_NC_030693.1:5273-5361_length:89_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000008.1:40421-40495_length:75_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000009.1:55082-55112_length:31_mod0000 -M_T0_RID45_S1_NC_028232.1:6596-6658_length:63_mod0000 -M_T0_RID46_S0_NZ_JBDYSJ010000003.1:168383-168513_length:131_mod0000 -M_T0_RID47_S0_NC_029932.1:1175-1250_length:76_mod0000 -M_T0_RID47_S1_NC_027633.1:3344-3412_length:69_mod0000 -M_T0_RID48_S0_NC_018174.1:5223-5261_length:39_mod0000 -M_T0_RID48_S0_NC_023443.1:462-562_length:101_mod0000 -M_T0_RID48_S0_NZ_JBDYRX010000002.1:697197-697270_length:74_mod0000 -M_T0_RID49_S0_NC_029309.1:6196-6271_length:76_mod0000 -M_T0_RID49_S0_NZ_JBDYRX010000002.1:627468-627514_length:47_mod0000 -M_T0_RID49_S1_NC_028375.1:6864-6975_length:112_mod0000 -M_T0_RID50_S0_NC_027634.1:1642-1737_length:96_mod0000 -M_T0_RID50_S0_NC_030117.1:58855-58929_length:75_mod0000 -M_T0_RID50_S0_NC_030397.1:2093-2139_length:47_mod0001 -M_T0_RID50_S0_NZ_JBDYRX010000002.1:579910-579949_length:40_mod0000 -M_T0_RID50_S1_NC_028099.1:106360-106431_length:72_mod0000 -M_T0_RID50_S1_NZ_JBDYLZ010000012.1:83521-83604_length:84_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:803598-803655_length:58_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:945690-945779_length:90_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000006.1:184353-184397_length:45_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000018.1:32304-32360_length:57_mod0000 -M_T0_RID51_S1_NZ_JBDYRX010000001.1:868994-869082_length:89_mod0000 -M_T0_RID51_S1_NZ_JBDYSJ010000003.1:168788-168850_length:63_mod0000 -M_T0_RID52_S0_NZ_JBDYRX010000002.1:889544-889674_length:131_mod0000 -M_T0_RID52_S1_NC_030801.1:2462-2542_length:81_mod0000 -M_T0_RID53_S0_NC_029053.1:3050-3132_length:83_mod0000 -M_T0_RID53_S0_NC_033792.1:955-1008_length:54_mod0000 -M_T0_RID53_S0_NZ_JBDYRX010000003.1:127692-127758_length:67_mod0000 -M_T0_RID53_S1_NC_027533.1:2013-2051_length:39_mod0000 -M_T0_RID53_S1_NC_031307.1:5253-5307_length:55_mod0000 -M_T0_RID54_S0_NC_031079.1:45-96_length:52_mod0000 -M_T0_RID54_S1_NC_027712.1:6686-6777_length:92_mod0000 -M_T0_RID54_S1_NC_029996.1:22662-22724_length:63_mod0000 -M_T0_RID55_S0_NC_030141.1:2102-2247_length:146_mod0000 -M_T0_RID55_S0_NC_031304.1:2692-2762_length:71_mod0000 -M_T0_RID55_S0_NC_033704.1:4049-4166_length:118_mod0000 -M_T0_RID55_S0_NZ_JBDYRX010000001.1:247013-247049_length:37_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:448811-448874_length:64_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:513869-513936_length:68_mod0000 -M_T0_RID56_S0_NC_027016.1:52570-52626_length:57_mod0000 -M_T0_RID56_S0_NC_031449.1:9465-9556_length:92_mod0000 -M_T0_RID56_S0_NZ_JBDYLZ010000007.1:245259-245319_length:61_mod0001 -M_T0_RID56_S1_NZ_JBDYLZ010000007.1:103507-103590_length:84_mod0000 -M_T0_RID57_S0_NC_018070.1:8325-8447_length:123_mod0000 -M_T0_RID57_S0_NC_027426.1:3804-3851_length:48_mod0000 -M_T0_RID57_S1_NC_028099.1:83564-83601_length:38_mod0000 -M_T0_RID58_S0_NC_027121.1:14888-14980_length:93_mod0000 -M_T0_RID58_S0_NC_029550.1:232-272_length:41_mod0000 -M_T0_RID58_S1_NZ_JBDYLZ010000015.1:60370-60453_length:84_mod0000 -M_T0_RID59_S0_NZ_JBDYLZ010000011.1:108912-108996_length:85_mod0000 -M_T0_RID59_S0_NZ_JBDYRX010000004.1:15220-15308_length:89_mod0000 -M_T0_RID60_S1_NC_027641.1:1140-1184_length:45_mod0000 -M_T0_RID60_S1_NC_029085.1:8080-8154_length:75_mod0001 -M_T0_RID60_S1_NZ_JBDYRX010000001.1:262196-262266_length:71_mod0000 -M_T0_RID60_S1_NZ_JBDYSJ010000002.1:87924-88000_length:77_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:191465-191498_length:34_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:569149-569214_length:66_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000003.1:457685-457761_length:77_mod0000 -M_T0_RID62_S0_NC_023303.1:251-301_length:51_mod0000 -M_T0_RID62_S0_NZ_JBDYRX010000001.1:304278-304333_length:56_mod0000 -M_T0_RID62_S1_NC_023427.1:835-900_length:66_mod0000 -M_T0_RID62_S1_NC_027016.1:54356-54406_length:51_mod0000 -M_T0_RID62_S1_NC_028133.1:2961-2996_length:36_mod0000 -M_T0_RID62_S1_NC_031083.1:3710-3834_length:125_mod0000 -M_T0_RID62_S1_NC_031463.1:8948-8994_length:47_mod0000 -M_T0_RID62_S1_NZ_JBDYRX010000003.1:182597-182668_length:72_mod0001 -M_T0_RID62_S1_NZ_JBDYSJ010000001.1:192588-192667_length:80_mod0001 -M_T0_RID63_S0_NC_028144.1:6011-6113_length:103_mod0000 -M_T0_RID63_S0_NC_030240.1:102727-102785_length:59_mod0000 -M_T0_RID63_S0_NC_033760.1:1443-1573_length:131_mod0000 -M_T0_RID63_S0_NZ_JBDYLZ010000020.1:7118-7208_length:91_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000002.1:745773-745875_length:103_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000003.1:142067-142124_length:58_mod0000 -M_T0_RID63_S0_NZ_JBDYSJ010000003.1:151524-151569_length:46_mod0000 -M_T0_RID63_S1_NC_031236.1:11052-11140_length:89_mod0001 -M_T0_RID64_S0_NC_030748.1:1054-1124_length:71_mod0000 -M_T0_RID64_S1_NC_031093.1:6116-6176_length:61_mod0000 -M_T0_RID66_S0_NZ_JBDYLZ010000015.1:96499-96580_length:82_mod0000 -M_T0_RID66_S0_NZ_JBDYSJ010000002.1:346193-346225_length:33_mod0000 -M_T0_RID66_S1_NC_031305.1:4622-4714_length:93_mod0000 -M_T0_RID66_S1_NZ_JBDYRX010000002.1:340389-340472_length:84_mod0000 -M_T0_RID67_S0_NC_028134.1:42-92_length:51_mod0000 -M_T0_RID67_S0_NC_030447.1:1980-2070_length:91_mod0000 -M_T0_RID67_S0_NZ_JBDYRX010000004.1:332043-332120_length:78_mod0000 -M_T0_RID67_S0_NZ_JBDYSJ010000003.1:241049-241147_length:99_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000001.1:247375-247406_length:32_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000002.1:355091-355166_length:76_mod0000 -M_T0_RID68_S1_NC_034266.1:8834-8941_length:108_mod0000 -M_T0_RID68_S1_NZ_JBDYLZ010000016.1:69565-69646_length:82_mod0000 -M_T0_RID69_S0_NC_028368.1:19515-19575_length:61_mod0000 -M_T0_RID69_S0_NC_034266.1:30444-30515_length:72_mod0000 -M_T0_RID69_S0_NZ_JBDYLZ010000013.1:100003-100090_length:88_mod0000 -M_T0_RID69_S1_NZ_JBDYLZ010000016.1:63861-63942_length:82_mod0000 -M_T0_RID70_S0_NC_018404.1:2315-2374_length:60_mod0000 -M_T0_RID70_S1_NC_027713.1:293-401_length:109_mod0000 -M_T0_RID70_S1_NC_033830.1:3068-3146_length:79_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000007.1:118774-118860_length:87_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000016.1:66813-66865_length:53_mod0000 -M_T0_RID71_S0_NC_033620.1:14671-14724_length:54_mod0000 -M_T0_RID71_S1_NC_029562.1:2435-2497_length:63_mod0000 -M_T0_RID72_S0_NC_033716.1:7859-7951_length:93_mod0000 -M_T0_RID72_S1_NC_030117.1:83819-83856_length:38_mod0000 -M_T0_RID72_S1_NZ_JBDYLZ010000008.1:123604-123689_length:86_mod0000 -M_T0_RID73_S0_NC_030115.1:6022-6140_length:119_mod0000 -M_T0_RID73_S0_NC_030229.1:2674-2768_length:95_mod0000 -M_T0_RID73_S0_NC_033733.1:4354-4441_length:88_mod0001 -M_T0_RID74_S0_NC_031093.1:8592-8666_length:75_mod0000 -M_T0_RID74_S0_NZ_JBDYSJ010000002.1:362489-362559_length:71_mod0000 -M_T0_RID74_S1_NC_029302.1:212-295_length:84_mod0000 -M_T0_RID75_S0_NZ_JBDYRX010000001.1:235615-235682_length:68_mod0000 -M_T0_RID75_S1_NC_030235.1:6658-6691_length:34_mod0000 -M_T0_RID75_S1_NZ_JBDYLZ010000022.1:8709-8767_length:59_mod0000 -M_T0_RID75_S1_NZ_JBDYRX010000003.1:478660-478720_length:61_mod0000 -M_T0_RID76_S0_NC_018070.1:8778-8882_length:105_mod0000 -M_T0_RID76_S0_NC_029255.1:61305-61383_length:79_mod0000 -M_T0_RID76_S1_NC_027428.1:2290-2358_length:69_mod0000 -M_T0_RID76_S1_NC_030200.1:88040-88083_length:44_mod0000 -M_T0_RID76_S1_NC_033720.1:158-194_length:37_mod0000 -M_T0_RID77_S1_NC_033730.1:7657-7785_length:129_mod0000 -M_T0_RID78_S0_NC_023442.1:36825-36879_length:55_mod0000 -M_T0_RID78_S0_NC_027016.1:111926-112014_length:89_mod0000 -M_T0_RID78_S0_NZ_JBDYRX010000003.1:310444-310522_length:79_mod0000 -M_T0_RID78_S1_NC_030871.1:4415-4481_length:67_mod0000 -M_T0_RID78_S1_NC_031220.1:5976-6009_length:34_mod0000 -M_T0_RID79_S0_NC_029997.2:83992-84041_length:50_mod0000 -M_T0_RID79_S0_NC_030240.1:97988-98049_length:62_mod0000 -M_T0_RID79_S1_NC_033792.1:2479-2556_length:78_mod0000 -M_T0_RID79_S1_NZ_JBDYRX010000003.1:341785-341851_length:67_mod0001 -M_T0_RID80_S1_NZ_JBDYLZ010000010.1:13735-13769_length:35_mod0000 -M_T0_RID80_S1_NZ_JBDYSJ010000001.1:511944-512037_length:94_mod0000 -M_T0_RID81_S1_NC_027923.1:15413-15450_length:38_mod0000 -M_T0_RID82_S0_NC_027916.2:67438-67522_length:85_mod0001 -M_T0_RID82_S0_NC_028398.1:2368-2442_length:75_mod0000 -M_T0_RID82_S0_NC_033779.1:2219-2288_length:70_mod0000 -M_T0_RID82_S0_NZ_JBDYLZ010000016.1:9019-9115_length:97_mod0000 -M_T0_RID82_S0_NZ_JBDYRX010000001.1:261558-261662_length:105_mod0001 -M_T0_RID82_S1_NC_027016.1:72621-72680_length:60_mod0000 -M_T0_RID82_S1_NC_027535.1:2160-2253_length:94_mod0000 -M_T0_RID83_S1_NC_030159.1:273-312_length:40_mod0000 -M_T0_RID83_S1_NZ_JBDYLZ010000007.1:155539-155585_length:47_mod0000 -M_T0_RID83_S1_NZ_JBDYRX010000002.1:263346-263422_length:77_mod0000 -M_T0_RID84_S0_NZ_JBDYRX010000003.1:240685-240765_length:81_mod0000 -M_T0_RID84_S1_NZ_JBDYRX010000003.1:51637-51745_length:109_mod0000 -M_T0_RID85_S0_NZ_JBDYRX010000002.1:107354-107402_length:49_mod0000 -M_T0_RID85_S1_NC_023297.1:177-263_length:87_mod0000 -M_T0_RID85_S1_NC_030201.1:3764-3811_length:48_mod0000 -M_T0_RID85_S1_NZ_JBDYRX010000002.1:35225-35277_length:53_mod0000 -M_T0_RID86_S1_NC_028137.1:1830-1905_length:76_mod0000 -M_T0_RID86_S1_NC_033828.1:2664-2773_length:110_mod0000 -M_T0_RID86_S1_NZ_JBDYSJ010000001.1:383616-383681_length:66_mod0000 -M_T0_RID87_S0_NC_027631.1:5088-5147_length:60_mod0000 -M_T0_RID87_S0_NZ_JBDYLZ010000008.1:117199-117277_length:79_mod0000 -M_T0_RID87_S1_NZ_JBDYRX010000002.1:176453-176540_length:88_mod0000 -M_T0_RID89_S0_NC_028814.1:25832-25905_length:74_mod0000 -M_T0_RID89_S0_NZ_JBDYLZ010000010.1:109306-109408_length:103_mod0000 -M_T0_RID89_S1_NC_029064.1:9889-9971_length:83_mod0000 -M_T0_RID91_S0_NC_029997.2:19677-19742_length:66_mod0000 -M_T0_RID91_S0_NZ_JBDYSJ010000002.1:541980-542048_length:69_mod0001 -M_T0_RID91_S1_NC_028636.1:131522-131574_length:53_mod0000 -M_T0_RID91_S1_NZ_JBDYLZ010000015.1:73113-73211_length:99_mod0000 -M_T0_RID91_S1_NZ_JBDYRX010000002.1:531098-531224_length:127_mod0000 -M_T0_RID91_S1_NZ_JBDYSJ010000001.1:75425-75512_length:88_mod0000 -M_T0_RID92_S0_NC_033847.1:907-971_length:65_mod0001 -M_T0_RID92_S0_NZ_JBDYRX010000001.1:204153-204204_length:52_mod0000 -M_T0_RID93_S0_NC_029131.1:6029-6095_length:67_mod0000 -M_T0_RID93_S1_NZ_JBDYRX010000002.1:30248-30359_length:112_mod0000 -M_T0_RID94_S0_NC_028142.1:627-700_length:74_mod0000 -M_T0_RID94_S0_NC_033702.1:1317-1400_length:84_mod0000 -M_T0_RID94_S0_NC_033717.1:1284-1386_length:103_mod0000 -M_T0_RID95_S0_NC_018072.1:2591-2635_length:45_mod0000 -M_T0_RID95_S0_NC_027136.1:2231-2280_length:50_mod0000 -M_T0_RID95_S0_NC_029996.1:90789-90865_length:77_mod0000 -M_T0_RID95_S0_NZ_JBDYRX010000002.1:319590-319635_length:46_mod0000 -M_T0_RID95_S1_NC_033620.1:5347-5437_length:91_mod0000 -M_T0_RID96_S0_NC_028636.1:10556-10617_length:62_mod0000 -M_T0_RID96_S1_NC_028143.1:314-390_length:77_mod0000 -M_T0_RID97_S1_NZ_JBDYRX010000001.1:866338-866401_length:64_mod0001 -M_T0_RID97_S1_NZ_JBDYRX010000003.1:178272-178304_length:33_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000013.1:5680-5725_length:46_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000028.1:866-932_length:67_mod0000 -M_T0_RID98_S1_NC_029996.1:10631-10716_length:86_mod0000 -M_T0_RID99_S0_NC_030838.1:2068-2122_length:55_mod0000 -M_T0_RID99_S0_NC_031248.1:3321-3367_length:47_mod0000 -M_T0_RID99_S1_NC_027916.2:30126-30210_length:85_mod0000 -M_T0_RID99_S1_NC_030240.1:40035-40122_length:88_mod0000 -M_T0_RID99_S1_NC_031336.1:14128-14251_length:124_mod0001 -M_T0_RID99_S1_NZ_JBDYSJ010000001.1:396202-396267_length:66_mod0000 -M_T0_RID100_S0_NC_028376.1:14572-14682_length:111_mod0000 -M_T0_RID100_S0_NC_030697.1:970-1055_length:86_mod0000 -M_T0_RID100_S0_NZ_JBDYRX010000002.1:758402-758505_length:104_mod0000 -M_T0_RID101_S0_NZ_JBDYSJ010000001.1:645109-645147_length:39_mod0000 -M_T0_RID102_S0_NC_029255.1:63250-63323_length:74_mod0000 -M_T0_RID102_S0_NZ_JBDYSJ010000001.1:237444-237513_length:70_mod0000 -M_T0_RID103_S0_NC_028476.1:713-824_length:112_mod0000 -M_T0_RID103_S1_NC_031314.1:1276-1385_length:110_mod0000 -M_T0_RID103_S1_NC_031463.1:18479-18581_length:103_mod0000 -M_T0_RID103_S1_NZ_JBDYRX010000003.1:535271-535363_length:93_mod0000 -M_T0_RID105_S0_NC_030118.1:8503-8572_length:70_mod0000 -M_T0_RID105_S1_NC_027712.1:9939-9971_length:33_mod0000 -M_T0_RID105_S1_NC_030472.1:4177-4227_length:51_mod0000 -M_T0_RID106_S1_NC_028382.1:483-531_length:49_mod0000 -M_T0_RID106_S1_NZ_JBDYLZ010000017.1:12627-12692_length:66_mod0000 -M_T0_RID106_S1_NZ_JBDYRX010000001.1:885175-885267_length:93_mod0000 -M_T0_RID106_S1_NZ_JBDYSJ010000001.1:754603-754673_length:71_mod0000 -M_T0_RID107_S0_NZ_JBDYRX010000002.1:887203-887264_length:62_mod0000 -M_T0_RID107_S1_NC_027016.1:87956-88044_length:89_mod0000 -M_T0_RID107_S1_NC_028478.1:299-392_length:94_mod0000 -M_T0_RID107_S1_NZ_JBDYRX010000003.1:166903-166964_length:62_mod0001 -M_T0_RID107_S1_NZ_JBDYSJ010000001.1:252763-252845_length:83_mod0000 -M_T0_RID108_S1_NC_033767.1:689-744_length:56_mod0000 -M_T0_RID108_S1_NZ_JBDYSJ010000003.1:468268-468339_length:72_mod0000 -M_T0_RID109_S0_NZ_JBDYRX010000001.1:988451-988536_length:86_mod0000 -M_T0_RID110_S1_NC_028099.1:36637-36726_length:90_mod0000 -M_T0_RID110_S1_NZ_JBDYLZ010000015.1:71842-71908_length:67_mod0000 -M_T0_RID111_S0_NC_030232.1:3068-3100_length:33_mod0000 -M_T0_RID111_S0_NZ_JBDYRX010000002.1:284375-284457_length:83_mod0000 -M_T0_RID111_S1_NC_028491.1:22651-22727_length:77_mod0000 -M_T0_RID112_S1_NZ_JBDYRX010000004.1:227206-227261_length:56_mod0000 -M_T0_RID112_S1_NZ_JBDYSJ010000003.1:186720-186750_length:31_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000008.1:103905-103950_length:46_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000017.1:43421-43530_length:110_mod0000 -M_T0_RID114_S0_NZ_JBDYSJ010000001.1:888974-889061_length:88_mod0000 -M_T0_RID114_S1_NC_028485.1:4265-4351_length:87_mod0000 -M_T0_RID114_S1_NC_030654.1:5564-5612_length:49_mod0000 -M_T0_RID114_S1_NC_033763.1:670-745_length:76_mod0000 -M_T0_RID114_S1_NZ_JBDYSJ010000001.1:20373-20432_length:60_mod0000 -M_T0_RID115_S0_NC_033781.1:4795-4906_length:112_mod0000 -M_T0_RID115_S1_NC_031236.1:618-674_length:57_mod0000 -M_T0_RID116_S0_NC_028833.1:24900-24930_length:31_mod0000 -M_T0_RID116_S0_NZ_JBDYSJ010000001.1:278209-278280_length:72_mod0000 -M_T0_RID117_S0_NC_028491.1:76819-76945_length:127_mod0000 -M_T0_RID117_S0_NC_028636.1:51360-51406_length:47_mod0000 -M_T0_RID117_S0_NZ_JBDYRX010000002.1:695385-695511_length:127_mod0000 -M_T0_RID117_S0_NZ_JBDYSJ010000004.1:214232-214301_length:70_mod0000 -M_T0_RID117_S1_NZ_JBDYSJ010000001.1:254125-254189_length:65_mod0000 -M_T0_RID118_S1_NC_017967.1:3728-3792_length:65_mod0000 -M_T0_RID118_S1_NZ_JBDYLZ010000012.1:104385-104434_length:50_mod0000 -M_T0_RID118_S1_NZ_JBDYRX010000003.1:569089-569158_length:70_mod0000 -M_T0_RID119_S0_NC_027138.1:1980-2027_length:48_mod0000 -M_T0_RID119_S0_NZ_JBDYRX010000001.1:479636-479698_length:63_mod0000 -M_T0_RID119_S1_NC_030750.1:2333-2363_length:31_mod0000 -M_T0_RID120_S0_NZ_JBDYRX010000004.1:143311-143407_length:97_mod0000 -M_T0_RID120_S0_NZ_JBDYSJ010000002.1:211897-211962_length:66_mod0000 -M_T0_RID120_S1_NC_029255.1:99346-99425_length:80_mod0000 -M_T0_RID120_S1_NZ_JBDYLZ010000008.1:182987-183039_length:53_mod0000 -M_T0_RID121_S1_NZ_JBDYRX010000003.1:22645-22773_length:129_mod0000 -M_T0_RID122_S0_NZ_JBDYSJ010000002.1:28060-28162_length:103_mod0000 -M_T0_RID122_S1_NZ_JBDYRX010000002.1:593335-593394_length:60_mod0000 -M_T0_RID123_S1_NC_029932.1:780-841_length:62_mod0000 -M_T0_RID123_S1_NZ_JBDYRX010000002.1:624572-624628_length:57_mod0000 -M_T0_RID123_S1_NZ_JBDYSJ010000003.1:205052-205133_length:82_mod0000 -M_T0_RID124_S0_NC_018105.1:1032-1078_length:47_mod0000 -M_T0_RID124_S0_NC_027016.1:37306-37377_length:72_mod0000 -M_T0_RID124_S0_NC_027430.1:2075-2124_length:50_mod0000 -M_T0_RID124_S0_NC_033751.1:1175-1283_length:109_mod0000 -M_T0_RID124_S0_NZ_JBDYLZ010000012.1:107683-107735_length:53_mod0000 -M_T0_RID124_S1_NC_029783.1:12839-12935_length:97_mod0000 -M_T0_RID125_S1_NC_024911.1:585-717_length:133_mod0000 -M_T0_RID125_S1_NZ_JBDYRX010000002.1:524061-524121_length:61_mod0000 -M_T0_RID126_S0_NZ_JBDYSJ010000003.1:204369-204435_length:67_mod0000 -M_T0_RID126_S1_NC_027136.1:6692-6786_length:95_mod0000 -M_T0_RID126_S1_NZ_JBDYLZ010000007.1:147969-148026_length:58_mod0000 -M_T0_RID126_S1_NZ_JBDYSJ010000001.1:849768-849826_length:59_mod0000 -M_T0_RID127_S0_NZ_JBDYLZ010000019.1:20624-20673_length:50_mod0000 -M_T0_RID127_S1_NC_033619.1:4029-4155_length:127_mod0000 -M_T0_RID127_S1_NZ_JBDYRX010000004.1:112527-112563_length:37_mod0000 -M_T0_RID128_S0_NC_033620.1:26172-26261_length:90_mod0000 -M_T0_RID128_S0_NZ_JBDYSJ010000001.1:127550-127596_length:47_mod0000 -M_T0_RID128_S1_NZ_JBDYLZ010000010.1:81225-81326_length:102_mod0000 -M_T0_RID129_S0_NC_028372.1:12347-12414_length:68_mod0001 -M_T0_RID129_S0_NC_030844.1:4967-5083_length:117_mod0001 -M_T0_RID129_S1_NZ_JBDYSJ010000001.1:451837-451880_length:44_mod0000 -M_T0_RID130_S0_NZ_JBDYSJ010000001.1:904477-904569_length:93_mod0000 -M_T0_RID130_S1_NC_030400.1:8920-8964_length:45_mod0000 -M_T0_RID131_S0_NC_030200.1:24540-24653_length:114_mod0000 -M_T0_RID131_S0_NZ_JBDYRX010000004.1:307376-307435_length:60_mod0001 -M_T0_RID131_S1_NZ_JBDYRX010000002.1:215925-215981_length:57_mod0000 -M_T0_RID132_S0_NC_029132.1:26524-26609_length:86_mod0000 -M_T0_RID132_S0_NZ_JBDYRX010000002.1:856095-856160_length:66_mod0000 -M_T0_RID132_S1_NC_028099.1:70003-70100_length:98_mod0000 -M_T0_RID132_S1_NC_028636.1:77454-77493_length:40_mod0000 -M_T0_RID133_S0_NC_027210.1:8798-8910_length:113_mod0000 -M_T0_RID133_S1_NZ_JBDYLZ010000014.1:82781-82835_length:55_mod0000 -M_T0_RID134_S0_NC_034266.1:203255-203287_length:33_mod0000 -M_T0_RID134_S1_NC_033705.1:7105-7262_length:158_mod0000 -M_T0_RID135_S0_NC_033733.1:6746-6806_length:61_mod0000 -M_T0_RID135_S1_NZ_JBDYSJ010000004.1:255279-255341_length:63_mod0000 -M_T0_RID136_S0_NZ_JBDYSJ010000001.1:562721-562768_length:48_mod0000 -M_T0_RID136_S1_NC_030200.1:80911-80976_length:66_mod0001 -M_T0_RID136_S1_NZ_JBDYLZ010000009.1:44314-44384_length:71_mod0000 -M_T0_RID136_S1_NZ_JBDYLZ010000018.1:9886-9961_length:76_mod0000 -M_T0_RID136_S1_NZ_JBDYRX010000001.1:825042-825123_length:82_mod0000 -M_T0_RID137_S0_NC_031083.1:11357-11420_length:64_mod0000 -M_T0_RID137_S0_NZ_JBDYSJ010000002.1:311215-311270_length:56_mod0000 -M_T0_RID137_S1_NC_034266.1:15288-15392_length:105_mod0000 -M_T0_RID137_S1_NZ_JBDYSJ010000002.1:109720-109762_length:43_mod0000 -M_T0_RID138_S0_NC_033730.1:4735-4793_length:59_mod0000 -M_T0_RID139_S0_NC_029076.1:5391-5472_length:82_mod0000 -M_T0_RID139_S0_NC_029131.1:3428-3518_length:91_mod0000 -M_T0_RID139_S1_NC_027128.1:7467-7524_length:58_mod0000 -M_T0_RID139_S1_NC_033730.1:8262-8350_length:89_mod0000 -M_T0_RID140_S0_NC_031216.1:8965-9047_length:83_mod0000 -M_T0_RID140_S1_NC_029996.1:128484-128577_length:94_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000007.1:238838-238873_length:36_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000015.1:16859-16896_length:38_mod0000 -M_T0_RID142_S0_NC_027916.2:139729-139809_length:81_mod0001 -M_T0_RID142_S0_NC_030873.1:562-633_length:72_mod0000 -M_T0_RID142_S0_NZ_JBDYSJ010000003.1:9947-10048_length:102_mod0001 -M_T0_RID144_S0_NC_030200.1:1026-1085_length:60_mod0001 -M_T0_RID144_S0_NZ_JBDYRX010000002.1:297802-297909_length:108_mod0000 -M_T0_RID145_S0_NZ_JBDYSJ010000001.1:690815-690908_length:94_mod0000 -M_T0_RID146_S0_NC_028636.1:8587-8640_length:54_mod0000 -M_T0_RID147_S0_NC_030839.1:401-442_length:42_mod0000 -M_T0_RID147_S1_NZ_JBDYRX010000002.1:330619-330694_length:76_mod0000 -M_T0_RID148_S1_NZ_JBDYRX010000002.1:14264-14309_length:46_mod0000 -M_T0_RID149_S0_NZ_JBDYSJ010000001.1:617340-617447_length:108_mod0000 -M_T0_RID149_S1_NC_028249.1:10239-10323_length:85_mod0000 -M_T0_RID149_S1_NZ_JBDYLZ010000008.1:120921-120959_length:39_mod0000 -M_T0_RID150_S1_NZ_JBDYRX010000004.1:384747-384794_length:48_mod0000 -M_T0_RID152_S1_NZ_JBDYRX010000004.1:353714-353802_length:89_mod0000 -M_T0_RID153_S0_NZ_JBDYRX010000003.1:52603-52715_length:113_mod0000 -M_T0_RID153_S1_NC_028364.1:137-249_length:113_mod0000 -M_T0_RID154_S0_NZ_JBDYRX010000003.1:602237-602274_length:38_mod0000 -M_T0_RID154_S1_NC_028386.1:1116-1181_length:66_mod0000 -M_T0_RID154_S1_NC_033620.1:12644-12716_length:73_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000002.1:675599-675679_length:81_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000003.1:514528-514581_length:54_mod0000 -M_T0_RID155_S0_NC_033701.1:9275-9317_length:43_mod0000 -M_T0_RID156_S1_NC_023295.1:2064-2141_length:78_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000006.1:281471-281567_length:97_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000011.1:132268-132312_length:45_mod0000 -M_T0_RID158_S1_NC_028241.1:531-607_length:77_mod0000 -M_T0_RID159_S0_NC_029311.1:69011-69045_length:35_mod0000 -M_T0_RID159_S0_NC_031216.1:6290-6405_length:116_mod0000 -M_T0_RID159_S0_NC_033620.1:32537-32621_length:85_mod0000 -M_T0_RID159_S0_NZ_JBDYSJ010000002.1:600959-600995_length:37_mod0000 -M_T0_RID161_S1_NC_030240.1:83741-83790_length:50_mod0000 -M_T0_RID162_S0_NZ_JBDYLZ010000008.1:5183-5216_length:34_mod0000 -M_T0_RID162_S1_NC_017862.1:7381-7452_length:72_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:584559-584609_length:51_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:726659-726738_length:80_mod0000 -M_T0_RID163_S0_NC_033620.1:156883-156969_length:87_mod0000 -M_T0_RID163_S1_NC_030275.1:100083-100169_length:87_mod0000 -M_T0_RID164_S0_NZ_JBDYLZ010000018.1:17968-18030_length:63_mod0000 -M_T0_RID164_S1_NC_033620.1:130668-130713_length:46_mod0000 -M_T0_RID164_S1_NZ_JBDYRX010000004.1:519479-519563_length:85_mod0000 -M_T0_RID165_S0_NC_027917.1:1959-2051_length:93_mod0000 -M_T0_RID166_S0_NZ_JBDYRX010000004.1:59696-59805_length:110_mod0000 -M_T0_RID167_S0_NZ_JBDYLZ010000007.1:38370-38443_length:74_mod0000 -M_T0_RID168_S0_NC_030225.1:5381-5465_length:85_mod0001 -M_T0_RID168_S0_NC_030236.1:5080-5154_length:75_mod0000 -M_T0_RID169_S0_NC_028263.1:913-994_length:82_mod0000 -M_T0_RID169_S0_NZ_JBDYLZ010000007.1:16953-17017_length:65_mod0000 -M_T0_RID169_S1_NC_017970.1:7200-7322_length:123_mod0000 -M_T0_RID169_S1_NC_027016.1:84360-84421_length:62_mod0000 -M_T0_RID169_S1_NC_031295.1:1211-1283_length:73_mod0001 -M_T0_RID170_S1_NZ_JBDYRX010000001.1:71554-71642_length:89_mod0000 -M_T0_RID171_S0_NC_023429.1:1938-1983_length:46_mod0000 -M_T0_RID171_S0_NZ_JBDYRX010000001.1:944221-944313_length:93_mod0001 -M_T0_RID171_S1_NC_028891.1:8612-8645_length:34_mod0000 -M_T0_RID172_S0_NC_031455.1:2261-2316_length:56_mod0000 -M_T0_RID172_S1_NC_028383.1:1536-1621_length:86_mod0000 -M_T0_RID172_S1_NC_031293.1:5209-5302_length:94_mod0000 -M_T0_RID172_S1_NZ_JBDYSJ010000002.1:22259-22312_length:54_mod0000 -M_T0_RID173_S0_NC_033710.1:8523-8561_length:39_mod0000 -M_T0_RID173_S0_NZ_JBDYRX010000004.1:391209-391337_length:129_mod0000 -M_T0_RID173_S1_NZ_JBDYLZ010000022.1:5769-5818_length:50_mod0000 -M_T0_RID173_S1_NZ_JBDYSJ010000001.1:629973-630049_length:77_mod0000 -M_T0_RID174_S1_NC_030158.1:2752-2787_length:36_mod0000 -M_T0_RID174_S1_NC_031339.1:433-463_length:31_mod0000 -M_T0_RID174_S1_NZ_JBDYLZ010000006.1:10668-10748_length:81_mod0000 -M_T0_RID175_S0_NZ_JBDYLZ010000018.1:25042-25131_length:90_mod0000 -M_T0_RID175_S1_NZ_JBDYSJ010000001.1:899529-899569_length:41_mod0000 -M_T0_RID176_S0_NC_030200.1:58204-58287_length:84_mod0000 -M_T0_RID176_S0_NZ_JBDYRX010000002.1:668726-668775_length:50_mod0000 -M_T0_RID176_S1_NZ_JBDYSJ010000003.1:471518-471566_length:49_mod0001 -M_T0_RID177_S1_NZ_JBDYRX010000002.1:466682-466753_length:72_mod0000 -M_T0_RID178_S0_NC_028099.1:31084-31207_length:124_mod0000 -M_T0_RID178_S0_NC_033620.1:149729-149799_length:71_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000001.1:853106-853172_length:67_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000002.1:203092-203185_length:94_mod0000 -M_T0_RID179_S0_NC_023442.1:39001-39088_length:88_mod0000 -M_T0_RID179_S0_NZ_JBDYRX010000004.1:52140-52225_length:86_mod0000 -M_T0_RID179_S0_NZ_JBDYSJ010000001.1:721050-721084_length:35_mod0001 -M_T0_RID180_S0_NZ_JBDYSJ010000002.1:534591-534638_length:48_mod0000 -M_T0_RID180_S1_NC_029801.1:1212-1290_length:79_mod0000 -M_T0_RID181_S0_NC_023420.2:1575-1682_length:108_mod0000 -M_T0_RID181_S0_NZ_JBDYSJ010000001.1:400625-400659_length:35_mod0000 -M_T0_RID181_S1_NZ_JBDYLZ010000022.1:10488-10567_length:80_mod0000 -M_T0_RID182_S1_NC_030115.1:4690-4735_length:46_mod0000 -M_T0_RID183_S0_NC_029996.1:43664-43722_length:59_mod0000 -M_T0_RID185_S1_NZ_JBDYRX010000003.1:308336-308406_length:71_mod0001 -M_T0_RID185_S1_NZ_JBDYRX010000004.1:191608-191699_length:92_mod0000 -M_T0_RID187_S0_NC_029132.1:3505-3621_length:117_mod0000 -M_T0_RID187_S1_NC_028833.1:12138-12185_length:48_mod0001 -M_T0_RID187_S1_NZ_JBDYLZ010000007.1:48250-48349_length:100_mod0000 -M_T0_RID187_S1_NZ_JBDYRX010000001.1:251442-251541_length:100_mod0000 -M_T0_RID188_S0_NC_033620.1:60461-60546_length:86_mod0000 -M_T0_RID188_S0_NC_033745.1:5844-5924_length:81_mod0000 -M_T0_RID188_S1_NC_030746.1:5743-5836_length:94_mod0000 -M_T0_RID188_S1_NZ_JBDYSJ010000001.1:693404-693463_length:60_mod0000 -M_T0_RID190_S0_NC_028099.1:110295-110391_length:97_mod0000 -M_T0_RID190_S0_NC_031463.1:15502-15572_length:71_mod0000 -M_T0_RID190_S0_NZ_JBDYSJ010000002.1:205146-205255_length:110_mod0000 -M_T0_RID190_S1_NC_031291.1:89-172_length:84_mod0000 -M_T0_RID190_S1_NZ_JBDYRX010000001.1:953429-953485_length:57_mod0001 -M_T0_RID191_S0_NC_028811.1:13630-13691_length:62_mod0000 -M_T0_RID191_S0_NC_029255.1:128444-128478_length:35_mod0000 -M_T0_RID191_S1_NC_027706.1:673-702_length:30_mod0000 -M_T0_RID192_S0_NC_030202.1:1974-2037_length:64_mod0000 -M_T0_RID192_S0_NZ_JBDYSJ010000002.1:499003-499042_length:40_mod0000 -M_T0_RID192_S1_NC_028266.1:2491-2562_length:72_mod0000 -M_T0_RID192_S1_NC_029935.1:3672-3749_length:78_mod0000 -M_T0_RID193_S0_NC_030796.1:1139-1218_length:80_mod0000 -M_T0_RID193_S0_NZ_JBDYLZ010000006.1:65091-65167_length:77_mod0000 -M_T0_RID193_S1_NC_029311.1:3962-4023_length:62_mod0000 -M_T0_RID193_S1_NC_029854.1:2071-2138_length:68_mod0001 -M_T0_RID193_S1_NZ_JBDYLZ010000018.1:32241-32282_length:42_mod0000 -M_T0_RID193_S1_NZ_JBDYSJ010000004.1:33272-33325_length:54_mod0000 -M_T0_RID194_S0_NZ_JBDYRX010000001.1:29953-30068_length:116_mod0000 -M_T0_RID194_S1_NC_027117.1:4-75_length:72_mod0000 -M_T0_RID194_S1_NZ_JBDYSJ010000002.1:458031-458124_length:94_mod0000 -M_T0_RID195_S0_NC_029126.1:5551-5630_length:80_mod0000 -M_T0_RID195_S0_NC_030117.1:78912-78948_length:37_mod0000 -M_T0_RID195_S0_NZ_JBDYLZ010000010.1:56983-57024_length:42_mod0000 -M_T0_RID196_S0_NC_028891.1:12640-12710_length:71_mod0000 -M_T0_RID196_S0_NZ_JBDYSJ010000001.1:166064-166125_length:62_mod0000 -M_T0_RID196_S1_NC_029306.1:173-274_length:102_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000001.1:85071-85115_length:45_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000003.1:358250-358311_length:62_mod0001 -M_T0_RID198_S1_NZ_JBDYLZ010000012.1:46495-46566_length:72_mod0000 -M_T0_RID198_S1_NZ_JBDYSJ010000001.1:185655-185715_length:61_mod0000 -M_T0_RID199_S0_NZ_JBDYRX010000001.1:904336-904396_length:61_mod0000 -M_T0_RID200_S1_NZ_JBDYRX010000001.1:660511-660552_length:42_mod0000 -M_T0_RID201_S0_NZ_JBDYLZ010000028.1:698-764_length:67_mod0000 -M_T0_RID201_S1_NZ_JBDYSJ010000001.1:587635-587727_length:93_mod0000 -M_T0_RID202_S0_NZ_JBDYLZ010000009.1:73121-73183_length:63_mod0000 -M_T0_RID203_S1_NC_027923.1:89467-89574_length:108_mod0000 -M_T0_RID203_S1_NC_028470.1:6286-6372_length:87_mod0000 -M_T0_RID204_S0_NZ_JBDYSJ010000003.1:424711-424783_length:73_mod0000 -M_T0_RID204_S1_NZ_JBDYLZ010000009.1:157953-158008_length:56_mod0000 -M_T0_RID205_S0_NC_028806.1:14973-15042_length:70_mod0001 -M_T0_RID205_S0_NC_031336.1:5585-5707_length:123_mod0000 -M_T0_RID205_S0_NC_033710.1:1140-1174_length:35_mod0001 -M_T0_RID205_S0_NC_034377.1:309-345_length:37_mod0000 -M_T0_RID205_S0_NZ_JBDYRX010000001.1:648020-648102_length:83_mod0000 -M_T0_RID206_S0_NZ_JBDYRX010000003.1:657781-657875_length:95_mod0000 -M_T0_RID206_S1_NZ_JBDYSJ010000002.1:507837-507900_length:64_mod0000 -M_T0_RID207_S0_NC_029782.1:2571-2655_length:85_mod0000 -M_T0_RID207_S0_NC_033756.1:9757-9804_length:48_mod0000 -M_T0_RID207_S1_NC_028470.1:3881-3944_length:64_mod0000 -M_T0_RID207_S1_NC_029111.1:391-425_length:35_mod0000 -M_T0_RID208_S1_NC_028137.1:3146-3238_length:93_mod0000 -M_T0_RID209_S1_NC_027016.1:200405-200534_length:130_mod0000 -M_T0_RID209_S1_NZ_JBDYRX010000003.1:693765-693849_length:85_mod0000 -M_T0_RID211_S0_NC_030749.1:1821-1921_length:101_mod0000 -M_T0_RID211_S0_NZ_JBDYSJ010000002.1:199161-199238_length:78_mod0000 -M_T0_RID212_S0_NC_028462.1:2849-2888_length:40_mod0000 -M_T0_RID212_S0_NC_031272.1:7400-7455_length:56_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:220611-220694_length:84_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:824198-824247_length:50_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000002.1:522607-522670_length:64_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000003.1:35532-35575_length:44_mod0000 -M_T0_RID213_S1_NC_027619.1:3998-4074_length:77_mod0000 -M_T0_RID214_S0_NC_017990.1:4036-4109_length:74_mod0000 -M_T0_RID214_S0_NZ_JBDYRX010000004.1:6306-6380_length:75_mod0000 -M_T0_RID214_S1_NZ_JBDYLZ010000016.1:26291-26346_length:56_mod0001 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:332282-332360_length:79_mod0000 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:457564-457597_length:34_mod0000 -M_T0_RID215_S1_NZ_JBDYRX010000004.1:547476-547541_length:66_mod0000 -M_T0_RID217_S0_NC_030922.1:6414-6531_length:118_mod0000 -M_T0_RID217_S0_NZ_JBDYRX010000001.1:366993-367094_length:102_mod0000 -M_T0_RID217_S1_NC_017970.1:8697-8737_length:41_mod0000 -M_T0_RID217_S1_NC_018482.1:2018-2099_length:82_mod0000 -M_T0_RID219_S0_NZ_JBDYLZ010000006.1:135272-135372_length:101_mod0001 -M_T0_RID219_S1_NZ_JBDYRX010000003.1:132173-132251_length:79_mod0000 -M_T0_RID220_S0_NC_033725.1:8661-8722_length:62_mod0000 -M_T0_RID220_S1_NZ_JBDYRX010000003.1:133141-133229_length:89_mod0000 -M_T0_RID221_S0_NZ_JBDYRX010000001.1:771011-771087_length:77_mod0000 -M_T0_RID222_S0_NC_037572.1:1818-1871_length:54_mod0000 -M_T0_RID222_S1_NC_028485.1:810-872_length:63_mod0000 -M_T0_RID222_S1_NC_030793.1:2889-2992_length:104_mod0000 -M_T0_RID222_S1_NZ_JBDYRX010000001.1:301419-301533_length:115_mod0001 -M_T0_RID223_S1_NC_033620.1:157690-157751_length:62_mod0000 -M_T0_RID224_S0_NC_017937.1:2859-2949_length:91_mod0000 -M_T0_RID224_S1_NC_028388.1:2224-2291_length:68_mod0001 -M_T0_RID224_S1_NC_033700.1:22817-22886_length:70_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000001.1:692859-692944_length:86_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000004.1:483631-483701_length:71_mod0000 -M_T0_RID225_S1_NC_029311.1:72416-72523_length:108_mod0000 -M_T0_RID225_S1_NC_030240.1:91908-91984_length:77_mod0000 -M_T0_RID226_S0_NZ_JBDYRX010000001.1:678003-678073_length:71_mod0000 -M_T0_RID226_S1_NZ_JBDYRX010000001.1:984964-985038_length:75_mod0000 -M_T0_RID227_S0_NC_028636.1:35420-35507_length:88_mod0000 -M_T0_RID227_S0_NZ_JBDYLZ010000014.1:18260-18351_length:92_mod0000 -M_T0_RID227_S1_NZ_JBDYLZ010000010.1:2424-2519_length:96_mod0000 -M_T0_RID229_S0_NZ_JBDYRX010000002.1:664717-664801_length:85_mod0000 -M_T0_RID230_S0_NC_033822.1:1869-1967_length:99_mod0000 -M_T0_RID230_S0_NZ_JBDYRX010000002.1:244562-244600_length:39_mod0000 -M_T0_RID231_S0_NC_034017.1:4341-4449_length:109_mod0000 -M_T0_RID231_S0_NZ_JBDYRX010000002.1:364966-365054_length:89_mod0000 -M_T0_RID231_S1_NZ_JBDYRX010000004.1:275949-276005_length:57_mod0001 -M_T0_RID233_S0_NC_030402.1:4056-4127_length:72_mod0000 -M_T0_RID234_S0_NZ_JBDYSJ010000001.1:910286-910315_length:30_mod0000 -M_T0_RID234_S1_NZ_JBDYSJ010000003.1:84105-84229_length:125_mod0000 -M_T0_RID235_S0_NC_029997.2:52965-53016_length:52_mod0000 -M_T0_RID235_S0_NZ_JBDYRX010000004.1:469577-469661_length:85_mod0000 -M_T0_RID235_S1_NC_029993.1:68-156_length:89_mod0000 -M_T0_RID236_S0_NC_027209.1:15-106_length:92_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000001.1:879200-879251_length:52_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000002.1:665177-665206_length:30_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:172535-172571_length:37_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:365370-365448_length:79_mod0000 -M_T0_RID237_S1_NZ_JBDYRX010000003.1:311400-311455_length:56_mod0000 -M_T0_RID237_S1_NZ_JBDYSJ010000001.1:341900-342051_length:152_mod0001 -M_T0_RID237_S1_NZ_JBDYSJ010000002.1:210078-210161_length:84_mod0000 -M_T0_RID239_S1_NZ_JBDYLZ010000008.1:60180-60243_length:64_mod0000 -M_T0_RID240_S0_NC_028376.1:8889-8978_length:90_mod0000 -M_T0_RID240_S0_NZ_JBDYLZ010000011.1:107039-107086_length:48_mod0000 -M_T0_RID240_S1_NC_029255.1:88189-88282_length:94_mod0000 -M_T0_RID242_S0_NC_031275.1:6726-6767_length:42_mod0000 -M_T0_RID242_S1_NZ_JBDYRX010000003.1:456427-456495_length:69_mod0000 -M_T0_RID243_S0_NC_038232.1:593-634_length:42_mod0000 -M_T0_RID244_S0_NZ_JBDYRX010000004.1:71169-71250_length:82_mod0000 -M_T0_RID244_S1_NC_031105.1:1094-1177_length:84_mod0000 -M_T0_RID244_S1_NZ_JBDYRX010000003.1:93344-93453_length:110_mod0000 -M_T0_RID245_S1_NC_027916.2:74440-74509_length:70_mod0000 -M_T0_RID246_S0_NZ_JBDYLZ010000007.1:253179-253255_length:77_mod0000 -M_T0_RID246_S0_NZ_JBDYRX010000003.1:373773-373844_length:72_mod0000 -M_T0_RID247_S1_NC_034240.1:6159-6240_length:82_mod0000 -M_T0_RID247_S1_NZ_JBDYLZ010000006.1:319402-319479_length:78_mod0000 -M_T0_RID248_S1_NZ_JBDYLZ010000021.1:15403-15484_length:82_mod0000 -M_T0_RID248_S1_NZ_JBDYSJ010000002.1:614316-614362_length:47_mod0000 -M_T0_RID249_S1_NZ_JBDYSJ010000002.1:599779-599834_length:56_mod0000 -M_T0_RID250_S0_NC_027916.2:147626-147747_length:122_mod0000 -M_T0_RID250_S0_NC_033620.1:26136-26203_length:68_mod0000 -M_T0_RID251_S1_NZ_JBDYRX010000003.1:388429-388516_length:88_mod0001 -M_T0_RID252_S0_NZ_JBDYRX010000003.1:533554-533659_length:106_mod0000 -M_T0_RID252_S0_NZ_JBDYSJ010000004.1:89796-89871_length:76_mod0000 -M_T0_RID254_S0_NC_029312.1:1320-1415_length:96_mod0000 -M_T0_RID254_S1_NC_033722.1:1513-1562_length:50_mod0000 -M_T0_RID254_S1_NZ_JBDYRX010000003.1:600746-600803_length:58_mod0000 -M_T0_RID255_S1_NZ_JBDYLZ010000009.1:84943-85024_length:82_mod0000 -M_T0_RID256_S0_NZ_JBDYRX010000002.1:72764-72831_length:68_mod0000 -M_T0_RID256_S1_NZ_JBDYSJ010000003.1:105583-105635_length:53_mod0001 -M_T0_RID257_S0_NC_029997.2:11591-11678_length:88_mod0000 -M_T0_RID257_S0_NZ_JBDYLZ010000007.1:42813-42887_length:75_mod0000 -M_T0_RID258_S0_NC_030151.1:5275-5349_length:75_mod0000 -M_T0_RID258_S1_NC_023442.1:46718-46759_length:42_mod0000 -M_T0_RID258_S1_NC_027641.1:2606-2691_length:86_mod0000 -M_T0_RID259_S0_NZ_JBDYRX010000001.1:515399-515441_length:43_mod0000 -M_T0_RID259_S1_NC_033710.1:2139-2199_length:61_mod0001 -M_T0_RID260_S0_NZ_JBDYRX010000004.1:304887-304994_length:108_mod0000 -M_T0_RID261_S0_NC_024913.1:363-436_length:74_mod0000 -M_T0_RID261_S1_NZ_JBDYSJ010000003.1:83891-83937_length:47_mod0000 -M_T0_RID262_S0_NC_028964.1:8465-8506_length:42_mod0000 -M_T0_RID262_S1_NC_028369.1:11507-11563_length:57_mod0000 -M_T0_RID263_S1_NZ_JBDYLZ010000007.1:59938-60023_length:86_mod0000 -M_T0_RID264_S1_NC_030240.1:10284-10380_length:97_mod0000 -M_T0_RID266_S0_NZ_JBDYRX010000003.1:575037-575078_length:42_mod0000 -M_T0_RID268_S0_NZ_JBDYRX010000001.1:768153-768245_length:93_mod0000 -M_T0_RID268_S0_NZ_JBDYSJ010000001.1:798703-798770_length:68_mod0000 -M_T0_RID270_S0_NC_029132.1:95722-95798_length:77_mod0000 -M_T0_RID270_S1_NZ_JBDYSJ010000004.1:222075-222158_length:84_mod0000 -M_T0_RID271_S0_NC_033620.1:162451-162504_length:54_mod0000 -M_T0_RID272_S0_NC_033620.1:33874-33960_length:87_mod0000 -M_T0_RID273_S1_NC_030744.1:7300-7340_length:41_mod0000 -M_T0_RID273_S1_NZ_JBDYRX010000002.1:841729-841840_length:112_mod0000 -M_T0_RID274_S1_NC_037571.1:1402-1475_length:74_mod0000 -M_T0_RID274_S1_NC_037615.1:1507-1556_length:50_mod0000 -M_T0_RID274_S1_NZ_JBDYRX010000002.1:803747-803830_length:84_mod0001 -M_T0_RID276_S0_NZ_JBDYSJ010000001.1:37440-37524_length:85_mod0000 -M_T0_RID276_S1_NZ_JBDYSJ010000003.1:418336-418453_length:118_mod0000 -M_T0_RID277_S1_NZ_JBDYLZ010000010.1:25227-25303_length:77_mod0000 -M_T0_RID277_S1_NZ_JBDYRX010000004.1:42366-42442_length:77_mod0000 -M_T0_RID280_S1_NC_029255.1:110657-110707_length:51_mod0000 -M_T0_RID280_S1_NZ_JBDYLZ010000007.1:148039-148124_length:86_mod0000 -M_T0_RID280_S1_NZ_JBDYSJ010000003.1:358558-358656_length:99_mod0000 -M_T0_RID281_S0_NZ_JBDYRX010000001.1:319973-320043_length:71_mod0000 -M_T0_RID281_S1_NC_033717.1:9058-9157_length:100_mod0000 -M_T0_RID281_S1_NZ_JBDYLZ010000009.1:175718-175802_length:85_mod0000 -M_T0_RID282_S0_NZ_JBDYRX010000002.1:378265-378345_length:81_mod0001 -M_T0_RID283_S1_NC_027016.1:6355-6413_length:59_mod0000 -M_T0_RID283_S1_NC_028230.1:391-510_length:120_mod0000 -M_T0_RID285_S1_NC_034376.1:1364-1410_length:47_mod0000 -M_T0_RID286_S1_NC_027918.1:6177-6259_length:83_mod0000 -M_T0_RID287_S0_NZ_JBDYRX010000003.1:370134-370205_length:72_mod0000 -M_T0_RID289_S0_NZ_JBDYRX010000001.1:744827-744955_length:129_mod0000 -M_T0_RID289_S1_NC_028259.1:3827-3878_length:52_mod0000 -M_T0_RID290_S0_NC_030240.1:45198-45233_length:36_mod0000 -M_T0_RID290_S0_NC_030691.1:1722-1773_length:52_mod0000 -M_T0_RID290_S1_NC_029133.1:4034-4132_length:99_mod0000 -M_T0_RID291_S1_NC_028981.1:5970-6046_length:77_mod0000 -M_T0_RID291_S1_NZ_JBDYSJ010000002.1:464139-464169_length:31_mod0000 -M_T0_RID293_S1_NC_030232.1:2260-2327_length:68_mod0000 -M_T0_RID295_S1_NC_027916.2:61867-61920_length:54_mod0000 -M_T0_RID295_S1_NC_028806.1:27530-27608_length:79_mod0000 -M_T0_RID296_S0_NZ_JBDYSJ010000001.1:184354-184410_length:57_mod0000 -M_T0_RID296_S1_NC_028867.1:5870-5944_length:75_mod0000 -M_T0_RID296_S1_NC_029034.2:6068-6170_length:103_mod0000 -M_T0_RID296_S1_NC_029575.1:1786-1824_length:39_mod0000 -M_T0_RID296_S1_NC_031313.1:8320-8423_length:104_mod0000 -M_T0_RID296_S1_NZ_JBDYRX010000001.1:732093-732144_length:52_mod0000 -M_T0_RID300_S0_NC_030870.1:888-963_length:76_mod0000 -M_T0_RID300_S1_NC_028239.1:12981-13075_length:95_mod0001 -M_T0_RID301_S0_NC_027016.1:47977-48089_length:113_mod0000 -M_T0_RID301_S0_NC_029997.2:77533-77588_length:56_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000001.1:795273-795348_length:76_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000003.1:723584-723651_length:68_mod0000 -M_T0_RID302_S1_NC_033820.1:4695-4770_length:76_mod0000 -M_T0_RID303_S0_NZ_JBDYSJ010000002.1:596456-596511_length:56_mod0000 -M_T0_RID303_S1_NZ_JBDYLZ010000013.1:92895-92926_length:32_mod0000 -M_T0_RID304_S0_NC_031463.1:20675-20751_length:77_mod0000 -M_T0_RID306_S0_NC_027916.2:96621-96699_length:79_mod0000 -M_T0_RID307_S0_NC_028266.1:10941-10980_length:40_mod0000 -M_T0_RID308_S1_NZ_JBDYLZ010000010.1:103191-103276_length:86_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:370261-370296_length:36_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:387786-387861_length:76_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000003.1:389721-389777_length:57_mod0000 -M_T0_RID309_S1_NC_026944.1:4310-4395_length:86_mod0000 -M_T0_RID309_S1_NZ_JBDYSJ010000001.1:151328-151382_length:55_mod0000 -M_T0_RID311_S0_NZ_JBDYLZ010000006.1:59717-59765_length:49_mod0000 -M_T0_RID311_S1_NZ_JBDYLZ010000023.1:5604-5703_length:100_mod0000 -M_T0_RID312_S1_NC_018382.1:3769-3816_length:48_mod0000 -M_T0_RID313_S1_NZ_JBDYRX010000002.1:139751-139865_length:115_mod0000 -M_T0_RID314_S0_NZ_JBDYSJ010000004.1:132522-132621_length:100_mod0000 -M_T0_RID315_S0_NC_033823.1:7820-7860_length:41_mod0000 -M_T0_RID317_S0_NC_034214.1:5951-5996_length:46_mod0000 -M_T0_RID317_S0_NZ_JBDYLZ010000015.1:71185-71277_length:93_mod0000 -M_T0_RID317_S0_NZ_JBDYRX010000004.1:174342-174382_length:41_mod0000 -M_T0_RID317_S1_NC_030293.1:5902-5968_length:67_mod0001 -M_T0_RID318_S0_NC_028814.1:27392-27476_length:85_mod0000 -M_T0_RID318_S0_NZ_JBDYRX010000001.1:771856-771930_length:75_mod0000 -M_T0_RID318_S1_NZ_JBDYLZ010000006.1:119310-119391_length:82_mod0000 -M_T0_RID319_S0_NC_034266.1:62140-62218_length:79_mod0000 -M_T0_RID319_S1_NC_028981.1:4292-4341_length:50_mod0000 -M_T0_RID319_S1_NC_031455.1:2498-2551_length:54_mod0000 -M_T0_RID319_S1_NZ_JBDYRX010000004.1:60929-61033_length:105_mod0000 -M_T0_RID322_S1_NZ_JBDYRX010000003.1:440227-440291_length:65_mod0000 -M_T0_RID323_S0_NC_030240.1:40893-40967_length:75_mod0000 -M_T0_RID323_S0_NZ_JBDYLZ010000007.1:249215-249268_length:54_mod0000 -M_T0_RID324_S0_NC_029311.1:87639-87764_length:126_mod0000 -M_T0_RID324_S0_NZ_JBDYSJ010000002.1:545609-545688_length:80_mod0000 -M_T0_RID324_S1_NZ_JBDYSJ010000003.1:210751-210786_length:36_mod0000 -M_T0_RID325_S1_NC_031240.1:7762-7813_length:52_mod0000 -M_T0_RID326_S0_NZ_JBDYLZ010000009.1:5470-5539_length:70_mod0000 -M_T0_RID328_S1_NZ_JBDYRX010000002.1:171169-171268_length:100_mod0000 -M_T0_RID329_S0_NZ_JBDYRX010000002.1:757356-757453_length:98_mod0000 -M_T0_RID329_S1_NZ_JBDYLZ010000008.1:68972-69065_length:94_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:680879-680974_length:96_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:706464-706551_length:88_mod0000 -M_T0_RID331_S0_NC_029255.1:77095-77131_length:37_mod0000 -M_T0_RID331_S0_NC_030240.1:62248-62311_length:64_mod0000 -M_T0_RID331_S1_NC_030126.1:1582-1653_length:72_mod0001 -M_T0_RID331_S1_NC_033707.1:5319-5406_length:88_mod0000 -M_T0_RID331_S1_NZ_JBDYLZ010000016.1:42739-42823_length:85_mod0000 -M_T0_RID332_S0_NZ_JBDYSJ010000004.1:35297-35358_length:62_mod0000 -M_T0_RID333_S0_NZ_JBDYLZ010000014.1:79014-79074_length:61_mod0000 -M_T0_RID333_S1_NC_027647.1:655-726_length:72_mod0000 -M_T0_RID333_S1_NC_033620.1:54726-54845_length:120_mod0000 -M_T0_RID334_S0_NZ_JBDYRX010000002.1:455003-455101_length:99_mod0000 -M_T0_RID335_S0_NZ_JBDYRX010000002.1:694573-694718_length:146_mod0000 -M_T0_RID335_S1_NZ_JBDYSJ010000001.1:102384-102461_length:78_mod0000 -M_T0_RID337_S0_NC_028368.1:13695-13792_length:98_mod0000 -M_T0_RID338_S0_NZ_JBDYRX010000001.1:578324-578379_length:56_mod0000 -M_T0_RID338_S1_NZ_JBDYRX010000003.1:471689-471760_length:72_mod0000 -M_T0_RID339_S1_NC_028362.1:1132-1236_length:105_mod0000 -M_T0_RID339_S1_NZ_JBDYRX010000003.1:626110-626150_length:41_mod0000 -M_T0_RID339_S1_NZ_JBDYSJ010000002.1:576422-576503_length:82_mod0000 -M_T0_RID340_S0_NC_028973.1:4682-4727_length:46_mod0000 -M_T0_RID340_S0_NC_029132.1:93532-93576_length:45_mod0000 -M_T0_RID341_S0_NC_030240.1:112206-112263_length:58_mod0000 -M_T0_RID341_S0_NC_034252.1:1229-1329_length:101_mod0000 -M_T0_RID342_S0_NZ_JBDYLZ010000011.1:111949-111982_length:34_mod0001 -M_T0_RID342_S1_NZ_JBDYLZ010000008.1:135318-135406_length:89_mod0001 -M_T0_RID343_S0_NC_029996.1:68953-69051_length:99_mod0000 -M_T0_RID344_S1_NC_030148.1:11118-11172_length:55_mod0000 -M_T0_RID345_S0_NZ_JBDYRX010000002.1:64932-64977_length:46_mod0000 -M_T0_RID346_S1_NZ_JBDYRX010000003.1:433612-433704_length:93_mod0000 -M_T0_RID347_S0_NC_036636.1:7712-7773_length:62_mod0000 -M_T0_RID347_S1_NZ_JBDYRX010000002.1:59074-59138_length:65_mod0000 -M_T0_RID347_S1_NZ_JBDYSJ010000003.1:117376-117430_length:55_mod0001 -M_T0_RID348_S0_NZ_JBDYRX010000001.1:1015831-1015930_length:100_mod0000 -M_T0_RID348_S1_NZ_JBDYRX010000001.1:141445-141557_length:113_mod0000 -M_T0_RID349_S0_NC_030391.1:4068-4155_length:88_mod0001 -M_T0_RID349_S0_NZ_JBDYRX010000001.1:226925-227009_length:85_mod0000 -M_T0_RID349_S1_NZ_JBDYRX010000003.1:358370-358434_length:65_mod0000 -M_T0_RID351_S0_NC_033753.1:4226-4317_length:92_mod0000 -M_T0_RID352_S1_NC_028259.1:56-127_length:72_mod0000 -M_T0_RID352_S1_NC_028395.1:155-248_length:94_mod0000 -M_T0_RID352_S1_NC_029931.1:9204-9241_length:38_mod0000 -M_T0_RID353_S0_NZ_JBDYLZ010000009.1:48165-48236_length:72_mod0000 -M_T0_RID354_S1_NZ_JBDYLZ010000012.1:45797-45922_length:126_mod0000 -M_T0_RID356_S0_NC_028378.1:3454-3530_length:77_mod0000 -M_T0_RID357_S0_NZ_JBDYRX010000002.1:120553-120591_length:39_mod0000 -M_T0_RID357_S1_NZ_JBDYSJ010000004.1:245908-245957_length:50_mod0000 -M_T0_RID358_S0_NC_029126.1:5901-5938_length:38_mod0000 -M_T0_RID358_S1_NC_028140.1:1554-1651_length:98_mod0000 -M_T0_RID358_S1_NZ_JBDYSJ010000002.1:580725-580785_length:61_mod0001 -M_T0_RID359_S0_NZ_JBDYRX010000001.1:601220-601298_length:79_mod0000 -M_T0_RID360_S0_NC_027916.2:77660-77740_length:81_mod0001 -M_T0_RID360_S0_NZ_JBDYLZ010000012.1:70482-70531_length:50_mod0000 -M_T0_RID360_S1_NC_017862.1:2881-2912_length:32_mod0000 -M_T0_RID360_S1_NC_028373.1:7802-7900_length:99_mod0000 -M_T0_RID361_S0_NZ_JBDYRX010000003.1:274684-274747_length:64_mod0000 -M_T0_RID362_S0_NC_029996.1:102820-102944_length:125_mod0001 -M_T0_RID362_S1_NC_027916.2:110368-110450_length:83_mod0000 -M_T0_RID362_S1_NZ_JBDYSJ010000002.1:480705-480765_length:61_mod0000 -M_T0_RID363_S0_NC_031089.1:6455-6543_length:89_mod0000 -M_T0_RID363_S0_NC_031218.1:1568-1623_length:56_mod0000 -M_T0_RID365_S1_NZ_JBDYSJ010000002.1:271975-272051_length:77_mod0000 -M_T0_RID366_S0_NZ_JBDYSJ010000001.1:487398-487484_length:87_mod0001 -M_T0_RID366_S1_NC_030843.1:4921-5005_length:85_mod0000 -M_T0_RID367_S0_NC_030127.1:2548-2589_length:42_mod0000 -M_T0_RID367_S0_NZ_JBDYLZ010000011.1:24860-24971_length:112_mod0000 -M_T0_RID367_S1_NZ_JBDYLZ010000006.1:96139-96201_length:63_mod0000 -M_T0_RID368_S0_NZ_JBDYSJ010000002.1:604782-604905_length:124_mod0001 -M_T0_RID369_S1_NC_031464.1:5161-5234_length:74_mod0000 -M_T0_RID370_S0_NC_027542.1:1019-1100_length:82_mod0000 -M_T0_RID371_S1_NC_028144.1:5011-5099_length:89_mod0000 -M_T0_RID371_S1_NZ_JBDYRX010000002.1:678499-678596_length:98_mod0000 -M_T0_RID372_S0_NZ_JBDYRX010000003.1:526040-526077_length:38_mod0000 -M_T0_RID372_S0_NZ_JBDYSJ010000002.1:283416-283463_length:48_mod0001 -M_T0_RID373_S0_NC_033705.1:55-95_length:41_mod0000 -M_T0_RID374_S0_NC_027016.1:151413-151449_length:37_mod0000 -M_T0_RID374_S0_NZ_JBDYSJ010000003.1:310288-310375_length:88_mod0000 -M_T0_RID374_S1_NZ_JBDYLZ010000012.1:57726-57851_length:126_mod0000 -M_T0_RID375_S0_NC_034377.1:6340-6385_length:46_mod0000 -M_T0_RID375_S1_NC_028099.1:112413-112504_length:92_mod0001 -M_T0_RID378_S0_NC_018448.1:5936-6007_length:72_mod0000 -M_T0_RID379_S1_NZ_JBDYRX010000001.1:727009-727109_length:101_mod0000 -M_T0_RID380_S0_NC_034253.1:5146-5187_length:42_mod0000 -M_T0_RID380_S1_NC_029905.1:2051-2094_length:44_mod0000 -M_T0_RID381_S0_NC_030240.1:103311-103373_length:63_mod0000 -M_T0_RID381_S0_NZ_JBDYLZ010000009.1:178104-178162_length:59_mod0000 -M_T0_RID382_S0_NC_027210.1:5895-5968_length:74_mod0000 -M_T0_RID382_S0_NC_029996.1:87376-87478_length:103_mod0000 -M_T0_RID382_S1_NC_027916.2:84236-84307_length:72_mod0000 -M_T0_RID383_S0_NZ_JBDYSJ010000001.1:683370-683456_length:87_mod0000 -M_T0_RID383_S1_NC_029132.1:79856-79920_length:65_mod0000 -M_T0_RID385_S0_NZ_JBDYLZ010000009.1:69071-69118_length:48_mod0000 -M_T0_RID386_S0_NC_034225.1:1556-1648_length:93_mod0000 -M_T0_RID387_S1_NC_028636.1:123682-123742_length:61_mod0000 -M_T0_RID388_S0_NZ_JBDYLZ010000008.1:71860-71983_length:124_mod0000 -M_T0_RID389_S0_NC_029051.1:9270-9318_length:49_mod0000 -M_T0_RID389_S0_NZ_JBDYLZ010000016.1:61192-61254_length:63_mod0000 -M_T0_RID390_S1_NC_028981.1:1738-1830_length:93_mod0000 -M_T0_RID391_S0_NC_028371.1:6428-6495_length:68_mod0000 -M_T0_RID391_S0_NZ_JBDYRX010000004.1:272450-272500_length:51_mod0000 -M_T0_RID391_S1_NZ_JBDYSJ010000002.1:543099-543205_length:107_mod0000 -M_T0_RID392_S0_NC_028970.1:5031-5099_length:69_mod0000 -M_T0_RID392_S1_NC_028824.1:19380-19469_length:90_mod0000 -M_T0_RID392_S1_NZ_JBDYLZ010000009.1:26519-26597_length:79_mod0000 -M_T0_RID393_S0_NZ_JBDYLZ010000015.1:66736-66802_length:67_mod0000 -M_T0_RID395_S0_NC_031304.1:4214-4304_length:91_mod0000 -M_T0_RID396_S0_NZ_JBDYSJ010000001.1:683444-683483_length:40_mod0000 -M_T0_RID397_S0_NC_028125.1:5157-5221_length:65_mod0000 -M_T0_RID398_S0_NC_028814.1:21296-21329_length:34_mod0000 -M_T0_RID398_S0_NZ_JBDYLZ010000008.1:89568-89611_length:44_mod0000 -M_T0_RID398_S1_NZ_JBDYRX010000003.1:160428-160514_length:87_mod0000 -M_T0_RID399_S1_NZ_JBDYRX010000002.1:383166-383266_length:101_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000006.1:321094-321166_length:73_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000017.1:46480-46536_length:57_mod0000 -M_T0_RID402_S0_NC_028491.1:36087-36159_length:73_mod0000 -M_T0_RID406_S0_NC_033720.1:8569-8637_length:69_mod0000 -M_T0_RID406_S0_NZ_JBDYSJ010000002.1:605544-605617_length:74_mod0000 -M_T0_RID406_S1_NC_033620.1:71763-71841_length:79_mod0000 -M_T0_RID407_S0_NC_028491.1:95220-95304_length:85_mod0000 -M_T0_RID407_S0_NZ_JBDYRX010000004.1:531865-531922_length:58_mod0000 -M_T0_RID408_S0_NZ_JBDYLZ010000006.1:20241-20331_length:91_mod0000 -M_T0_RID408_S1_NC_030391.1:1047-1152_length:106_mod0000 -M_T0_RID409_S1_NC_029904.1:2927-3013_length:87_mod0000 -M_T0_RID410_S0_NC_028369.1:7176-7240_length:65_mod0000 -M_T0_RID410_S1_NC_027923.1:107200-107294_length:95_mod0000 -M_T0_RID411_S1_NC_027916.2:12656-12743_length:88_mod0000 -M_T0_RID412_S0_NC_028362.1:1734-1810_length:77_mod0000 -M_T0_RID414_S0_NC_027646.1:3518-3556_length:39_mod0000 -M_T0_RID415_S1_NC_033703.1:4454-4536_length:83_mod0000 -M_T0_RID415_S1_NZ_JBDYRX010000004.1:398358-398416_length:59_mod0000 -M_T0_RID419_S0_NZ_JBDYSJ010000002.1:339543-339583_length:41_mod0000 -M_T0_RID420_S0_NC_029919.1:1092-1170_length:79_mod0000 -M_T0_RID420_S1_NC_029132.1:86139-86240_length:102_mod0000 -M_T0_RID421_S0_NZ_JBDYRX010000004.1:42510-42680_length:171_mod0001 -M_T0_RID421_S1_NC_028099.1:99392-99421_length:30_mod0000 -M_T0_RID422_S0_NC_028236.1:7738-7797_length:60_mod0000 -M_T0_RID422_S0_NZ_JBDYLZ010000014.1:21662-21716_length:55_mod0000 -M_T0_RID422_S0_NZ_JBDYSJ010000002.1:476168-476219_length:52_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:131159-131244_length:86_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:465551-465658_length:108_mod0000 -M_T0_RID424_S0_NC_029132.1:124479-124602_length:124_mod0000 -M_T0_RID424_S1_NZ_JBDYLZ010000006.1:180426-180481_length:56_mod0000 -M_T0_RID424_S1_NZ_JBDYSJ010000003.1:445372-445447_length:76_mod0000 -M_T0_RID425_S0_NZ_JBDYLZ010000006.1:11120-11222_length:103_mod0000 -M_T0_RID426_S1_NZ_JBDYRX010000002.1:460851-460904_length:54_mod0000 -M_T0_RID426_S1_NZ_JBDYSJ010000001.1:882579-882628_length:50_mod0000 -M_T0_RID427_S0_NZ_JBDYSJ010000001.1:460394-460459_length:66_mod0000 -M_T0_RID428_S1_NZ_JBDYLZ010000007.1:203593-203667_length:75_mod0000 -M_T0_RID432_S1_NZ_JBDYRX010000004.1:37215-37282_length:68_mod0000 -M_T0_RID433_S0_NC_028371.1:7751-7803_length:53_mod0000 -M_T0_RID433_S0_NZ_JBDYRX010000001.1:940205-940283_length:79_mod0000 -M_T0_RID434_S0_NZ_JBDYRX010000003.1:278075-278140_length:66_mod0000 -M_T0_RID435_S1_NC_031225.1:6315-6360_length:46_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000001.1:992235-992354_length:120_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000002.1:28179-28253_length:75_mod0000 -M_T0_RID436_S0_NZ_JBDYRX010000004.1:193926-194033_length:108_mod0000 -M_T0_RID438_S0_NZ_JBDYRX010000004.1:427488-427551_length:64_mod0000 -M_T0_RID441_S1_NC_028486.1:4288-4332_length:45_mod0000 -M_T0_RID441_S1_NC_031135.1:1215-1254_length:40_mod0000 -M_T0_RID441_S1_NC_033620.1:171185-171273_length:89_mod0000 -M_T0_RID441_S1_NZ_JBDYRX010000001.1:944430-944505_length:76_mod0000 -M_T0_RID442_S1_NZ_JBDYSJ010000001.1:795030-795132_length:103_mod0000 -M_T0_RID444_S1_NC_029927.1:739-780_length:42_mod0000 -M_T0_RID445_S0_NC_030400.1:9136-9237_length:102_mod0000 -M_T0_RID445_S1_NC_037578.1:3062-3107_length:46_mod0000 -M_T0_RID446_S0_NC_029996.1:10622-10695_length:74_mod0000 -M_T0_RID446_S1_NC_034266.1:27796-27894_length:99_mod0000 -M_T0_RID447_S1_NC_031259.1:1711-1781_length:71_mod0000 -M_T0_RID450_S0_NZ_JBDYRX010000003.1:719829-719908_length:80_mod0000 -M_T0_RID451_S0_NC_027214.1:8775-8830_length:56_mod0000 -M_T0_RID451_S0_NC_028367.1:5391-5502_length:112_mod0000 -M_T0_RID451_S1_NZ_JBDYRX010000002.1:31090-31200_length:111_mod0000 -M_T0_RID452_S1_NC_030205.1:1725-1812_length:88_mod0000 -M_T0_RID453_S0_NC_033761.1:8903-9009_length:107_mod0001 -M_T0_RID455_S0_NC_027799.1:284-375_length:92_mod0000 -M_T0_RID455_S1_NZ_JBDYLZ010000014.1:95838-95936_length:99_mod0000 -M_T0_RID455_S1_NZ_JBDYSJ010000002.1:210490-210557_length:68_mod0000 -M_T0_RID456_S0_NZ_JBDYLZ010000007.1:109571-109660_length:90_mod0000 -M_T0_RID456_S1_NC_030240.1:55430-55543_length:114_mod0000 -M_T0_RID457_S1_NZ_JBDYLZ010000009.1:123168-123262_length:95_mod0000 -M_T0_RID457_S1_NZ_JBDYSJ010000004.1:21364-21417_length:54_mod0000 -M_T0_RID458_S1_NC_034266.1:128171-128258_length:88_mod0000 -M_T0_RID458_S1_NZ_JBDYLZ010000008.1:129533-129587_length:55_mod0000 -M_T0_RID458_S1_NZ_JBDYRX010000002.1:29087-29147_length:61_mod0000 -M_T0_RID459_S0_NZ_JBDYRX010000001.1:1023086-1023182_length:97_mod0000 -M_T0_RID459_S1_NC_023442.1:114262-114356_length:95_mod0000 -M_T0_RID460_S0_NC_029052.1:1193-1273_length:81_mod0000 -M_T0_RID462_S1_NZ_JBDYRX010000001.1:1005315-1005420_length:106_mod0000 -M_T0_RID463_S0_NC_028372.1:9914-9999_length:86_mod0000 -M_T0_RID463_S1_NZ_JBDYSJ010000004.1:218365-218453_length:89_mod0000 -M_T0_RID465_S0_NZ_JBDYSJ010000001.1:787887-787945_length:59_mod0000 -M_T0_RID465_S1_NC_029311.1:1797-1831_length:35_mod0000 -M_T0_RID466_S0_NZ_JBDYRX010000003.1:730520-730588_length:69_mod0000 -M_T0_RID470_S1_NC_033820.1:3073-3102_length:30_mod0000 -M_T0_RID471_S1_NZ_JBDYLZ010000008.1:35202-35290_length:89_mod0000 -M_T0_RID472_S0_NZ_JBDYLZ010000011.1:10802-10846_length:45_mod0000 -M_T0_RID472_S1_NZ_JBDYRX010000001.1:652634-652707_length:74_mod0000 -M_T0_RID474_S0_NC_030225.1:5289-5336_length:48_mod0000 -M_T0_RID475_S0_NZ_JBDYLZ010000006.1:151548-151631_length:84_mod0000 -M_T0_RID475_S0_NZ_JBDYRX010000002.1:464041-464153_length:113_mod0000 -M_T0_RID476_S0_NZ_JBDYLZ010000015.1:62860-62918_length:59_mod0000 -M_T0_RID477_S0_NC_027214.1:4315-4391_length:77_mod0000 -M_T0_RID477_S0_NC_030231.1:4362-4445_length:84_mod0000 -M_T0_RID477_S1_NC_027926.1:5336-5385_length:50_mod0000 -M_T0_RID479_S0_NC_034240.1:10006-10105_length:100_mod0000 -M_T0_RID479_S0_NC_034377.1:6973-7006_length:34_mod0000 -M_T0_RID479_S1_NC_029309.1:1183-1291_length:109_mod0000 -M_T0_RID479_S1_NZ_JBDYRX010000004.1:294593-294685_length:93_mod0000 -M_T0_RID480_S0_NC_030148.1:14092-14146_length:55_mod0000 -M_T0_RID481_S1_NC_027920.1:4910-4956_length:47_mod0000 -M_T0_RID481_S1_NC_028252.1:1447-1525_length:79_mod0000 -M_T0_RID481_S1_NC_029038.1:3990-4034_length:45_mod0000 -M_T0_RID482_S0_NC_031287.1:3748-3826_length:79_mod0000 -M_T0_RID483_S0_NC_029311.1:111589-111673_length:85_mod0000 -M_T0_RID484_S0_NZ_JBDYRX010000001.1:874633-874662_length:30_mod0000 -M_T0_RID484_S1_NZ_JBDYRX010000002.1:457659-457735_length:77_mod0000 -M_T0_RID487_S0_NC_023339.1:3452-3542_length:91_mod0000 -M_T0_RID488_S1_NC_030800.1:3767-3843_length:77_mod0000 -M_T0_RID490_S1_NC_028249.1:6706-6755_length:50_mod0000 -M_T0_RID490_S1_NC_033815.1:382-420_length:39_mod0000 -M_T0_RID491_S0_NC_029549.1:1543-1601_length:59_mod0000 -M_T0_RID491_S1_NC_023442.1:106362-106456_length:95_mod0001 -M_T0_RID491_S1_NZ_JBDYSJ010000002.1:433503-433622_length:120_mod0000 -M_T0_RID492_S1_NC_017967.1:4737-4790_length:54_mod0000 -M_T0_RID497_S1_NC_028231.1:2435-2530_length:96_mod0000 -M_T0_RID498_S1_NC_028368.1:10324-10389_length:66_mod0000 -M_T0_RID498_S1_NC_031088.1:10285-10350_length:66_mod0000 -M_T0_RID499_S0_NZ_JBDYLZ010000012.1:63930-64011_length:82_mod0000 -M_T0_RID500_S0_NZ_JBDYSJ010000003.1:369722-369827_length:106_mod0000 -M_T0_RID501_S0_NC_034214.1:4534-4626_length:93_mod0000 -M_T0_RID503_S1_NZ_JBDYLZ010000014.1:65584-65643_length:60_mod0001 -M_T0_RID504_S0_NC_033727.1:6181-6283_length:103_mod0000 -M_T0_RID504_S0_NC_037572.1:353-481_length:129_mod0000 -M_T0_RID506_S0_NZ_JBDYSJ010000001.1:230782-230869_length:88_mod0000 -M_T0_RID506_S1_NZ_JBDYRX010000001.1:155361-155441_length:81_mod0000 -M_T0_RID507_S0_NZ_JBDYRX010000001.1:64196-64251_length:56_mod0001 -M_T0_RID507_S0_NZ_JBDYRX010000002.1:311911-312021_length:111_mod0000 -M_T0_RID508_S1_NC_028382.1:618-664_length:47_mod0000 -M_T0_RID509_S0_NZ_JBDYRX010000002.1:83623-83710_length:88_mod0000 -M_T0_RID509_S0_NZ_JBDYSJ010000002.1:32694-32813_length:120_mod0000 -M_T0_RID512_S0_NC_031301.1:7499-7600_length:102_mod0000 -M_T0_RID512_S0_NZ_JBDYSJ010000001.1:497297-497384_length:88_mod0001 -M_T0_RID512_S1_NC_023299.1:173-222_length:50_mod0000 -M_T0_RID514_S0_NC_028144.1:1039-1130_length:92_mod0000 -M_T0_RID515_S1_NC_028239.1:1870-1935_length:66_mod0000 -M_T0_RID516_S0_NC_028099.1:69736-69811_length:76_mod0000 -M_T0_RID518_S0_NZ_JBDYSJ010000002.1:172879-172954_length:76_mod0000 -M_T0_RID518_S1_NC_028374.1:22488-22593_length:106_mod0000 -M_T0_RID519_S0_NZ_JBDYSJ010000004.1:83804-83909_length:106_mod0000 -M_T0_RID519_S1_NC_023442.1:37132-37228_length:97_mod0000 -M_T0_RID520_S1_NC_033821.1:5336-5462_length:127_mod0000 -M_T0_RID521_S1_NC_028362.1:8323-8409_length:87_mod0000 -M_T0_RID521_S1_NC_033620.1:165922-166009_length:88_mod0000 -M_T0_RID526_S0_NZ_JBDYLZ010000008.1:191196-191301_length:106_mod0000 -M_T0_RID527_S0_NZ_JBDYRX010000001.1:664374-664450_length:77_mod0000 -M_T0_RID530_S1_NC_029255.1:118676-118738_length:63_mod0000 -M_T0_RID531_S0_NC_030240.1:18050-18083_length:34_mod0000 -M_T0_RID535_S0_NZ_JBDYRX010000003.1:273784-273814_length:31_mod0000 -M_T0_RID535_S0_NZ_JBDYSJ010000001.1:408974-409045_length:72_mod0000 -M_T0_RID536_S1_NZ_JBDYLZ010000007.1:187492-187559_length:68_mod0001 -M_T0_RID537_S0_NC_031106.1:5925-5990_length:66_mod0000 -M_T0_RID539_S0_NC_023442.1:25605-25715_length:111_mod0000 -M_T0_RID539_S0_NC_030922.1:6177-6250_length:74_mod0000 -M_T0_RID539_S1_NC_033732.1:488-545_length:58_mod0000 -M_T0_RID539_S1_NZ_JBDYRX010000003.1:428710-428748_length:39_mod0000 -M_T0_RID540_S1_NC_028636.1:8122-8203_length:82_mod0000 -M_T0_RID540_S1_NC_033777.1:478-533_length:56_mod0000 -M_T0_RID541_S0_NZ_JBDYLZ010000009.1:17788-17882_length:95_mod0000 -M_T0_RID543_S0_NZ_JBDYLZ010000006.1:137222-137319_length:98_mod0000 -M_T0_RID545_S1_NC_033620.1:141319-141407_length:89_mod0000 -M_T0_RID547_S0_NC_029901.1:2272-2382_length:111_mod0000 -M_T0_RID548_S0_NC_027916.2:50899-50962_length:64_mod0000 -M_T0_RID549_S0_NZ_JBDYRX010000003.1:184280-184329_length:50_mod0000 -M_T0_RID549_S1_NC_027016.1:166476-166540_length:65_mod0001 -M_T0_RID552_S0_NC_031244.1:259-371_length:113_mod0000 -M_T0_RID552_S1_NZ_JBDYSJ010000001.1:904809-904898_length:90_mod0000 -M_T0_RID555_S0_NC_029255.1:86976-87025_length:50_mod0000 -M_T0_RID555_S0_NC_033700.1:23881-23958_length:78_mod0000 -M_T0_RID555_S1_NZ_JBDYSJ010000003.1:459317-459387_length:71_mod0000 -M_T0_RID556_S0_NC_029800.1:2415-2467_length:53_mod0000 -M_T0_RID556_S0_NZ_JBDYRX010000003.1:269557-269627_length:71_mod0000 -M_T0_RID556_S1_NC_018151.1:436-524_length:89_mod0000 -M_T0_RID556_S1_NC_029997.2:2602-2635_length:34_mod0000 -M_T0_RID560_S0_NC_030691.1:8709-8769_length:61_mod0000 -M_T0_RID563_S0_NZ_JBDYSJ010000001.1:279557-279665_length:109_mod0000 -M_T0_RID563_S1_NC_029255.1:16285-16387_length:103_mod0000 -M_T0_RID563_S1_NC_030651.1:8044-8106_length:63_mod0000 -M_T0_RID564_S1_NC_030380.1:905-947_length:43_mod0000 -M_T0_RID566_S0_NZ_JBDYRX010000002.1:228758-228796_length:39_mod0000 -M_T0_RID566_S1_NC_027916.2:158878-158953_length:76_mod0000 -M_T0_RID568_S0_NC_033718.1:5028-5099_length:72_mod0000 -M_T0_RID569_S1_NZ_JBDYSJ010000002.1:4445-4500_length:56_mod0000 -M_T0_RID571_S1_NC_030200.1:53402-53457_length:56_mod0000 -M_T0_RID571_S1_NC_031291.1:6265-6343_length:79_mod0000 -M_T0_RID573_S0_NZ_JBDYSJ010000001.1:821929-821988_length:60_mod0000 -M_T0_RID573_S1_NZ_JBDYRX010000002.1:420333-420420_length:88_mod0000 -M_T0_RID578_S0_NC_028389.1:883-929_length:47_mod0000 -M_T0_RID578_S1_NC_027920.1:2737-2802_length:66_mod0000 -M_T0_RID578_S1_NZ_JBDYRX010000001.1:125147-125264_length:118_mod0000 -M_T0_RID579_S1_NC_028636.1:80919-81006_length:88_mod0000 -M_T0_RID579_S1_NZ_JBDYRX010000003.1:600760-600842_length:83_mod0000 -M_T0_RID579_S1_NZ_JBDYSJ010000001.1:621908-622008_length:101_mod0000 -M_T0_RID580_S0_NC_031236.1:9639-9701_length:63_mod0000 -M_T0_RID580_S0_NC_033620.1:115666-115748_length:83_mod0000 -M_T0_RID584_S1_NZ_JBDYRX010000003.1:30143-30232_length:90_mod0000 -M_T0_RID587_S1_NC_030236.1:1921-2018_length:98_mod0000 -M_T0_RID588_S0_NZ_JBDYRX010000004.1:487902-487980_length:79_mod0000 -M_T0_RID592_S0_NZ_JBDYRX010000004.1:290162-290207_length:46_mod0000 -M_T0_RID596_S0_NC_028491.1:22873-22918_length:46_mod0000 -M_T0_RID597_S0_NZ_JBDYRX010000004.1:248380-248414_length:35_mod0000 -M_T0_RID598_S0_NZ_JBDYLZ010000013.1:99135-99225_length:91_mod0000 -M_T0_RID598_S0_NZ_JBDYRX010000004.1:521129-521194_length:66_mod0000 -M_T0_RID598_S1_NC_027781.1:1542-1623_length:82_mod0000 -M_T0_RID598_S1_NC_033828.1:1452-1571_length:120_mod0000 -M_T0_RID599_S0_NZ_JBDYLZ010000018.1:17132-17215_length:84_mod0000 -M_T0_RID601_S1_NZ_JBDYRX010000004.1:64749-64831_length:83_mod0000 -M_T0_RID601_S1_NZ_JBDYSJ010000004.1:72990-73054_length:65_mod0000 -M_T0_RID603_S1_NZ_JBDYRX010000003.1:148174-148218_length:45_mod0000 -M_T0_RID606_S1_NZ_JBDYRX010000004.1:81494-81540_length:47_mod0000 -M_T0_RID608_S1_NZ_JBDYLZ010000006.1:54120-54159_length:40_mod0000 -M_T0_RID608_S1_NZ_JBDYSJ010000003.1:75571-75624_length:54_mod0000 -M_T0_RID609_S0_NZ_JBDYLZ010000017.1:21746-21833_length:88_mod0000 -M_T0_RID610_S1_NZ_JBDYRX010000004.1:416636-416711_length:76_mod0000 -M_T0_RID617_S1_NZ_JBDYLZ010000013.1:81956-82016_length:61_mod0000 -M_T0_RID618_S0_NZ_JBDYRX010000001.1:154047-154079_length:33_mod0000 -M_T0_RID619_S0_NZ_JBDYRX010000001.1:929162-929284_length:123_mod0000 -M_T0_RID620_S1_NZ_JBDYRX010000004.1:231083-231194_length:112_mod0000 -M_T0_RID622_S0_NC_029117.1:1274-1341_length:68_mod0000 -M_T0_RID625_S1_NZ_JBDYRX010000003.1:351246-351297_length:52_mod0000 -M_T0_RID626_S0_NZ_JBDYRX010000003.1:54224-54264_length:41_mod0000 -M_T0_RID627_S1_NZ_JBDYRX010000002.1:425465-425547_length:83_mod0000 -M_T0_RID629_S1_NC_028264.1:4326-4405_length:80_mod0000 -M_T0_RID630_S0_NZ_JBDYSJ010000002.1:388835-388868_length:34_mod0000 -M_T0_RID633_S1_NZ_JBDYRX010000003.1:253941-254012_length:72_mod0000 -M_T0_RID634_S1_NC_033815.1:2695-2865_length:171_mod0000 -M_T0_RID635_S1_NC_033700.1:17426-17511_length:86_mod0000 -M_T0_RID636_S0_NC_029086.1:7004-7042_length:39_mod0000 -M_T0_RID638_S1_NZ_JBDYSJ010000001.1:82298-82352_length:55_mod0000 -M_T0_RID640_S0_NC_033756.1:5658-5786_length:129_mod0001 -M_T0_RID641_S0_NC_027706.1:187-292_length:106_mod0000 -M_T0_RID642_S0_NC_034266.1:154137-154203_length:67_mod0000 -M_T0_RID642_S0_NZ_JBDYRX010000003.1:290122-290229_length:108_mod0000 -M_T0_RID643_S0_NC_017937.1:1077-1164_length:88_mod0000 -M_T0_RID643_S0_NZ_JBDYRX010000002.1:527817-527928_length:112_mod0000 -M_T0_RID645_S0_NC_030799.1:4650-4688_length:39_mod0000 -M_T0_RID645_S1_NZ_JBDYLZ010000008.1:186276-186348_length:73_mod0000 -M_T0_RID651_S1_NC_033733.1:2956-3039_length:84_mod0001 -M_T0_RID651_S1_NZ_JBDYRX010000001.1:479171-479229_length:59_mod0000 -M_T0_RID653_S1_NC_029311.1:77186-77261_length:76_mod0000 -M_T0_RID654_S0_NZ_JBDYSJ010000001.1:904727-904802_length:76_mod0000 -M_T0_RID655_S0_NZ_JBDYSJ010000001.1:482269-482365_length:97_mod0000 -M_T0_RID655_S1_NZ_JBDYRX010000002.1:520330-520420_length:91_mod0000 -M_T0_RID656_S0_NC_028259.1:1542-1591_length:50_mod0000 -M_T0_RID656_S0_NZ_JBDYLZ010000019.1:6097-6185_length:89_mod0000 -M_T0_RID660_S1_NC_034266.1:157401-157477_length:77_mod0000 -M_T0_RID664_S0_NC_027916.2:59946-59993_length:48_mod0000 -M_T0_RID664_S0_NZ_JBDYLZ010000015.1:82686-82741_length:56_mod0000 -M_T0_RID664_S0_NZ_JBDYSJ010000003.1:87421-87503_length:83_mod0000 -M_T0_RID668_S0_NZ_JBDYRX010000004.1:18573-18663_length:91_mod0000 -M_T0_RID670_S0_NC_027920.1:1301-1393_length:93_mod0000 -M_T0_RID673_S1_NC_033703.1:545-616_length:72_mod0000 -M_T0_RID673_S1_NZ_JBDYRX010000001.1:644803-644895_length:93_mod0000 -M_T0_RID679_S0_NZ_JBDYRX010000002.1:605076-605139_length:64_mod0000 -M_T0_RID679_S1_NC_033703.1:1306-1364_length:59_mod0000 -M_T0_RID680_S0_NZ_JBDYRX010000002.1:632837-632879_length:43_mod0000 -M_T0_RID681_S1_NZ_JBDYSJ010000002.1:496144-496188_length:45_mod0000 -M_T0_RID682_S0_NZ_JBDYSJ010000001.1:116469-116509_length:41_mod0000 -M_T0_RID683_S0_NZ_JBDYRX010000001.1:675311-675352_length:42_mod0000 -M_T0_RID683_S0_NZ_JBDYSJ010000004.1:71365-71456_length:92_mod0000 -M_T0_RID683_S1_NC_029255.1:7610-7675_length:66_mod0000 -M_T0_RID686_S0_NC_027429.1:2932-2966_length:35_mod0000 -M_T0_RID686_S1_NC_027923.1:107955-107999_length:45_mod0000 -M_T0_RID686_S1_NC_029132.1:95050-95160_length:111_mod0000 -M_T0_RID689_S1_NZ_JBDYSJ010000004.1:138231-138318_length:88_mod0000 -M_T0_RID691_S1_NC_033710.1:3870-3926_length:57_mod0000 -M_T0_RID692_S1_NC_027531.1:1508-1612_length:105_mod0000 -M_T0_RID695_S0_NC_030200.1:124072-124139_length:68_mod0000 -M_T0_RID697_S0_NC_028921.1:5390-5470_length:81_mod0000 -M_T0_RID699_S0_NC_031083.1:4910-4975_length:66_mod0000 -M_T0_RID699_S1_NZ_JBDYLZ010000010.1:101894-101946_length:53_mod0000 -M_T0_RID700_S1_NZ_JBDYSJ010000001.1:915360-915453_length:94_mod0000 -M_T0_RID702_S1_NC_028099.1:63829-63929_length:101_mod0000 -M_T0_RID706_S0_NC_027210.1:7432-7505_length:74_mod0000 -M_T0_RID707_S1_NZ_JBDYRX010000002.1:367432-367522_length:91_mod0001 -M_T0_RID707_S1_NZ_JBDYSJ010000004.1:260063-260128_length:66_mod0000 -M_T0_RID709_S1_NZ_JBDYRX010000003.1:29327-29484_length:158_mod0000 -M_T0_RID710_S1_NC_033720.1:7987-8089_length:103_mod0000 -M_T0_RID711_S0_NZ_JBDYLZ010000006.1:173182-173278_length:97_mod0000 -M_T0_RID711_S1_NC_033700.1:20537-20567_length:31_mod0000 -M_T0_RID711_S1_NZ_JBDYSJ010000001.1:181184-181271_length:88_mod0000 -M_T0_RID714_S0_NC_037612.1:3005-3122_length:118_mod0000 -M_T0_RID715_S0_NC_027788.1:468-551_length:84_mod0000 -M_T0_RID715_S1_NZ_JBDYLZ010000006.1:219162-219260_length:99_mod0000 -M_T0_RID717_S0_NC_030654.1:1669-1721_length:53_mod0000 -M_T0_RID719_S1_NZ_JBDYSJ010000001.1:826609-826678_length:70_mod0000 -M_T0_RID722_S1_NC_027923.1:41169-41259_length:91_mod0001 -M_T0_RID727_S0_NC_029997.2:28478-28523_length:46_mod0000 -M_T0_RID728_S0_NZ_JBDYRX010000002.1:879157-879230_length:74_mod0000 -M_T0_RID729_S1_NZ_JBDYLZ010000008.1:194207-194253_length:47_mod0000 -M_T0_RID731_S1_NC_030117.1:17286-17318_length:33_mod0000 -M_T0_RID736_S0_NZ_JBDYRX010000001.1:178466-178588_length:123_mod0000 -M_T0_RID737_S0_NC_028491.1:18226-18284_length:59_mod0000 -M_T0_RID739_S1_NZ_JBDYLZ010000011.1:127333-127376_length:44_mod0000 -M_T0_RID743_S0_NC_037573.1:1169-1247_length:79_mod0000 -M_T0_RID747_S1_NZ_JBDYRX010000002.1:430138-430204_length:67_mod0000 -M_T0_RID749_S1_NZ_JBDYRX010000003.1:71924-71986_length:63_mod0000 -M_T0_RID752_S0_NC_031336.1:9006-9046_length:41_mod0000 -M_T0_RID753_S0_NZ_JBDYSJ010000003.1:446526-446575_length:50_mod0000 -M_T0_RID757_S0_NC_028136.1:1312-1355_length:44_mod0000 -M_T0_RID757_S1_NC_027016.1:202899-202969_length:71_mod0000 -M_T0_RID757_S1_NZ_JBDYRX010000004.1:461576-461693_length:118_mod0000 -M_T0_RID759_S1_NC_029691.1:3622-3733_length:112_mod0000 -M_T0_RID763_S1_NC_027916.2:99012-99086_length:75_mod0000 -M_T0_RID763_S1_NC_028265.1:10302-10344_length:43_mod0000 -M_T0_RID763_S1_NC_030798.1:7132-7233_length:102_mod0000 -M_T0_RID763_S1_NZ_JBDYLZ010000015.1:37189-37249_length:61_mod0000 -M_T0_RID765_S0_NC_028261.1:4356-4443_length:88_mod0000 -M_T0_RID767_S1_NC_027916.2:86943-87045_length:103_mod0000 -M_T0_RID768_S0_NC_028491.1:2854-2933_length:80_mod0000 -M_T0_RID768_S0_NC_030200.1:40203-40312_length:110_mod0000 -M_T0_RID771_S0_NZ_JBDYLZ010000019.1:13804-13871_length:68_mod0000 -M_T0_RID778_S1_NC_031275.1:5153-5201_length:49_mod0000 -M_T0_RID781_S1_NZ_JBDYRX010000003.1:540287-540355_length:69_mod0000 -M_T0_RID783_S1_NZ_JBDYLZ010000010.1:89260-89349_length:90_mod0000 -M_T0_RID785_S1_NC_027199.1:11719-11818_length:100_mod0000 -M_T0_RID786_S1_NZ_JBDYLZ010000008.1:173777-173859_length:83_mod0000 -M_T0_RID788_S0_NC_030922.1:1394-1483_length:90_mod0000 -M_T0_RID793_S0_NZ_JBDYRX010000003.1:539904-539954_length:51_mod0001 -M_T0_RID797_S1_NZ_JBDYRX010000004.1:414620-414694_length:75_mod0000 -M_T0_RID807_S1_NC_030117.1:45331-45378_length:48_mod0000 -M_T0_RID810_S0_NC_028491.1:85062-85136_length:75_mod0001 -M_T0_RID811_S1_NC_030697.1:295-351_length:57_mod0000 -M_T0_RID813_S1_NC_027016.1:91244-91325_length:82_mod0000 -M_T0_RID817_S1_NC_030240.1:108663-108730_length:68_mod0001 -M_T0_RID823_S0_NC_033620.1:158427-158465_length:39_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000003.1:241332-241406_length:75_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000004.1:228843-228928_length:86_mod0000 -M_T0_RID827_S0_NZ_JBDYSJ010000004.1:239871-239973_length:103_mod0000 -M_T0_RID832_S0_NZ_JBDYLZ010000015.1:88774-88854_length:81_mod0000 -M_T0_RID833_S0_NZ_JBDYSJ010000001.1:590978-591039_length:62_mod0000 -M_T0_RID837_S1_NZ_JBDYRX010000001.1:656888-656964_length:77_mod0000 -M_T0_RID840_S0_NC_028396.1:529-621_length:93_mod0000 -M_T0_RID844_S1_NZ_JBDYLZ010000007.1:237741-237786_length:46_mod0000 -M_T0_RID847_S0_NZ_JBDYRX010000003.1:703429-703507_length:79_mod0000 -M_T0_RID852_S0_NC_030240.1:105292-105367_length:76_mod0000 -M_T0_RID856_S0_NZ_JBDYRX010000003.1:28070-28132_length:63_mod0000 -M_T0_RID856_S1_NC_027644.1:3712-3804_length:93_mod0000 -M_T0_RID858_S0_NZ_JBDYSJ010000003.1:197400-197485_length:86_mod0000 -M_T0_RID858_S1_NZ_JBDYSJ010000004.1:175908-175948_length:41_mod0000 -M_T0_RID859_S0_NC_033777.1:2010-2066_length:57_mod0000 -M_T0_RID862_S1_NC_030799.1:1806-1881_length:76_mod0000 -M_T0_RID865_S1_NZ_JBDYSJ010000002.1:326035-326087_length:53_mod0000 -M_T0_RID873_S1_NC_028119.1:2502-2583_length:82_mod0000 -M_T0_RID880_S0_NC_033620.1:55069-55148_length:80_mod0000 -M_T0_RID882_S0_NZ_JBDYRX010000002.1:484332-484416_length:85_mod0000 -M_T0_RID882_S1_NC_034266.1:103121-103153_length:33_mod0000 -M_T0_RID885_S0_NZ_JBDYRX010000003.1:244205-244252_length:48_mod0000 -M_T0_RID885_S1_NC_036636.1:5051-5143_length:93_mod0000 -M_T0_RID887_S0_NC_029132.1:58239-58309_length:71_mod0000 -M_T0_RID895_S1_NZ_JBDYRX010000004.1:290403-290535_length:133_mod0000 -M_T0_RID900_S0_NZ_JBDYRX010000003.1:442650-442708_length:59_mod0000 -M_T0_RID903_S0_NC_029994.1:1129-1161_length:33_mod0000 -M_T0_RID910_S1_NC_030801.1:531-591_length:61_mod0000 -M_T0_RID913_S1_NZ_JBDYSJ010000001.1:289314-289350_length:37_mod0000 -M_T0_RID923_S1_NC_028374.1:1835-1919_length:85_mod0000 -M_T0_RID930_S0_NC_033727.1:5848-5935_length:88_mod0000 -M_T0_RID941_S0_NZ_JBDYLZ010000020.1:17961-18008_length:48_mod0000 -M_T0_RID951_S0_NZ_JBDYLZ010000007.1:258088-258169_length:82_mod0000 -M_T0_RID960_S1_NZ_JBDYRX010000001.1:365497-365549_length:53_mod0000 -M_T0_RID963_S0_NZ_JBDYSJ010000002.1:471116-471242_length:127_mod0000 -M_T0_RID967_S0_NC_028145.1:2423-2491_length:69_mod0000 -M_T0_RID969_S1_NC_027917.1:3392-3477_length:86_mod0000 -M_T0_RID973_S1_NC_028243.1:233-298_length:66_mod0000 -M_T0_RID975_S0_NZ_JBDYLZ010000006.1:262785-262833_length:49_mod0000 -M_T0_RID977_S0_NC_029311.1:110890-110930_length:41_mod0000 -M_T0_RID978_S1_NC_033707.1:4471-4569_length:99_mod0000 -M_T0_RID978_S1_NZ_JBDYLZ010000011.1:12262-12308_length:47_mod0000 -M_T0_RID987_S1_NZ_JBDYRX010000002.1:268856-268924_length:69_mod0000 -M_T0_RID993_S0_NZ_JBDYSJ010000002.1:495946-496025_length:80_mod0000 -M_T0_RID997_S0_NC_029303.1:1692-1771_length:80_mod0000 -M_T0_RID1003_S0_NZ_JBDYSJ010000001.1:678727-678783_length:57_mod0000 -M_T0_RID1022_S1_NC_030746.1:3635-3726_length:92_mod0000 -M_T0_RID1023_S1_NZ_JBDYLZ010000006.1:264893-265013_length:121_mod0000 -M_T0_RID1048_S0_NZ_JBDYLZ010000008.1:126930-127042_length:113_mod0000 -M_T0_RID1070_S0_NZ_JBDYRX010000003.1:112054-112158_length:105_mod0000 -M_T0_RID250_S0_NC_028636.1:14337-14398_length:62_mod0000 diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/expected/results/reads/prefilter/extract/Lib_LVsim1_collapsed.fastq.gz b/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/expected/results/reads/prefilter/extract/Lib_LVsim1_collapsed.fastq.gz deleted file mode 100644 index 9de6d7e..0000000 Binary files a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/expected/results/reads/prefilter/extract/Lib_LVsim1_collapsed.fastq.gz and /dev/null differ diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/config.yaml b/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/config.yaml deleted file mode 100644 index ae3df34..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/config.yaml +++ /dev/null @@ -1,142 +0,0 @@ - -# - Only tested with Phred33 quality scores - -samples: config/samples.tsv - -units: config/units.tsv - - - -############# -### READS ### -############# -trim: - trim: - activate: true - tool: adapterremoval - params: "--trimns --maxns 10 --trimqualities --minlength 30 --mask-degenerate-bases --seed 12345" - - # Ignored for SE - collapse: - activate: true - params: "--collapse-conservatively" - -derep: - extension: - activate: false - k: 16 - params: "ibb=t prefilter=0 el=100 er=100 ecc=f ecco=f ignorebadquality extendrollback=0" - - derep: - activate: true - # vsearch or seqkit - tool: seqkit - params: "" - - low_complex: - params: "entropy=0.7 entropywindow=30 entropyk=4" - - - -############# -### ALIGN ### -############# -prefilter: - taxa: "Bacteria,Archaea,Viruses" - - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: - prok: - n_shards: 2 - path: "data/prok.{n_shard}-of-2.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal -N 1" - bt2l: False - acc2taxid: "data/prok.acc2taxid.gz" - virus: - n_shards: 1 - path: "data/virus.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/virus.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 25 --weight_type 1 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2" - - -euk: - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: - mitoch: - n_shards: 1 - path: "data/mitoch.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/mitoch.acc2taxid.gz" - plastid: - n_shards: 1 - path: "data/plastid.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/plastid.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 15 --sim_score_low 0.95 --weight_type 0 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2 --seed 12345" - - -############ -## REPORT ## -############ -report: - multiqc: "--no-ai --verbose --cl-config 'custom_logo: data/KU_long.png' --cl-config 'custom_logo_title: CAEG - Center for Ancient Environmental Genomics' --cl-config 'custom_logo_url: https://globe.ku.dk/research/caeg/'" - multiqc_db_url: "test_qc.sqlite" diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/samples.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/samples.tsv deleted file mode 100644 index 5994081..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/samples.tsv +++ /dev/null @@ -1,2 +0,0 @@ -sample alias group condition -Lib ancient diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/units.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/units.tsv deleted file mode 100644 index 4a8a376..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/units.tsv +++ /dev/null @@ -1,4 +0,0 @@ -sample library flowcell lane seq_type library_type material data machine run_n sample_n date center platform adapters -Lib LVsim1 BHXXXXXXXX L001 PE ds DNA data/test_L001_R{Read}.fq.gz SIMULATED 0000 S1 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Lib LVsim1 BHXXXXXXXX L002 PE ds DNA data/test_L002_R{Read}.fq.gz SIMULATED 0000 S2 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Lib LVsim2 BHXXXXXXXX L001 PE ds DNA data/test_L003_R{Read}.fq.gz SIMULATED 0000 S3 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/prefilter_shards/saturated_reads/filter/Lib_LVsim1_collapsed.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/prefilter_shards/saturated_reads/filter/Lib_LVsim1_collapsed.tsv deleted file mode 100644 index 7a48652..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/prefilter_shards/saturated_reads/filter/Lib_LVsim1_collapsed.tsv +++ /dev/null @@ -1 +0,0 @@ -M_T0_RID250_S0_NC_028636.1:14337-14398_length:62_mod0000 diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids b/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids deleted file mode 100644 index ef20c09..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids +++ /dev/null @@ -1,1299 +0,0 @@ -M_T0_RID0_S0_NC_030117.1:111953-112007_length:55_mod0000 -M_T0_RID0_S0_NZ_JBDYLZ010000006.1:232651-232713_length:63_mod0000 -M_T0_RID0_S0_NZ_JBDYRX010000003.1:638778-638845_length:68_mod0000 -M_T0_RID0_S0_NZ_JBDYSJ010000001.1:480453-480521_length:69_mod0000 -M_T0_RID0_S1_NC_029996.1:52049-52114_length:66_mod0000 -M_T0_RID0_S1_NC_029997.2:98154-98247_length:94_mod0001 -M_T0_RID0_S1_NC_033619.1:5054-5125_length:72_mod0000 -M_T0_RID1_S0_NZ_JBDYLZ010000006.1:89475-89546_length:72_mod0000 -M_T0_RID2_S0_NC_030240.1:124812-124864_length:53_mod0000 -M_T0_RID2_S0_NZ_JBDYLZ010000014.1:79367-79450_length:84_mod0000 -M_T0_RID2_S1_NC_029132.1:78897-78961_length:65_mod0000 -M_T0_RID3_S1_NC_029996.1:125237-125310_length:74_mod0000 -M_T0_RID3_S1_NC_030229.1:666-744_length:79_mod0000 -M_T0_RID4_S0_NZ_JBDYRX010000001.1:960749-960798_length:50_mod0000 -M_T0_RID4_S1_NZ_JBDYSJ010000003.1:80602-80671_length:70_mod0000 -M_T0_RID5_S0_NC_028371.1:3473-3533_length:61_mod0000 -M_T0_RID5_S0_NZ_JBDYLZ010000014.1:31093-31169_length:77_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000003.1:463476-463555_length:80_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000004.1:91279-91382_length:104_mod0000 -M_T0_RID5_S1_NC_031272.1:12737-12796_length:60_mod0000 -M_T0_RID5_S1_NZ_JBDYSJ010000001.1:152930-152976_length:47_mod0000 -M_T0_RID6_S0_NC_018093.1:1833-1947_length:115_mod0000 -M_T0_RID6_S1_NZ_JBDYSJ010000001.1:525478-525555_length:78_mod0000 -M_T0_RID7_S0_NC_027121.1:14835-14908_length:74_mod0000 -M_T0_RID7_S0_NC_030117.1:123232-123357_length:126_mod0000 -M_T0_RID7_S0_NC_033733.1:1775-1866_length:92_mod0000 -M_T0_RID7_S0_NC_033757.1:335-408_length:74_mod0000 -M_T0_RID7_S0_NC_033816.1:2121-2169_length:49_mod0000 -M_T0_RID7_S0_NZ_JBDYRX010000001.1:768041-768147_length:107_mod0000 -M_T0_RID7_S1_NZ_JBDYRX010000003.1:741729-741847_length:119_mod0000 -M_T0_RID8_S0_NC_028255.1:2339-2453_length:115_mod0000 -M_T0_RID8_S0_NC_028362.1:3644-3681_length:38_mod0000 -M_T0_RID8_S0_NC_030295.1:5058-5146_length:89_mod0000 -M_T0_RID8_S0_NZ_JBDYLZ010000011.1:65064-65142_length:79_mod0000 -M_T0_RID8_S1_NC_029996.1:15385-15439_length:55_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000001.1:372140-372170_length:31_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000002.1:184902-185028_length:127_mod0000 -M_T0_RID9_S0_NC_018175.1:751-814_length:64_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000001.1:128705-128756_length:52_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000003.1:717567-717638_length:72_mod0000 -M_T0_RID9_S1_NZ_JBDYRX010000001.1:708791-708875_length:85_mod0001 -M_T0_RID10_S1_NC_034266.1:180760-180821_length:62_mod0000 -M_T0_RID11_S0_NC_027126.1:6629-6712_length:84_mod0000 -M_T0_RID11_S0_NC_027426.1:3579-3717_length:139_mod0000 -M_T0_RID11_S1_NC_030117.1:3968-4065_length:98_mod0000 -M_T0_RID12_S0_NC_027016.1:206020-206105_length:86_mod0000 -M_T0_RID13_S0_NC_027915.1:11194-11270_length:77_mod0000 -M_T0_RID13_S1_NZ_JBDYLZ010000012.1:21748-21797_length:50_mod0000 -M_T0_RID13_S1_NZ_JBDYSJ010000002.1:219548-219618_length:71_mod0000 -M_T0_RID14_S0_NC_033816.1:7896-7995_length:100_mod0000 -M_T0_RID14_S0_NZ_JBDYRX010000001.1:272205-272307_length:103_mod0000 -M_T0_RID14_S0_NZ_JBDYSJ010000001.1:204692-204745_length:54_mod0000 -M_T0_RID14_S1_NC_031321.1:1201-1285_length:85_mod0000 -M_T0_RID14_S1_NC_034217.1:1799-1845_length:47_mod0000 -M_T0_RID15_S0_NZ_JBDYSJ010000001.1:485204-485240_length:37_mod0001 -M_T0_RID15_S1_NC_023442.1:20190-20253_length:64_mod0001 -M_T0_RID15_S1_NC_028259.1:6855-6912_length:58_mod0000 -M_T0_RID15_S1_NZ_JBDYLZ010000014.1:31347-31473_length:127_mod0000 -M_T0_RID16_S0_NC_033718.1:9155-9282_length:128_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000014.1:112132-112219_length:88_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000018.1:30565-30632_length:68_mod0001 -M_T0_RID17_S1_NC_030658.1:888-970_length:83_mod0001 -M_T0_RID17_S1_NC_030873.1:769-848_length:80_mod0000 -M_T0_RID17_S1_NZ_JBDYRX010000004.1:479027-479133_length:107_mod0000 -M_T0_RID17_S1_NZ_JBDYSJ010000002.1:142153-142239_length:87_mod0000 -M_T0_RID18_S0_NC_033830.1:429-498_length:70_mod0000 -M_T0_RID18_S1_NC_027429.1:4469-4544_length:76_mod0000 -M_T0_RID19_S0_NC_028491.1:2563-2618_length:56_mod0000 -M_T0_RID19_S0_NC_031227.1:5693-5751_length:59_mod0000 -M_T0_RID20_S1_NC_029562.1:5000-5036_length:37_mod0000 -M_T0_RID20_S1_NZ_JBDYSJ010000004.1:235888-235979_length:92_mod0000 -M_T0_RID21_S0_NC_028242.1:2691-2737_length:47_mod0000 -M_T0_RID21_S0_NC_029052.1:6412-6494_length:83_mod0000 -M_T0_RID21_S0_NZ_JBDYSJ010000002.1:218541-218623_length:83_mod0000 -M_T0_RID21_S1_NZ_JBDYLZ010000006.1:140228-140329_length:102_mod0000 -M_T0_RID21_S1_NZ_JBDYRX010000001.1:693665-693710_length:46_mod0000 -M_T0_RID22_S0_NC_030402.1:754-835_length:82_mod0000 -M_T0_RID22_S0_NC_034216.1:12941-13048_length:108_mod0000 -M_T0_RID22_S1_NZ_JBDYRX010000001.1:435105-435213_length:109_mod0000 -M_T0_RID23_S0_NC_030701.1:5103-5151_length:49_mod0000 -M_T0_RID23_S0_NC_033762.1:10-98_length:89_mod0000 -M_T0_RID23_S0_NC_037617.1:942-1060_length:119_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000002.1:499806-499888_length:83_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000004.1:201196-201277_length:82_mod0000 -M_T0_RID23_S1_NC_031275.1:7710-7771_length:62_mod0000 -M_T0_RID24_S0_NC_030240.1:57723-57766_length:44_mod0000 -M_T0_RID24_S0_NZ_JBDYLZ010000012.1:969-1002_length:34_mod0000 -M_T0_RID24_S0_NZ_JBDYRX010000001.1:197011-197061_length:51_mod0000 -M_T0_RID24_S1_NC_027121.1:8433-8469_length:37_mod0000 -M_T0_RID24_S1_NZ_JBDYRX010000001.1:668610-668664_length:55_mod0000 -M_T0_RID25_S0_NZ_JBDYSJ010000002.1:6311-6403_length:93_mod0000 -M_T0_RID25_S1_NC_029997.2:85189-85282_length:94_mod0000 -M_T0_RID25_S1_NC_034384.1:2318-2377_length:60_mod0000 -M_T0_RID25_S1_NZ_JBDYRX010000002.1:614807-614869_length:63_mod0000 -M_T0_RID25_S1_NZ_JBDYSJ010000004.1:88035-88153_length:119_mod0000 -M_T0_RID26_S0_NC_028491.1:86460-86530_length:71_mod0000 -M_T0_RID26_S0_NZ_JBDYSJ010000003.1:64065-64167_length:103_mod0000 -M_T0_RID26_S1_NZ_JBDYSJ010000002.1:180789-180849_length:61_mod0001 -M_T0_RID27_S0_NZ_JBDYRX010000002.1:879317-879417_length:101_mod0001 -M_T0_RID27_S0_NZ_JBDYSJ010000002.1:371147-371261_length:115_mod0000 -M_T0_RID27_S1_NC_024911.1:1404-1530_length:127_mod0000 -M_T0_RID27_S1_NC_034266.1:112117-112169_length:53_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000003.1:302019-302061_length:43_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000004.1:327071-327150_length:80_mod0001 -M_T0_RID28_S0_NC_027812.1:1778-1877_length:100_mod0000 -M_T0_RID28_S0_NC_028833.1:23931-24017_length:87_mod0000 -M_T0_RID28_S0_NC_034159.1:870-906_length:37_mod0000 -M_T0_RID28_S0_NZ_JBDYSJ010000003.1:260828-260864_length:37_mod0000 -M_T0_RID29_S0_NC_027137.1:5905-5940_length:36_mod0000 -M_T0_RID29_S0_NC_027208.1:2702-2783_length:82_mod0000 -M_T0_RID29_S0_NC_029996.1:60558-60653_length:96_mod0000 -M_T0_RID29_S0_NC_033722.1:167-248_length:82_mod0000 -M_T0_RID30_S0_NC_017977.1:8983-9015_length:33_mod0000 -M_T0_RID30_S0_NC_034219.1:4140-4199_length:60_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000001.1:753768-753819_length:52_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000002.1:441798-441831_length:34_mod0000 -M_T0_RID30_S0_NZ_JBDYSJ010000001.1:878513-878614_length:102_mod0000 -M_T0_RID30_S1_NC_028492.1:144-210_length:67_mod0000 -M_T0_RID30_S1_NZ_JBDYRX010000004.1:168829-168933_length:105_mod0000 -M_T0_RID30_S1_NZ_JBDYSJ010000002.1:584020-584104_length:85_mod0000 -M_T0_RID31_S0_NZ_JBDYSJ010000002.1:273852-273897_length:46_mod0000 -M_T0_RID31_S1_NC_031450.1:2281-2311_length:31_mod0000 -M_T0_RID31_S1_NZ_JBDYSJ010000002.1:454313-454400_length:88_mod0000 -M_T0_RID32_S0_NC_023442.1:31719-31785_length:67_mod0000 -M_T0_RID32_S1_NC_028133.1:1439-1562_length:124_mod0000 -M_T0_RID32_S1_NZ_JBDYSJ010000002.1:412312-412351_length:40_mod0000 -M_T0_RID33_S1_NC_034266.1:78437-78516_length:80_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000001.1:102672-102747_length:76_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000002.1:784464-784511_length:48_mod0000 -M_T0_RID33_S1_NZ_JBDYSJ010000003.1:324967-325032_length:66_mod0000 -M_T0_RID34_S0_NC_018457.1:737-780_length:44_mod0000 -M_T0_RID34_S0_NC_028253.1:2464-2519_length:56_mod0000 -M_T0_RID34_S0_NZ_JBDYRX010000003.1:19821-19946_length:126_mod0000 -M_T0_RID34_S1_NC_029255.1:103099-103196_length:98_mod0000 -M_T0_RID34_S1_NZ_JBDYRX010000001.1:214312-214398_length:87_mod0001 -M_T0_RID35_S0_NZ_JBDYRX010000001.1:286577-286647_length:71_mod0000 -M_T0_RID35_S0_NZ_JBDYRX010000002.1:303458-303514_length:57_mod0000 -M_T0_RID35_S1_NC_028374.1:16776-16870_length:95_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:363132-363178_length:47_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:829523-829581_length:59_mod0000 -M_T0_RID36_S0_NC_029311.1:99001-99097_length:97_mod0000 -M_T0_RID37_S0_NC_033620.1:94230-94306_length:77_mod0000 -M_T0_RID37_S0_NZ_JBDYLZ010000012.1:26095-26141_length:47_mod0000 -M_T0_RID37_S1_NC_029311.1:32048-32093_length:46_mod0000 -M_T0_RID37_S1_NZ_JBDYSJ010000001.1:902396-902441_length:46_mod0000 -M_T0_RID38_S0_NC_030691.1:6883-6932_length:50_mod0000 -M_T0_RID38_S1_NZ_JBDYRX010000004.1:200501-200575_length:75_mod0000 -M_T0_RID39_S1_NC_028136.1:1274-1340_length:67_mod0000 -M_T0_RID39_S1_NZ_JBDYSJ010000002.1:503066-503117_length:52_mod0000 -M_T0_RID40_S0_NC_030234.1:4344-4414_length:71_mod0000 -M_T0_RID41_S0_NC_031088.1:9201-9299_length:99_mod0000 -M_T0_RID41_S0_NZ_JBDYLZ010000009.1:31815-31852_length:38_mod0000 -M_T0_RID41_S1_NC_028244.1:5988-6042_length:55_mod0000 -M_T0_RID41_S1_NZ_JBDYLZ010000006.1:65238-65362_length:125_mod0000 -M_T0_RID41_S1_NZ_JBDYRX010000003.1:765215-765280_length:66_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:32817-32939_length:123_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:462782-462843_length:62_mod0000 -M_T0_RID43_S0_NZ_JBDYLZ010000008.1:49878-49973_length:96_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000001.1:889979-890062_length:84_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000004.1:406662-406696_length:35_mod0000 -M_T0_RID44_S1_NZ_JBDYLZ010000006.1:90744-90777_length:34_mod0000 -M_T0_RID45_S0_NC_027712.1:10734-10821_length:88_mod0000 -M_T0_RID45_S0_NC_029311.1:44548-44620_length:73_mod0000 -M_T0_RID45_S0_NC_030693.1:5273-5361_length:89_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000008.1:40421-40495_length:75_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000009.1:55082-55112_length:31_mod0000 -M_T0_RID45_S1_NC_028232.1:6596-6658_length:63_mod0000 -M_T0_RID46_S0_NZ_JBDYSJ010000003.1:168383-168513_length:131_mod0000 -M_T0_RID47_S0_NC_029932.1:1175-1250_length:76_mod0000 -M_T0_RID47_S1_NC_027633.1:3344-3412_length:69_mod0000 -M_T0_RID48_S0_NC_018174.1:5223-5261_length:39_mod0000 -M_T0_RID48_S0_NC_023443.1:462-562_length:101_mod0000 -M_T0_RID48_S0_NZ_JBDYRX010000002.1:697197-697270_length:74_mod0000 -M_T0_RID49_S0_NC_029309.1:6196-6271_length:76_mod0000 -M_T0_RID49_S0_NZ_JBDYRX010000002.1:627468-627514_length:47_mod0000 -M_T0_RID49_S1_NC_028375.1:6864-6975_length:112_mod0000 -M_T0_RID50_S0_NC_027634.1:1642-1737_length:96_mod0000 -M_T0_RID50_S0_NC_030117.1:58855-58929_length:75_mod0000 -M_T0_RID50_S0_NC_030397.1:2093-2139_length:47_mod0001 -M_T0_RID50_S0_NZ_JBDYRX010000002.1:579910-579949_length:40_mod0000 -M_T0_RID50_S1_NC_028099.1:106360-106431_length:72_mod0000 -M_T0_RID50_S1_NZ_JBDYLZ010000012.1:83521-83604_length:84_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:803598-803655_length:58_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:945690-945779_length:90_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000006.1:184353-184397_length:45_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000018.1:32304-32360_length:57_mod0000 -M_T0_RID51_S1_NZ_JBDYRX010000001.1:868994-869082_length:89_mod0000 -M_T0_RID51_S1_NZ_JBDYSJ010000003.1:168788-168850_length:63_mod0000 -M_T0_RID52_S0_NZ_JBDYRX010000002.1:889544-889674_length:131_mod0000 -M_T0_RID52_S1_NC_030801.1:2462-2542_length:81_mod0000 -M_T0_RID53_S0_NC_029053.1:3050-3132_length:83_mod0000 -M_T0_RID53_S0_NC_033792.1:955-1008_length:54_mod0000 -M_T0_RID53_S0_NZ_JBDYRX010000003.1:127692-127758_length:67_mod0000 -M_T0_RID53_S1_NC_027533.1:2013-2051_length:39_mod0000 -M_T0_RID53_S1_NC_031307.1:5253-5307_length:55_mod0000 -M_T0_RID54_S0_NC_031079.1:45-96_length:52_mod0000 -M_T0_RID54_S1_NC_027712.1:6686-6777_length:92_mod0000 -M_T0_RID54_S1_NC_029996.1:22662-22724_length:63_mod0000 -M_T0_RID55_S0_NC_030141.1:2102-2247_length:146_mod0000 -M_T0_RID55_S0_NC_031304.1:2692-2762_length:71_mod0000 -M_T0_RID55_S0_NC_033704.1:4049-4166_length:118_mod0000 -M_T0_RID55_S0_NZ_JBDYRX010000001.1:247013-247049_length:37_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:448811-448874_length:64_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:513869-513936_length:68_mod0000 -M_T0_RID56_S0_NC_027016.1:52570-52626_length:57_mod0000 -M_T0_RID56_S0_NC_031449.1:9465-9556_length:92_mod0000 -M_T0_RID56_S0_NZ_JBDYLZ010000007.1:245259-245319_length:61_mod0001 -M_T0_RID56_S1_NZ_JBDYLZ010000007.1:103507-103590_length:84_mod0000 -M_T0_RID57_S0_NC_018070.1:8325-8447_length:123_mod0000 -M_T0_RID57_S0_NC_027426.1:3804-3851_length:48_mod0000 -M_T0_RID57_S1_NC_028099.1:83564-83601_length:38_mod0000 -M_T0_RID58_S0_NC_027121.1:14888-14980_length:93_mod0000 -M_T0_RID58_S0_NC_029550.1:232-272_length:41_mod0000 -M_T0_RID58_S1_NZ_JBDYLZ010000015.1:60370-60453_length:84_mod0000 -M_T0_RID59_S0_NZ_JBDYLZ010000011.1:108912-108996_length:85_mod0000 -M_T0_RID59_S0_NZ_JBDYRX010000004.1:15220-15308_length:89_mod0000 -M_T0_RID60_S1_NC_027641.1:1140-1184_length:45_mod0000 -M_T0_RID60_S1_NC_029085.1:8080-8154_length:75_mod0001 -M_T0_RID60_S1_NZ_JBDYRX010000001.1:262196-262266_length:71_mod0000 -M_T0_RID60_S1_NZ_JBDYSJ010000002.1:87924-88000_length:77_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:191465-191498_length:34_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:569149-569214_length:66_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000003.1:457685-457761_length:77_mod0000 -M_T0_RID62_S0_NC_023303.1:251-301_length:51_mod0000 -M_T0_RID62_S0_NZ_JBDYRX010000001.1:304278-304333_length:56_mod0000 -M_T0_RID62_S1_NC_023427.1:835-900_length:66_mod0000 -M_T0_RID62_S1_NC_027016.1:54356-54406_length:51_mod0000 -M_T0_RID62_S1_NC_028133.1:2961-2996_length:36_mod0000 -M_T0_RID62_S1_NC_031083.1:3710-3834_length:125_mod0000 -M_T0_RID62_S1_NC_031463.1:8948-8994_length:47_mod0000 -M_T0_RID62_S1_NZ_JBDYRX010000003.1:182597-182668_length:72_mod0001 -M_T0_RID62_S1_NZ_JBDYSJ010000001.1:192588-192667_length:80_mod0001 -M_T0_RID63_S0_NC_028144.1:6011-6113_length:103_mod0000 -M_T0_RID63_S0_NC_030240.1:102727-102785_length:59_mod0000 -M_T0_RID63_S0_NC_033760.1:1443-1573_length:131_mod0000 -M_T0_RID63_S0_NZ_JBDYLZ010000020.1:7118-7208_length:91_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000002.1:745773-745875_length:103_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000003.1:142067-142124_length:58_mod0000 -M_T0_RID63_S0_NZ_JBDYSJ010000003.1:151524-151569_length:46_mod0000 -M_T0_RID63_S1_NC_031236.1:11052-11140_length:89_mod0001 -M_T0_RID64_S0_NC_030748.1:1054-1124_length:71_mod0000 -M_T0_RID64_S1_NC_031093.1:6116-6176_length:61_mod0000 -M_T0_RID66_S0_NZ_JBDYLZ010000015.1:96499-96580_length:82_mod0000 -M_T0_RID66_S0_NZ_JBDYSJ010000002.1:346193-346225_length:33_mod0000 -M_T0_RID66_S1_NC_031305.1:4622-4714_length:93_mod0000 -M_T0_RID66_S1_NZ_JBDYRX010000002.1:340389-340472_length:84_mod0000 -M_T0_RID67_S0_NC_028134.1:42-92_length:51_mod0000 -M_T0_RID67_S0_NC_030447.1:1980-2070_length:91_mod0000 -M_T0_RID67_S0_NZ_JBDYRX010000004.1:332043-332120_length:78_mod0000 -M_T0_RID67_S0_NZ_JBDYSJ010000003.1:241049-241147_length:99_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000001.1:247375-247406_length:32_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000002.1:355091-355166_length:76_mod0000 -M_T0_RID68_S1_NC_034266.1:8834-8941_length:108_mod0000 -M_T0_RID68_S1_NZ_JBDYLZ010000016.1:69565-69646_length:82_mod0000 -M_T0_RID69_S0_NC_028368.1:19515-19575_length:61_mod0000 -M_T0_RID69_S0_NC_034266.1:30444-30515_length:72_mod0000 -M_T0_RID69_S0_NZ_JBDYLZ010000013.1:100003-100090_length:88_mod0000 -M_T0_RID69_S1_NZ_JBDYLZ010000016.1:63861-63942_length:82_mod0000 -M_T0_RID70_S0_NC_018404.1:2315-2374_length:60_mod0000 -M_T0_RID70_S1_NC_027713.1:293-401_length:109_mod0000 -M_T0_RID70_S1_NC_033830.1:3068-3146_length:79_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000007.1:118774-118860_length:87_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000016.1:66813-66865_length:53_mod0000 -M_T0_RID71_S0_NC_033620.1:14671-14724_length:54_mod0000 -M_T0_RID71_S1_NC_029562.1:2435-2497_length:63_mod0000 -M_T0_RID72_S0_NC_033716.1:7859-7951_length:93_mod0000 -M_T0_RID72_S1_NC_030117.1:83819-83856_length:38_mod0000 -M_T0_RID72_S1_NZ_JBDYLZ010000008.1:123604-123689_length:86_mod0000 -M_T0_RID73_S0_NC_030115.1:6022-6140_length:119_mod0000 -M_T0_RID73_S0_NC_030229.1:2674-2768_length:95_mod0000 -M_T0_RID73_S0_NC_033733.1:4354-4441_length:88_mod0001 -M_T0_RID74_S0_NC_031093.1:8592-8666_length:75_mod0000 -M_T0_RID74_S0_NZ_JBDYSJ010000002.1:362489-362559_length:71_mod0000 -M_T0_RID74_S1_NC_029302.1:212-295_length:84_mod0000 -M_T0_RID75_S0_NZ_JBDYRX010000001.1:235615-235682_length:68_mod0000 -M_T0_RID75_S1_NC_030235.1:6658-6691_length:34_mod0000 -M_T0_RID75_S1_NZ_JBDYLZ010000022.1:8709-8767_length:59_mod0000 -M_T0_RID75_S1_NZ_JBDYRX010000003.1:478660-478720_length:61_mod0000 -M_T0_RID76_S0_NC_018070.1:8778-8882_length:105_mod0000 -M_T0_RID76_S0_NC_029255.1:61305-61383_length:79_mod0000 -M_T0_RID76_S1_NC_027428.1:2290-2358_length:69_mod0000 -M_T0_RID76_S1_NC_030200.1:88040-88083_length:44_mod0000 -M_T0_RID76_S1_NC_033720.1:158-194_length:37_mod0000 -M_T0_RID77_S1_NC_033730.1:7657-7785_length:129_mod0000 -M_T0_RID78_S0_NC_023442.1:36825-36879_length:55_mod0000 -M_T0_RID78_S0_NC_027016.1:111926-112014_length:89_mod0000 -M_T0_RID78_S0_NZ_JBDYRX010000003.1:310444-310522_length:79_mod0000 -M_T0_RID78_S1_NC_030871.1:4415-4481_length:67_mod0000 -M_T0_RID78_S1_NC_031220.1:5976-6009_length:34_mod0000 -M_T0_RID79_S0_NC_029997.2:83992-84041_length:50_mod0000 -M_T0_RID79_S0_NC_030240.1:97988-98049_length:62_mod0000 -M_T0_RID79_S1_NC_033792.1:2479-2556_length:78_mod0000 -M_T0_RID79_S1_NZ_JBDYRX010000003.1:341785-341851_length:67_mod0001 -M_T0_RID80_S1_NZ_JBDYLZ010000010.1:13735-13769_length:35_mod0000 -M_T0_RID80_S1_NZ_JBDYSJ010000001.1:511944-512037_length:94_mod0000 -M_T0_RID81_S1_NC_027923.1:15413-15450_length:38_mod0000 -M_T0_RID82_S0_NC_027916.2:67438-67522_length:85_mod0001 -M_T0_RID82_S0_NC_028398.1:2368-2442_length:75_mod0000 -M_T0_RID82_S0_NC_033779.1:2219-2288_length:70_mod0000 -M_T0_RID82_S0_NZ_JBDYLZ010000016.1:9019-9115_length:97_mod0000 -M_T0_RID82_S0_NZ_JBDYRX010000001.1:261558-261662_length:105_mod0001 -M_T0_RID82_S1_NC_027016.1:72621-72680_length:60_mod0000 -M_T0_RID82_S1_NC_027535.1:2160-2253_length:94_mod0000 -M_T0_RID83_S1_NC_030159.1:273-312_length:40_mod0000 -M_T0_RID83_S1_NZ_JBDYLZ010000007.1:155539-155585_length:47_mod0000 -M_T0_RID83_S1_NZ_JBDYRX010000002.1:263346-263422_length:77_mod0000 -M_T0_RID84_S0_NZ_JBDYRX010000003.1:240685-240765_length:81_mod0000 -M_T0_RID84_S1_NZ_JBDYRX010000003.1:51637-51745_length:109_mod0000 -M_T0_RID85_S0_NZ_JBDYRX010000002.1:107354-107402_length:49_mod0000 -M_T0_RID85_S1_NC_023297.1:177-263_length:87_mod0000 -M_T0_RID85_S1_NC_030201.1:3764-3811_length:48_mod0000 -M_T0_RID85_S1_NZ_JBDYRX010000002.1:35225-35277_length:53_mod0000 -M_T0_RID86_S1_NC_028137.1:1830-1905_length:76_mod0000 -M_T0_RID86_S1_NC_033828.1:2664-2773_length:110_mod0000 -M_T0_RID86_S1_NZ_JBDYSJ010000001.1:383616-383681_length:66_mod0000 -M_T0_RID87_S0_NC_027631.1:5088-5147_length:60_mod0000 -M_T0_RID87_S0_NZ_JBDYLZ010000008.1:117199-117277_length:79_mod0000 -M_T0_RID87_S1_NZ_JBDYRX010000002.1:176453-176540_length:88_mod0000 -M_T0_RID89_S0_NC_028814.1:25832-25905_length:74_mod0000 -M_T0_RID89_S0_NZ_JBDYLZ010000010.1:109306-109408_length:103_mod0000 -M_T0_RID89_S1_NC_029064.1:9889-9971_length:83_mod0000 -M_T0_RID91_S0_NC_029997.2:19677-19742_length:66_mod0000 -M_T0_RID91_S0_NZ_JBDYSJ010000002.1:541980-542048_length:69_mod0001 -M_T0_RID91_S1_NC_028636.1:131522-131574_length:53_mod0000 -M_T0_RID91_S1_NZ_JBDYLZ010000015.1:73113-73211_length:99_mod0000 -M_T0_RID91_S1_NZ_JBDYRX010000002.1:531098-531224_length:127_mod0000 -M_T0_RID91_S1_NZ_JBDYSJ010000001.1:75425-75512_length:88_mod0000 -M_T0_RID92_S0_NC_033847.1:907-971_length:65_mod0001 -M_T0_RID92_S0_NZ_JBDYRX010000001.1:204153-204204_length:52_mod0000 -M_T0_RID93_S0_NC_029131.1:6029-6095_length:67_mod0000 -M_T0_RID93_S1_NZ_JBDYRX010000002.1:30248-30359_length:112_mod0000 -M_T0_RID94_S0_NC_028142.1:627-700_length:74_mod0000 -M_T0_RID94_S0_NC_033702.1:1317-1400_length:84_mod0000 -M_T0_RID94_S0_NC_033717.1:1284-1386_length:103_mod0000 -M_T0_RID95_S0_NC_018072.1:2591-2635_length:45_mod0000 -M_T0_RID95_S0_NC_027136.1:2231-2280_length:50_mod0000 -M_T0_RID95_S0_NC_029996.1:90789-90865_length:77_mod0000 -M_T0_RID95_S0_NZ_JBDYRX010000002.1:319590-319635_length:46_mod0000 -M_T0_RID95_S1_NC_033620.1:5347-5437_length:91_mod0000 -M_T0_RID96_S0_NC_028636.1:10556-10617_length:62_mod0000 -M_T0_RID96_S1_NC_028143.1:314-390_length:77_mod0000 -M_T0_RID97_S1_NZ_JBDYRX010000001.1:866338-866401_length:64_mod0001 -M_T0_RID97_S1_NZ_JBDYRX010000003.1:178272-178304_length:33_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000013.1:5680-5725_length:46_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000028.1:866-932_length:67_mod0000 -M_T0_RID98_S1_NC_029996.1:10631-10716_length:86_mod0000 -M_T0_RID99_S0_NC_030838.1:2068-2122_length:55_mod0000 -M_T0_RID99_S0_NC_031248.1:3321-3367_length:47_mod0000 -M_T0_RID99_S1_NC_027916.2:30126-30210_length:85_mod0000 -M_T0_RID99_S1_NC_030240.1:40035-40122_length:88_mod0000 -M_T0_RID99_S1_NC_031336.1:14128-14251_length:124_mod0001 -M_T0_RID99_S1_NZ_JBDYSJ010000001.1:396202-396267_length:66_mod0000 -M_T0_RID100_S0_NC_028376.1:14572-14682_length:111_mod0000 -M_T0_RID100_S0_NC_030697.1:970-1055_length:86_mod0000 -M_T0_RID100_S0_NZ_JBDYRX010000002.1:758402-758505_length:104_mod0000 -M_T0_RID101_S0_NZ_JBDYSJ010000001.1:645109-645147_length:39_mod0000 -M_T0_RID102_S0_NC_029255.1:63250-63323_length:74_mod0000 -M_T0_RID102_S0_NZ_JBDYSJ010000001.1:237444-237513_length:70_mod0000 -M_T0_RID103_S0_NC_028476.1:713-824_length:112_mod0000 -M_T0_RID103_S1_NC_031314.1:1276-1385_length:110_mod0000 -M_T0_RID103_S1_NC_031463.1:18479-18581_length:103_mod0000 -M_T0_RID103_S1_NZ_JBDYRX010000003.1:535271-535363_length:93_mod0000 -M_T0_RID105_S0_NC_030118.1:8503-8572_length:70_mod0000 -M_T0_RID105_S1_NC_027712.1:9939-9971_length:33_mod0000 -M_T0_RID105_S1_NC_030472.1:4177-4227_length:51_mod0000 -M_T0_RID106_S1_NC_028382.1:483-531_length:49_mod0000 -M_T0_RID106_S1_NZ_JBDYLZ010000017.1:12627-12692_length:66_mod0000 -M_T0_RID106_S1_NZ_JBDYRX010000001.1:885175-885267_length:93_mod0000 -M_T0_RID106_S1_NZ_JBDYSJ010000001.1:754603-754673_length:71_mod0000 -M_T0_RID107_S0_NZ_JBDYRX010000002.1:887203-887264_length:62_mod0000 -M_T0_RID107_S1_NC_027016.1:87956-88044_length:89_mod0000 -M_T0_RID107_S1_NC_028478.1:299-392_length:94_mod0000 -M_T0_RID107_S1_NZ_JBDYRX010000003.1:166903-166964_length:62_mod0001 -M_T0_RID107_S1_NZ_JBDYSJ010000001.1:252763-252845_length:83_mod0000 -M_T0_RID108_S1_NC_033767.1:689-744_length:56_mod0000 -M_T0_RID108_S1_NZ_JBDYSJ010000003.1:468268-468339_length:72_mod0000 -M_T0_RID109_S0_NZ_JBDYRX010000001.1:988451-988536_length:86_mod0000 -M_T0_RID110_S1_NC_028099.1:36637-36726_length:90_mod0000 -M_T0_RID110_S1_NZ_JBDYLZ010000015.1:71842-71908_length:67_mod0000 -M_T0_RID111_S0_NC_030232.1:3068-3100_length:33_mod0000 -M_T0_RID111_S0_NZ_JBDYRX010000002.1:284375-284457_length:83_mod0000 -M_T0_RID111_S1_NC_028491.1:22651-22727_length:77_mod0000 -M_T0_RID112_S1_NZ_JBDYRX010000004.1:227206-227261_length:56_mod0000 -M_T0_RID112_S1_NZ_JBDYSJ010000003.1:186720-186750_length:31_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000008.1:103905-103950_length:46_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000017.1:43421-43530_length:110_mod0000 -M_T0_RID114_S0_NZ_JBDYSJ010000001.1:888974-889061_length:88_mod0000 -M_T0_RID114_S1_NC_028485.1:4265-4351_length:87_mod0000 -M_T0_RID114_S1_NC_030654.1:5564-5612_length:49_mod0000 -M_T0_RID114_S1_NC_033763.1:670-745_length:76_mod0000 -M_T0_RID114_S1_NZ_JBDYSJ010000001.1:20373-20432_length:60_mod0000 -M_T0_RID115_S0_NC_033781.1:4795-4906_length:112_mod0000 -M_T0_RID115_S1_NC_031236.1:618-674_length:57_mod0000 -M_T0_RID116_S0_NC_028833.1:24900-24930_length:31_mod0000 -M_T0_RID116_S0_NZ_JBDYSJ010000001.1:278209-278280_length:72_mod0000 -M_T0_RID117_S0_NC_028491.1:76819-76945_length:127_mod0000 -M_T0_RID117_S0_NC_028636.1:51360-51406_length:47_mod0000 -M_T0_RID117_S0_NZ_JBDYRX010000002.1:695385-695511_length:127_mod0000 -M_T0_RID117_S0_NZ_JBDYSJ010000004.1:214232-214301_length:70_mod0000 -M_T0_RID117_S1_NZ_JBDYSJ010000001.1:254125-254189_length:65_mod0000 -M_T0_RID118_S1_NC_017967.1:3728-3792_length:65_mod0000 -M_T0_RID118_S1_NZ_JBDYLZ010000012.1:104385-104434_length:50_mod0000 -M_T0_RID118_S1_NZ_JBDYRX010000003.1:569089-569158_length:70_mod0000 -M_T0_RID119_S0_NC_027138.1:1980-2027_length:48_mod0000 -M_T0_RID119_S0_NZ_JBDYRX010000001.1:479636-479698_length:63_mod0000 -M_T0_RID119_S1_NC_030750.1:2333-2363_length:31_mod0000 -M_T0_RID120_S0_NZ_JBDYRX010000004.1:143311-143407_length:97_mod0000 -M_T0_RID120_S0_NZ_JBDYSJ010000002.1:211897-211962_length:66_mod0000 -M_T0_RID120_S1_NC_029255.1:99346-99425_length:80_mod0000 -M_T0_RID120_S1_NZ_JBDYLZ010000008.1:182987-183039_length:53_mod0000 -M_T0_RID121_S1_NZ_JBDYRX010000003.1:22645-22773_length:129_mod0000 -M_T0_RID122_S0_NZ_JBDYSJ010000002.1:28060-28162_length:103_mod0000 -M_T0_RID122_S1_NZ_JBDYRX010000002.1:593335-593394_length:60_mod0000 -M_T0_RID123_S1_NC_029932.1:780-841_length:62_mod0000 -M_T0_RID123_S1_NZ_JBDYRX010000002.1:624572-624628_length:57_mod0000 -M_T0_RID123_S1_NZ_JBDYSJ010000003.1:205052-205133_length:82_mod0000 -M_T0_RID124_S0_NC_018105.1:1032-1078_length:47_mod0000 -M_T0_RID124_S0_NC_027016.1:37306-37377_length:72_mod0000 -M_T0_RID124_S0_NC_027430.1:2075-2124_length:50_mod0000 -M_T0_RID124_S0_NC_033751.1:1175-1283_length:109_mod0000 -M_T0_RID124_S0_NZ_JBDYLZ010000012.1:107683-107735_length:53_mod0000 -M_T0_RID124_S1_NC_029783.1:12839-12935_length:97_mod0000 -M_T0_RID125_S1_NC_024911.1:585-717_length:133_mod0000 -M_T0_RID125_S1_NZ_JBDYRX010000002.1:524061-524121_length:61_mod0000 -M_T0_RID126_S0_NZ_JBDYSJ010000003.1:204369-204435_length:67_mod0000 -M_T0_RID126_S1_NC_027136.1:6692-6786_length:95_mod0000 -M_T0_RID126_S1_NZ_JBDYLZ010000007.1:147969-148026_length:58_mod0000 -M_T0_RID126_S1_NZ_JBDYSJ010000001.1:849768-849826_length:59_mod0000 -M_T0_RID127_S0_NZ_JBDYLZ010000019.1:20624-20673_length:50_mod0000 -M_T0_RID127_S1_NC_033619.1:4029-4155_length:127_mod0000 -M_T0_RID127_S1_NZ_JBDYRX010000004.1:112527-112563_length:37_mod0000 -M_T0_RID128_S0_NC_033620.1:26172-26261_length:90_mod0000 -M_T0_RID128_S0_NZ_JBDYSJ010000001.1:127550-127596_length:47_mod0000 -M_T0_RID128_S1_NZ_JBDYLZ010000010.1:81225-81326_length:102_mod0000 -M_T0_RID129_S0_NC_028372.1:12347-12414_length:68_mod0001 -M_T0_RID129_S0_NC_030844.1:4967-5083_length:117_mod0001 -M_T0_RID129_S1_NZ_JBDYSJ010000001.1:451837-451880_length:44_mod0000 -M_T0_RID130_S0_NZ_JBDYSJ010000001.1:904477-904569_length:93_mod0000 -M_T0_RID130_S1_NC_030400.1:8920-8964_length:45_mod0000 -M_T0_RID131_S0_NC_030200.1:24540-24653_length:114_mod0000 -M_T0_RID131_S0_NZ_JBDYRX010000004.1:307376-307435_length:60_mod0001 -M_T0_RID131_S1_NZ_JBDYRX010000002.1:215925-215981_length:57_mod0000 -M_T0_RID132_S0_NC_029132.1:26524-26609_length:86_mod0000 -M_T0_RID132_S0_NZ_JBDYRX010000002.1:856095-856160_length:66_mod0000 -M_T0_RID132_S1_NC_028099.1:70003-70100_length:98_mod0000 -M_T0_RID132_S1_NC_028636.1:77454-77493_length:40_mod0000 -M_T0_RID133_S0_NC_027210.1:8798-8910_length:113_mod0000 -M_T0_RID133_S1_NZ_JBDYLZ010000014.1:82781-82835_length:55_mod0000 -M_T0_RID134_S0_NC_034266.1:203255-203287_length:33_mod0000 -M_T0_RID134_S1_NC_033705.1:7105-7262_length:158_mod0000 -M_T0_RID135_S0_NC_033733.1:6746-6806_length:61_mod0000 -M_T0_RID135_S1_NZ_JBDYSJ010000004.1:255279-255341_length:63_mod0000 -M_T0_RID136_S0_NZ_JBDYSJ010000001.1:562721-562768_length:48_mod0000 -M_T0_RID136_S1_NC_030200.1:80911-80976_length:66_mod0001 -M_T0_RID136_S1_NZ_JBDYLZ010000009.1:44314-44384_length:71_mod0000 -M_T0_RID136_S1_NZ_JBDYLZ010000018.1:9886-9961_length:76_mod0000 -M_T0_RID136_S1_NZ_JBDYRX010000001.1:825042-825123_length:82_mod0000 -M_T0_RID137_S0_NC_031083.1:11357-11420_length:64_mod0000 -M_T0_RID137_S0_NZ_JBDYSJ010000002.1:311215-311270_length:56_mod0000 -M_T0_RID137_S1_NC_034266.1:15288-15392_length:105_mod0000 -M_T0_RID137_S1_NZ_JBDYSJ010000002.1:109720-109762_length:43_mod0000 -M_T0_RID138_S0_NC_033730.1:4735-4793_length:59_mod0000 -M_T0_RID139_S0_NC_029076.1:5391-5472_length:82_mod0000 -M_T0_RID139_S0_NC_029131.1:3428-3518_length:91_mod0000 -M_T0_RID139_S1_NC_027128.1:7467-7524_length:58_mod0000 -M_T0_RID139_S1_NC_033730.1:8262-8350_length:89_mod0000 -M_T0_RID140_S0_NC_031216.1:8965-9047_length:83_mod0000 -M_T0_RID140_S1_NC_029996.1:128484-128577_length:94_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000007.1:238838-238873_length:36_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000015.1:16859-16896_length:38_mod0000 -M_T0_RID142_S0_NC_027916.2:139729-139809_length:81_mod0001 -M_T0_RID142_S0_NC_030873.1:562-633_length:72_mod0000 -M_T0_RID142_S0_NZ_JBDYSJ010000003.1:9947-10048_length:102_mod0001 -M_T0_RID144_S0_NC_030200.1:1026-1085_length:60_mod0001 -M_T0_RID144_S0_NZ_JBDYRX010000002.1:297802-297909_length:108_mod0000 -M_T0_RID145_S0_NZ_JBDYSJ010000001.1:690815-690908_length:94_mod0000 -M_T0_RID146_S0_NC_028636.1:8587-8640_length:54_mod0000 -M_T0_RID147_S0_NC_030839.1:401-442_length:42_mod0000 -M_T0_RID147_S1_NZ_JBDYRX010000002.1:330619-330694_length:76_mod0000 -M_T0_RID148_S1_NZ_JBDYRX010000002.1:14264-14309_length:46_mod0000 -M_T0_RID149_S0_NZ_JBDYSJ010000001.1:617340-617447_length:108_mod0000 -M_T0_RID149_S1_NC_028249.1:10239-10323_length:85_mod0000 -M_T0_RID149_S1_NZ_JBDYLZ010000008.1:120921-120959_length:39_mod0000 -M_T0_RID150_S1_NZ_JBDYRX010000004.1:384747-384794_length:48_mod0000 -M_T0_RID152_S1_NZ_JBDYRX010000004.1:353714-353802_length:89_mod0000 -M_T0_RID153_S0_NZ_JBDYRX010000003.1:52603-52715_length:113_mod0000 -M_T0_RID153_S1_NC_028364.1:137-249_length:113_mod0000 -M_T0_RID154_S0_NZ_JBDYRX010000003.1:602237-602274_length:38_mod0000 -M_T0_RID154_S1_NC_028386.1:1116-1181_length:66_mod0000 -M_T0_RID154_S1_NC_033620.1:12644-12716_length:73_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000002.1:675599-675679_length:81_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000003.1:514528-514581_length:54_mod0000 -M_T0_RID155_S0_NC_033701.1:9275-9317_length:43_mod0000 -M_T0_RID156_S1_NC_023295.1:2064-2141_length:78_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000006.1:281471-281567_length:97_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000011.1:132268-132312_length:45_mod0000 -M_T0_RID158_S1_NC_028241.1:531-607_length:77_mod0000 -M_T0_RID159_S0_NC_029311.1:69011-69045_length:35_mod0000 -M_T0_RID159_S0_NC_031216.1:6290-6405_length:116_mod0000 -M_T0_RID159_S0_NC_033620.1:32537-32621_length:85_mod0000 -M_T0_RID159_S0_NZ_JBDYSJ010000002.1:600959-600995_length:37_mod0000 -M_T0_RID161_S1_NC_030240.1:83741-83790_length:50_mod0000 -M_T0_RID162_S0_NZ_JBDYLZ010000008.1:5183-5216_length:34_mod0000 -M_T0_RID162_S1_NC_017862.1:7381-7452_length:72_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:584559-584609_length:51_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:726659-726738_length:80_mod0000 -M_T0_RID163_S0_NC_033620.1:156883-156969_length:87_mod0000 -M_T0_RID163_S1_NC_030275.1:100083-100169_length:87_mod0000 -M_T0_RID164_S0_NZ_JBDYLZ010000018.1:17968-18030_length:63_mod0000 -M_T0_RID164_S1_NC_033620.1:130668-130713_length:46_mod0000 -M_T0_RID164_S1_NZ_JBDYRX010000004.1:519479-519563_length:85_mod0000 -M_T0_RID165_S0_NC_027917.1:1959-2051_length:93_mod0000 -M_T0_RID166_S0_NZ_JBDYRX010000004.1:59696-59805_length:110_mod0000 -M_T0_RID167_S0_NZ_JBDYLZ010000007.1:38370-38443_length:74_mod0000 -M_T0_RID168_S0_NC_030225.1:5381-5465_length:85_mod0001 -M_T0_RID168_S0_NC_030236.1:5080-5154_length:75_mod0000 -M_T0_RID169_S0_NC_028263.1:913-994_length:82_mod0000 -M_T0_RID169_S0_NZ_JBDYLZ010000007.1:16953-17017_length:65_mod0000 -M_T0_RID169_S1_NC_017970.1:7200-7322_length:123_mod0000 -M_T0_RID169_S1_NC_027016.1:84360-84421_length:62_mod0000 -M_T0_RID169_S1_NC_031295.1:1211-1283_length:73_mod0001 -M_T0_RID170_S1_NZ_JBDYRX010000001.1:71554-71642_length:89_mod0000 -M_T0_RID171_S0_NC_023429.1:1938-1983_length:46_mod0000 -M_T0_RID171_S0_NZ_JBDYRX010000001.1:944221-944313_length:93_mod0001 -M_T0_RID171_S1_NC_028891.1:8612-8645_length:34_mod0000 -M_T0_RID172_S0_NC_031455.1:2261-2316_length:56_mod0000 -M_T0_RID172_S1_NC_028383.1:1536-1621_length:86_mod0000 -M_T0_RID172_S1_NC_031293.1:5209-5302_length:94_mod0000 -M_T0_RID172_S1_NZ_JBDYSJ010000002.1:22259-22312_length:54_mod0000 -M_T0_RID173_S0_NC_033710.1:8523-8561_length:39_mod0000 -M_T0_RID173_S0_NZ_JBDYRX010000004.1:391209-391337_length:129_mod0000 -M_T0_RID173_S1_NZ_JBDYLZ010000022.1:5769-5818_length:50_mod0000 -M_T0_RID173_S1_NZ_JBDYSJ010000001.1:629973-630049_length:77_mod0000 -M_T0_RID174_S1_NC_030158.1:2752-2787_length:36_mod0000 -M_T0_RID174_S1_NC_031339.1:433-463_length:31_mod0000 -M_T0_RID174_S1_NZ_JBDYLZ010000006.1:10668-10748_length:81_mod0000 -M_T0_RID175_S0_NZ_JBDYLZ010000018.1:25042-25131_length:90_mod0000 -M_T0_RID175_S1_NZ_JBDYSJ010000001.1:899529-899569_length:41_mod0000 -M_T0_RID176_S0_NC_030200.1:58204-58287_length:84_mod0000 -M_T0_RID176_S0_NZ_JBDYRX010000002.1:668726-668775_length:50_mod0000 -M_T0_RID176_S1_NZ_JBDYSJ010000003.1:471518-471566_length:49_mod0001 -M_T0_RID177_S1_NZ_JBDYRX010000002.1:466682-466753_length:72_mod0000 -M_T0_RID178_S0_NC_028099.1:31084-31207_length:124_mod0000 -M_T0_RID178_S0_NC_033620.1:149729-149799_length:71_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000001.1:853106-853172_length:67_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000002.1:203092-203185_length:94_mod0000 -M_T0_RID179_S0_NC_023442.1:39001-39088_length:88_mod0000 -M_T0_RID179_S0_NZ_JBDYRX010000004.1:52140-52225_length:86_mod0000 -M_T0_RID179_S0_NZ_JBDYSJ010000001.1:721050-721084_length:35_mod0001 -M_T0_RID180_S0_NZ_JBDYSJ010000002.1:534591-534638_length:48_mod0000 -M_T0_RID180_S1_NC_029801.1:1212-1290_length:79_mod0000 -M_T0_RID181_S0_NC_023420.2:1575-1682_length:108_mod0000 -M_T0_RID181_S0_NZ_JBDYSJ010000001.1:400625-400659_length:35_mod0000 -M_T0_RID181_S1_NZ_JBDYLZ010000022.1:10488-10567_length:80_mod0000 -M_T0_RID182_S1_NC_030115.1:4690-4735_length:46_mod0000 -M_T0_RID183_S0_NC_029996.1:43664-43722_length:59_mod0000 -M_T0_RID185_S1_NZ_JBDYRX010000003.1:308336-308406_length:71_mod0001 -M_T0_RID185_S1_NZ_JBDYRX010000004.1:191608-191699_length:92_mod0000 -M_T0_RID187_S0_NC_029132.1:3505-3621_length:117_mod0000 -M_T0_RID187_S1_NC_028833.1:12138-12185_length:48_mod0001 -M_T0_RID187_S1_NZ_JBDYLZ010000007.1:48250-48349_length:100_mod0000 -M_T0_RID187_S1_NZ_JBDYRX010000001.1:251442-251541_length:100_mod0000 -M_T0_RID188_S0_NC_033620.1:60461-60546_length:86_mod0000 -M_T0_RID188_S0_NC_033745.1:5844-5924_length:81_mod0000 -M_T0_RID188_S1_NC_030746.1:5743-5836_length:94_mod0000 -M_T0_RID188_S1_NZ_JBDYSJ010000001.1:693404-693463_length:60_mod0000 -M_T0_RID190_S0_NC_028099.1:110295-110391_length:97_mod0000 -M_T0_RID190_S0_NC_031463.1:15502-15572_length:71_mod0000 -M_T0_RID190_S0_NZ_JBDYSJ010000002.1:205146-205255_length:110_mod0000 -M_T0_RID190_S1_NC_031291.1:89-172_length:84_mod0000 -M_T0_RID190_S1_NZ_JBDYRX010000001.1:953429-953485_length:57_mod0001 -M_T0_RID191_S0_NC_028811.1:13630-13691_length:62_mod0000 -M_T0_RID191_S0_NC_029255.1:128444-128478_length:35_mod0000 -M_T0_RID191_S1_NC_027706.1:673-702_length:30_mod0000 -M_T0_RID192_S0_NC_030202.1:1974-2037_length:64_mod0000 -M_T0_RID192_S0_NZ_JBDYSJ010000002.1:499003-499042_length:40_mod0000 -M_T0_RID192_S1_NC_028266.1:2491-2562_length:72_mod0000 -M_T0_RID192_S1_NC_029935.1:3672-3749_length:78_mod0000 -M_T0_RID193_S0_NC_030796.1:1139-1218_length:80_mod0000 -M_T0_RID193_S0_NZ_JBDYLZ010000006.1:65091-65167_length:77_mod0000 -M_T0_RID193_S1_NC_029311.1:3962-4023_length:62_mod0000 -M_T0_RID193_S1_NC_029854.1:2071-2138_length:68_mod0001 -M_T0_RID193_S1_NZ_JBDYLZ010000018.1:32241-32282_length:42_mod0000 -M_T0_RID193_S1_NZ_JBDYSJ010000004.1:33272-33325_length:54_mod0000 -M_T0_RID194_S0_NZ_JBDYRX010000001.1:29953-30068_length:116_mod0000 -M_T0_RID194_S1_NC_027117.1:4-75_length:72_mod0000 -M_T0_RID194_S1_NZ_JBDYSJ010000002.1:458031-458124_length:94_mod0000 -M_T0_RID195_S0_NC_029126.1:5551-5630_length:80_mod0000 -M_T0_RID195_S0_NC_030117.1:78912-78948_length:37_mod0000 -M_T0_RID195_S0_NZ_JBDYLZ010000010.1:56983-57024_length:42_mod0000 -M_T0_RID196_S0_NC_028891.1:12640-12710_length:71_mod0000 -M_T0_RID196_S0_NZ_JBDYSJ010000001.1:166064-166125_length:62_mod0000 -M_T0_RID196_S1_NC_029306.1:173-274_length:102_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000001.1:85071-85115_length:45_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000003.1:358250-358311_length:62_mod0001 -M_T0_RID198_S1_NZ_JBDYLZ010000012.1:46495-46566_length:72_mod0000 -M_T0_RID198_S1_NZ_JBDYSJ010000001.1:185655-185715_length:61_mod0000 -M_T0_RID199_S0_NZ_JBDYRX010000001.1:904336-904396_length:61_mod0000 -M_T0_RID200_S1_NZ_JBDYRX010000001.1:660511-660552_length:42_mod0000 -M_T0_RID201_S0_NZ_JBDYLZ010000028.1:698-764_length:67_mod0000 -M_T0_RID201_S1_NZ_JBDYSJ010000001.1:587635-587727_length:93_mod0000 -M_T0_RID202_S0_NZ_JBDYLZ010000009.1:73121-73183_length:63_mod0000 -M_T0_RID203_S1_NC_027923.1:89467-89574_length:108_mod0000 -M_T0_RID203_S1_NC_028470.1:6286-6372_length:87_mod0000 -M_T0_RID204_S0_NZ_JBDYSJ010000003.1:424711-424783_length:73_mod0000 -M_T0_RID204_S1_NZ_JBDYLZ010000009.1:157953-158008_length:56_mod0000 -M_T0_RID205_S0_NC_028806.1:14973-15042_length:70_mod0001 -M_T0_RID205_S0_NC_031336.1:5585-5707_length:123_mod0000 -M_T0_RID205_S0_NC_033710.1:1140-1174_length:35_mod0001 -M_T0_RID205_S0_NC_034377.1:309-345_length:37_mod0000 -M_T0_RID205_S0_NZ_JBDYRX010000001.1:648020-648102_length:83_mod0000 -M_T0_RID206_S0_NZ_JBDYRX010000003.1:657781-657875_length:95_mod0000 -M_T0_RID206_S1_NZ_JBDYSJ010000002.1:507837-507900_length:64_mod0000 -M_T0_RID207_S0_NC_029782.1:2571-2655_length:85_mod0000 -M_T0_RID207_S0_NC_033756.1:9757-9804_length:48_mod0000 -M_T0_RID207_S1_NC_028470.1:3881-3944_length:64_mod0000 -M_T0_RID207_S1_NC_029111.1:391-425_length:35_mod0000 -M_T0_RID208_S1_NC_028137.1:3146-3238_length:93_mod0000 -M_T0_RID209_S1_NC_027016.1:200405-200534_length:130_mod0000 -M_T0_RID209_S1_NZ_JBDYRX010000003.1:693765-693849_length:85_mod0000 -M_T0_RID211_S0_NC_030749.1:1821-1921_length:101_mod0000 -M_T0_RID211_S0_NZ_JBDYSJ010000002.1:199161-199238_length:78_mod0000 -M_T0_RID212_S0_NC_028462.1:2849-2888_length:40_mod0000 -M_T0_RID212_S0_NC_031272.1:7400-7455_length:56_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:220611-220694_length:84_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:824198-824247_length:50_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000002.1:522607-522670_length:64_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000003.1:35532-35575_length:44_mod0000 -M_T0_RID213_S1_NC_027619.1:3998-4074_length:77_mod0000 -M_T0_RID214_S0_NC_017990.1:4036-4109_length:74_mod0000 -M_T0_RID214_S0_NZ_JBDYRX010000004.1:6306-6380_length:75_mod0000 -M_T0_RID214_S1_NZ_JBDYLZ010000016.1:26291-26346_length:56_mod0001 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:332282-332360_length:79_mod0000 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:457564-457597_length:34_mod0000 -M_T0_RID215_S1_NZ_JBDYRX010000004.1:547476-547541_length:66_mod0000 -M_T0_RID217_S0_NC_030922.1:6414-6531_length:118_mod0000 -M_T0_RID217_S0_NZ_JBDYRX010000001.1:366993-367094_length:102_mod0000 -M_T0_RID217_S1_NC_017970.1:8697-8737_length:41_mod0000 -M_T0_RID217_S1_NC_018482.1:2018-2099_length:82_mod0000 -M_T0_RID219_S0_NZ_JBDYLZ010000006.1:135272-135372_length:101_mod0001 -M_T0_RID219_S1_NZ_JBDYRX010000003.1:132173-132251_length:79_mod0000 -M_T0_RID220_S0_NC_033725.1:8661-8722_length:62_mod0000 -M_T0_RID220_S1_NZ_JBDYRX010000003.1:133141-133229_length:89_mod0000 -M_T0_RID221_S0_NZ_JBDYRX010000001.1:771011-771087_length:77_mod0000 -M_T0_RID222_S0_NC_037572.1:1818-1871_length:54_mod0000 -M_T0_RID222_S1_NC_028485.1:810-872_length:63_mod0000 -M_T0_RID222_S1_NC_030793.1:2889-2992_length:104_mod0000 -M_T0_RID222_S1_NZ_JBDYRX010000001.1:301419-301533_length:115_mod0001 -M_T0_RID223_S1_NC_033620.1:157690-157751_length:62_mod0000 -M_T0_RID224_S0_NC_017937.1:2859-2949_length:91_mod0000 -M_T0_RID224_S1_NC_028388.1:2224-2291_length:68_mod0001 -M_T0_RID224_S1_NC_033700.1:22817-22886_length:70_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000001.1:692859-692944_length:86_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000004.1:483631-483701_length:71_mod0000 -M_T0_RID225_S1_NC_029311.1:72416-72523_length:108_mod0000 -M_T0_RID225_S1_NC_030240.1:91908-91984_length:77_mod0000 -M_T0_RID226_S0_NZ_JBDYRX010000001.1:678003-678073_length:71_mod0000 -M_T0_RID226_S1_NZ_JBDYRX010000001.1:984964-985038_length:75_mod0000 -M_T0_RID227_S0_NC_028636.1:35420-35507_length:88_mod0000 -M_T0_RID227_S0_NZ_JBDYLZ010000014.1:18260-18351_length:92_mod0000 -M_T0_RID227_S1_NZ_JBDYLZ010000010.1:2424-2519_length:96_mod0000 -M_T0_RID229_S0_NZ_JBDYRX010000002.1:664717-664801_length:85_mod0000 -M_T0_RID230_S0_NC_033822.1:1869-1967_length:99_mod0000 -M_T0_RID230_S0_NZ_JBDYRX010000002.1:244562-244600_length:39_mod0000 -M_T0_RID231_S0_NC_034017.1:4341-4449_length:109_mod0000 -M_T0_RID231_S0_NZ_JBDYRX010000002.1:364966-365054_length:89_mod0000 -M_T0_RID231_S1_NZ_JBDYRX010000004.1:275949-276005_length:57_mod0001 -M_T0_RID233_S0_NC_030402.1:4056-4127_length:72_mod0000 -M_T0_RID234_S0_NZ_JBDYSJ010000001.1:910286-910315_length:30_mod0000 -M_T0_RID234_S1_NZ_JBDYSJ010000003.1:84105-84229_length:125_mod0000 -M_T0_RID235_S0_NC_029997.2:52965-53016_length:52_mod0000 -M_T0_RID235_S0_NZ_JBDYRX010000004.1:469577-469661_length:85_mod0000 -M_T0_RID235_S1_NC_029993.1:68-156_length:89_mod0000 -M_T0_RID236_S0_NC_027209.1:15-106_length:92_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000001.1:879200-879251_length:52_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000002.1:665177-665206_length:30_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:172535-172571_length:37_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:365370-365448_length:79_mod0000 -M_T0_RID237_S1_NZ_JBDYRX010000003.1:311400-311455_length:56_mod0000 -M_T0_RID237_S1_NZ_JBDYSJ010000001.1:341900-342051_length:152_mod0001 -M_T0_RID237_S1_NZ_JBDYSJ010000002.1:210078-210161_length:84_mod0000 -M_T0_RID239_S1_NZ_JBDYLZ010000008.1:60180-60243_length:64_mod0000 -M_T0_RID240_S0_NC_028376.1:8889-8978_length:90_mod0000 -M_T0_RID240_S0_NZ_JBDYLZ010000011.1:107039-107086_length:48_mod0000 -M_T0_RID240_S1_NC_029255.1:88189-88282_length:94_mod0000 -M_T0_RID242_S0_NC_031275.1:6726-6767_length:42_mod0000 -M_T0_RID242_S1_NZ_JBDYRX010000003.1:456427-456495_length:69_mod0000 -M_T0_RID243_S0_NC_038232.1:593-634_length:42_mod0000 -M_T0_RID244_S0_NZ_JBDYRX010000004.1:71169-71250_length:82_mod0000 -M_T0_RID244_S1_NC_031105.1:1094-1177_length:84_mod0000 -M_T0_RID244_S1_NZ_JBDYRX010000003.1:93344-93453_length:110_mod0000 -M_T0_RID245_S1_NC_027916.2:74440-74509_length:70_mod0000 -M_T0_RID246_S0_NZ_JBDYLZ010000007.1:253179-253255_length:77_mod0000 -M_T0_RID246_S0_NZ_JBDYRX010000003.1:373773-373844_length:72_mod0000 -M_T0_RID247_S1_NC_034240.1:6159-6240_length:82_mod0000 -M_T0_RID247_S1_NZ_JBDYLZ010000006.1:319402-319479_length:78_mod0000 -M_T0_RID248_S1_NZ_JBDYLZ010000021.1:15403-15484_length:82_mod0000 -M_T0_RID248_S1_NZ_JBDYSJ010000002.1:614316-614362_length:47_mod0000 -M_T0_RID249_S1_NZ_JBDYSJ010000002.1:599779-599834_length:56_mod0000 -M_T0_RID250_S0_NC_027916.2:147626-147747_length:122_mod0000 -M_T0_RID250_S0_NC_033620.1:26136-26203_length:68_mod0000 -M_T0_RID251_S1_NZ_JBDYRX010000003.1:388429-388516_length:88_mod0001 -M_T0_RID252_S0_NZ_JBDYRX010000003.1:533554-533659_length:106_mod0000 -M_T0_RID252_S0_NZ_JBDYSJ010000004.1:89796-89871_length:76_mod0000 -M_T0_RID254_S0_NC_029312.1:1320-1415_length:96_mod0000 -M_T0_RID254_S1_NC_033722.1:1513-1562_length:50_mod0000 -M_T0_RID254_S1_NZ_JBDYRX010000003.1:600746-600803_length:58_mod0000 -M_T0_RID255_S1_NZ_JBDYLZ010000009.1:84943-85024_length:82_mod0000 -M_T0_RID256_S0_NZ_JBDYRX010000002.1:72764-72831_length:68_mod0000 -M_T0_RID256_S1_NZ_JBDYSJ010000003.1:105583-105635_length:53_mod0001 -M_T0_RID257_S0_NC_029997.2:11591-11678_length:88_mod0000 -M_T0_RID257_S0_NZ_JBDYLZ010000007.1:42813-42887_length:75_mod0000 -M_T0_RID258_S0_NC_030151.1:5275-5349_length:75_mod0000 -M_T0_RID258_S1_NC_023442.1:46718-46759_length:42_mod0000 -M_T0_RID258_S1_NC_027641.1:2606-2691_length:86_mod0000 -M_T0_RID259_S0_NZ_JBDYRX010000001.1:515399-515441_length:43_mod0000 -M_T0_RID259_S1_NC_033710.1:2139-2199_length:61_mod0001 -M_T0_RID260_S0_NZ_JBDYRX010000004.1:304887-304994_length:108_mod0000 -M_T0_RID261_S0_NC_024913.1:363-436_length:74_mod0000 -M_T0_RID261_S1_NZ_JBDYSJ010000003.1:83891-83937_length:47_mod0000 -M_T0_RID262_S0_NC_028964.1:8465-8506_length:42_mod0000 -M_T0_RID262_S1_NC_028369.1:11507-11563_length:57_mod0000 -M_T0_RID263_S1_NZ_JBDYLZ010000007.1:59938-60023_length:86_mod0000 -M_T0_RID264_S1_NC_030240.1:10284-10380_length:97_mod0000 -M_T0_RID266_S0_NZ_JBDYRX010000003.1:575037-575078_length:42_mod0000 -M_T0_RID268_S0_NZ_JBDYRX010000001.1:768153-768245_length:93_mod0000 -M_T0_RID268_S0_NZ_JBDYSJ010000001.1:798703-798770_length:68_mod0000 -M_T0_RID270_S0_NC_029132.1:95722-95798_length:77_mod0000 -M_T0_RID270_S1_NZ_JBDYSJ010000004.1:222075-222158_length:84_mod0000 -M_T0_RID271_S0_NC_033620.1:162451-162504_length:54_mod0000 -M_T0_RID272_S0_NC_033620.1:33874-33960_length:87_mod0000 -M_T0_RID273_S1_NC_030744.1:7300-7340_length:41_mod0000 -M_T0_RID273_S1_NZ_JBDYRX010000002.1:841729-841840_length:112_mod0000 -M_T0_RID274_S1_NC_037571.1:1402-1475_length:74_mod0000 -M_T0_RID274_S1_NC_037615.1:1507-1556_length:50_mod0000 -M_T0_RID274_S1_NZ_JBDYRX010000002.1:803747-803830_length:84_mod0001 -M_T0_RID276_S0_NZ_JBDYSJ010000001.1:37440-37524_length:85_mod0000 -M_T0_RID276_S1_NZ_JBDYSJ010000003.1:418336-418453_length:118_mod0000 -M_T0_RID277_S1_NZ_JBDYLZ010000010.1:25227-25303_length:77_mod0000 -M_T0_RID277_S1_NZ_JBDYRX010000004.1:42366-42442_length:77_mod0000 -M_T0_RID280_S1_NC_029255.1:110657-110707_length:51_mod0000 -M_T0_RID280_S1_NZ_JBDYLZ010000007.1:148039-148124_length:86_mod0000 -M_T0_RID280_S1_NZ_JBDYSJ010000003.1:358558-358656_length:99_mod0000 -M_T0_RID281_S0_NZ_JBDYRX010000001.1:319973-320043_length:71_mod0000 -M_T0_RID281_S1_NC_033717.1:9058-9157_length:100_mod0000 -M_T0_RID281_S1_NZ_JBDYLZ010000009.1:175718-175802_length:85_mod0000 -M_T0_RID282_S0_NZ_JBDYRX010000002.1:378265-378345_length:81_mod0001 -M_T0_RID283_S1_NC_027016.1:6355-6413_length:59_mod0000 -M_T0_RID283_S1_NC_028230.1:391-510_length:120_mod0000 -M_T0_RID285_S1_NC_034376.1:1364-1410_length:47_mod0000 -M_T0_RID286_S1_NC_027918.1:6177-6259_length:83_mod0000 -M_T0_RID287_S0_NZ_JBDYRX010000003.1:370134-370205_length:72_mod0000 -M_T0_RID289_S0_NZ_JBDYRX010000001.1:744827-744955_length:129_mod0000 -M_T0_RID289_S1_NC_028259.1:3827-3878_length:52_mod0000 -M_T0_RID290_S0_NC_030240.1:45198-45233_length:36_mod0000 -M_T0_RID290_S0_NC_030691.1:1722-1773_length:52_mod0000 -M_T0_RID290_S1_NC_029133.1:4034-4132_length:99_mod0000 -M_T0_RID291_S1_NC_028981.1:5970-6046_length:77_mod0000 -M_T0_RID291_S1_NZ_JBDYSJ010000002.1:464139-464169_length:31_mod0000 -M_T0_RID293_S1_NC_030232.1:2260-2327_length:68_mod0000 -M_T0_RID295_S1_NC_027916.2:61867-61920_length:54_mod0000 -M_T0_RID295_S1_NC_028806.1:27530-27608_length:79_mod0000 -M_T0_RID296_S0_NZ_JBDYSJ010000001.1:184354-184410_length:57_mod0000 -M_T0_RID296_S1_NC_028867.1:5870-5944_length:75_mod0000 -M_T0_RID296_S1_NC_029034.2:6068-6170_length:103_mod0000 -M_T0_RID296_S1_NC_029575.1:1786-1824_length:39_mod0000 -M_T0_RID296_S1_NC_031313.1:8320-8423_length:104_mod0000 -M_T0_RID296_S1_NZ_JBDYRX010000001.1:732093-732144_length:52_mod0000 -M_T0_RID300_S0_NC_030870.1:888-963_length:76_mod0000 -M_T0_RID300_S1_NC_028239.1:12981-13075_length:95_mod0001 -M_T0_RID301_S0_NC_027016.1:47977-48089_length:113_mod0000 -M_T0_RID301_S0_NC_029997.2:77533-77588_length:56_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000001.1:795273-795348_length:76_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000003.1:723584-723651_length:68_mod0000 -M_T0_RID302_S1_NC_033820.1:4695-4770_length:76_mod0000 -M_T0_RID303_S0_NZ_JBDYSJ010000002.1:596456-596511_length:56_mod0000 -M_T0_RID303_S1_NZ_JBDYLZ010000013.1:92895-92926_length:32_mod0000 -M_T0_RID304_S0_NC_031463.1:20675-20751_length:77_mod0000 -M_T0_RID306_S0_NC_027916.2:96621-96699_length:79_mod0000 -M_T0_RID307_S0_NC_028266.1:10941-10980_length:40_mod0000 -M_T0_RID308_S1_NZ_JBDYLZ010000010.1:103191-103276_length:86_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:370261-370296_length:36_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:387786-387861_length:76_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000003.1:389721-389777_length:57_mod0000 -M_T0_RID309_S1_NC_026944.1:4310-4395_length:86_mod0000 -M_T0_RID309_S1_NZ_JBDYSJ010000001.1:151328-151382_length:55_mod0000 -M_T0_RID311_S0_NZ_JBDYLZ010000006.1:59717-59765_length:49_mod0000 -M_T0_RID311_S1_NZ_JBDYLZ010000023.1:5604-5703_length:100_mod0000 -M_T0_RID312_S1_NC_018382.1:3769-3816_length:48_mod0000 -M_T0_RID313_S1_NZ_JBDYRX010000002.1:139751-139865_length:115_mod0000 -M_T0_RID314_S0_NZ_JBDYSJ010000004.1:132522-132621_length:100_mod0000 -M_T0_RID315_S0_NC_033823.1:7820-7860_length:41_mod0000 -M_T0_RID317_S0_NC_034214.1:5951-5996_length:46_mod0000 -M_T0_RID317_S0_NZ_JBDYLZ010000015.1:71185-71277_length:93_mod0000 -M_T0_RID317_S0_NZ_JBDYRX010000004.1:174342-174382_length:41_mod0000 -M_T0_RID317_S1_NC_030293.1:5902-5968_length:67_mod0001 -M_T0_RID318_S0_NC_028814.1:27392-27476_length:85_mod0000 -M_T0_RID318_S0_NZ_JBDYRX010000001.1:771856-771930_length:75_mod0000 -M_T0_RID318_S1_NZ_JBDYLZ010000006.1:119310-119391_length:82_mod0000 -M_T0_RID319_S0_NC_034266.1:62140-62218_length:79_mod0000 -M_T0_RID319_S1_NC_028981.1:4292-4341_length:50_mod0000 -M_T0_RID319_S1_NC_031455.1:2498-2551_length:54_mod0000 -M_T0_RID319_S1_NZ_JBDYRX010000004.1:60929-61033_length:105_mod0000 -M_T0_RID322_S1_NZ_JBDYRX010000003.1:440227-440291_length:65_mod0000 -M_T0_RID323_S0_NC_030240.1:40893-40967_length:75_mod0000 -M_T0_RID323_S0_NZ_JBDYLZ010000007.1:249215-249268_length:54_mod0000 -M_T0_RID324_S0_NC_029311.1:87639-87764_length:126_mod0000 -M_T0_RID324_S0_NZ_JBDYSJ010000002.1:545609-545688_length:80_mod0000 -M_T0_RID324_S1_NZ_JBDYSJ010000003.1:210751-210786_length:36_mod0000 -M_T0_RID325_S1_NC_031240.1:7762-7813_length:52_mod0000 -M_T0_RID326_S0_NZ_JBDYLZ010000009.1:5470-5539_length:70_mod0000 -M_T0_RID328_S1_NZ_JBDYRX010000002.1:171169-171268_length:100_mod0000 -M_T0_RID329_S0_NZ_JBDYRX010000002.1:757356-757453_length:98_mod0000 -M_T0_RID329_S1_NZ_JBDYLZ010000008.1:68972-69065_length:94_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:680879-680974_length:96_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:706464-706551_length:88_mod0000 -M_T0_RID331_S0_NC_029255.1:77095-77131_length:37_mod0000 -M_T0_RID331_S0_NC_030240.1:62248-62311_length:64_mod0000 -M_T0_RID331_S1_NC_030126.1:1582-1653_length:72_mod0001 -M_T0_RID331_S1_NC_033707.1:5319-5406_length:88_mod0000 -M_T0_RID331_S1_NZ_JBDYLZ010000016.1:42739-42823_length:85_mod0000 -M_T0_RID332_S0_NZ_JBDYSJ010000004.1:35297-35358_length:62_mod0000 -M_T0_RID333_S0_NZ_JBDYLZ010000014.1:79014-79074_length:61_mod0000 -M_T0_RID333_S1_NC_027647.1:655-726_length:72_mod0000 -M_T0_RID333_S1_NC_033620.1:54726-54845_length:120_mod0000 -M_T0_RID334_S0_NZ_JBDYRX010000002.1:455003-455101_length:99_mod0000 -M_T0_RID335_S0_NZ_JBDYRX010000002.1:694573-694718_length:146_mod0000 -M_T0_RID335_S1_NZ_JBDYSJ010000001.1:102384-102461_length:78_mod0000 -M_T0_RID337_S0_NC_028368.1:13695-13792_length:98_mod0000 -M_T0_RID338_S0_NZ_JBDYRX010000001.1:578324-578379_length:56_mod0000 -M_T0_RID338_S1_NZ_JBDYRX010000003.1:471689-471760_length:72_mod0000 -M_T0_RID339_S1_NC_028362.1:1132-1236_length:105_mod0000 -M_T0_RID339_S1_NZ_JBDYRX010000003.1:626110-626150_length:41_mod0000 -M_T0_RID339_S1_NZ_JBDYSJ010000002.1:576422-576503_length:82_mod0000 -M_T0_RID340_S0_NC_028973.1:4682-4727_length:46_mod0000 -M_T0_RID340_S0_NC_029132.1:93532-93576_length:45_mod0000 -M_T0_RID341_S0_NC_030240.1:112206-112263_length:58_mod0000 -M_T0_RID341_S0_NC_034252.1:1229-1329_length:101_mod0000 -M_T0_RID342_S0_NZ_JBDYLZ010000011.1:111949-111982_length:34_mod0001 -M_T0_RID342_S1_NZ_JBDYLZ010000008.1:135318-135406_length:89_mod0001 -M_T0_RID343_S0_NC_029996.1:68953-69051_length:99_mod0000 -M_T0_RID344_S1_NC_030148.1:11118-11172_length:55_mod0000 -M_T0_RID345_S0_NZ_JBDYRX010000002.1:64932-64977_length:46_mod0000 -M_T0_RID346_S1_NZ_JBDYRX010000003.1:433612-433704_length:93_mod0000 -M_T0_RID347_S0_NC_036636.1:7712-7773_length:62_mod0000 -M_T0_RID347_S1_NZ_JBDYRX010000002.1:59074-59138_length:65_mod0000 -M_T0_RID347_S1_NZ_JBDYSJ010000003.1:117376-117430_length:55_mod0001 -M_T0_RID348_S0_NZ_JBDYRX010000001.1:1015831-1015930_length:100_mod0000 -M_T0_RID348_S1_NZ_JBDYRX010000001.1:141445-141557_length:113_mod0000 -M_T0_RID349_S0_NC_030391.1:4068-4155_length:88_mod0001 -M_T0_RID349_S0_NZ_JBDYRX010000001.1:226925-227009_length:85_mod0000 -M_T0_RID349_S1_NZ_JBDYRX010000003.1:358370-358434_length:65_mod0000 -M_T0_RID351_S0_NC_033753.1:4226-4317_length:92_mod0000 -M_T0_RID352_S1_NC_028259.1:56-127_length:72_mod0000 -M_T0_RID352_S1_NC_028395.1:155-248_length:94_mod0000 -M_T0_RID352_S1_NC_029931.1:9204-9241_length:38_mod0000 -M_T0_RID353_S0_NZ_JBDYLZ010000009.1:48165-48236_length:72_mod0000 -M_T0_RID354_S1_NZ_JBDYLZ010000012.1:45797-45922_length:126_mod0000 -M_T0_RID356_S0_NC_028378.1:3454-3530_length:77_mod0000 -M_T0_RID357_S0_NZ_JBDYRX010000002.1:120553-120591_length:39_mod0000 -M_T0_RID357_S1_NZ_JBDYSJ010000004.1:245908-245957_length:50_mod0000 -M_T0_RID358_S0_NC_029126.1:5901-5938_length:38_mod0000 -M_T0_RID358_S1_NC_028140.1:1554-1651_length:98_mod0000 -M_T0_RID358_S1_NZ_JBDYSJ010000002.1:580725-580785_length:61_mod0001 -M_T0_RID359_S0_NZ_JBDYRX010000001.1:601220-601298_length:79_mod0000 -M_T0_RID360_S0_NC_027916.2:77660-77740_length:81_mod0001 -M_T0_RID360_S0_NZ_JBDYLZ010000012.1:70482-70531_length:50_mod0000 -M_T0_RID360_S1_NC_017862.1:2881-2912_length:32_mod0000 -M_T0_RID360_S1_NC_028373.1:7802-7900_length:99_mod0000 -M_T0_RID361_S0_NZ_JBDYRX010000003.1:274684-274747_length:64_mod0000 -M_T0_RID362_S0_NC_029996.1:102820-102944_length:125_mod0001 -M_T0_RID362_S1_NC_027916.2:110368-110450_length:83_mod0000 -M_T0_RID362_S1_NZ_JBDYSJ010000002.1:480705-480765_length:61_mod0000 -M_T0_RID363_S0_NC_031089.1:6455-6543_length:89_mod0000 -M_T0_RID363_S0_NC_031218.1:1568-1623_length:56_mod0000 -M_T0_RID365_S1_NZ_JBDYSJ010000002.1:271975-272051_length:77_mod0000 -M_T0_RID366_S0_NZ_JBDYSJ010000001.1:487398-487484_length:87_mod0001 -M_T0_RID366_S1_NC_030843.1:4921-5005_length:85_mod0000 -M_T0_RID367_S0_NC_030127.1:2548-2589_length:42_mod0000 -M_T0_RID367_S0_NZ_JBDYLZ010000011.1:24860-24971_length:112_mod0000 -M_T0_RID367_S1_NZ_JBDYLZ010000006.1:96139-96201_length:63_mod0000 -M_T0_RID368_S0_NZ_JBDYSJ010000002.1:604782-604905_length:124_mod0001 -M_T0_RID369_S1_NC_031464.1:5161-5234_length:74_mod0000 -M_T0_RID370_S0_NC_027542.1:1019-1100_length:82_mod0000 -M_T0_RID371_S1_NC_028144.1:5011-5099_length:89_mod0000 -M_T0_RID371_S1_NZ_JBDYRX010000002.1:678499-678596_length:98_mod0000 -M_T0_RID372_S0_NZ_JBDYRX010000003.1:526040-526077_length:38_mod0000 -M_T0_RID372_S0_NZ_JBDYSJ010000002.1:283416-283463_length:48_mod0001 -M_T0_RID373_S0_NC_033705.1:55-95_length:41_mod0000 -M_T0_RID374_S0_NC_027016.1:151413-151449_length:37_mod0000 -M_T0_RID374_S0_NZ_JBDYSJ010000003.1:310288-310375_length:88_mod0000 -M_T0_RID374_S1_NZ_JBDYLZ010000012.1:57726-57851_length:126_mod0000 -M_T0_RID375_S0_NC_034377.1:6340-6385_length:46_mod0000 -M_T0_RID375_S1_NC_028099.1:112413-112504_length:92_mod0001 -M_T0_RID378_S0_NC_018448.1:5936-6007_length:72_mod0000 -M_T0_RID379_S1_NZ_JBDYRX010000001.1:727009-727109_length:101_mod0000 -M_T0_RID380_S0_NC_034253.1:5146-5187_length:42_mod0000 -M_T0_RID380_S1_NC_029905.1:2051-2094_length:44_mod0000 -M_T0_RID381_S0_NC_030240.1:103311-103373_length:63_mod0000 -M_T0_RID381_S0_NZ_JBDYLZ010000009.1:178104-178162_length:59_mod0000 -M_T0_RID382_S0_NC_027210.1:5895-5968_length:74_mod0000 -M_T0_RID382_S0_NC_029996.1:87376-87478_length:103_mod0000 -M_T0_RID382_S1_NC_027916.2:84236-84307_length:72_mod0000 -M_T0_RID383_S0_NZ_JBDYSJ010000001.1:683370-683456_length:87_mod0000 -M_T0_RID383_S1_NC_029132.1:79856-79920_length:65_mod0000 -M_T0_RID385_S0_NZ_JBDYLZ010000009.1:69071-69118_length:48_mod0000 -M_T0_RID386_S0_NC_034225.1:1556-1648_length:93_mod0000 -M_T0_RID387_S1_NC_028636.1:123682-123742_length:61_mod0000 -M_T0_RID388_S0_NZ_JBDYLZ010000008.1:71860-71983_length:124_mod0000 -M_T0_RID389_S0_NC_029051.1:9270-9318_length:49_mod0000 -M_T0_RID389_S0_NZ_JBDYLZ010000016.1:61192-61254_length:63_mod0000 -M_T0_RID390_S1_NC_028981.1:1738-1830_length:93_mod0000 -M_T0_RID391_S0_NC_028371.1:6428-6495_length:68_mod0000 -M_T0_RID391_S0_NZ_JBDYRX010000004.1:272450-272500_length:51_mod0000 -M_T0_RID391_S1_NZ_JBDYSJ010000002.1:543099-543205_length:107_mod0000 -M_T0_RID392_S0_NC_028970.1:5031-5099_length:69_mod0000 -M_T0_RID392_S1_NC_028824.1:19380-19469_length:90_mod0000 -M_T0_RID392_S1_NZ_JBDYLZ010000009.1:26519-26597_length:79_mod0000 -M_T0_RID393_S0_NZ_JBDYLZ010000015.1:66736-66802_length:67_mod0000 -M_T0_RID395_S0_NC_031304.1:4214-4304_length:91_mod0000 -M_T0_RID396_S0_NZ_JBDYSJ010000001.1:683444-683483_length:40_mod0000 -M_T0_RID397_S0_NC_028125.1:5157-5221_length:65_mod0000 -M_T0_RID398_S0_NC_028814.1:21296-21329_length:34_mod0000 -M_T0_RID398_S0_NZ_JBDYLZ010000008.1:89568-89611_length:44_mod0000 -M_T0_RID398_S1_NZ_JBDYRX010000003.1:160428-160514_length:87_mod0000 -M_T0_RID399_S1_NZ_JBDYRX010000002.1:383166-383266_length:101_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000006.1:321094-321166_length:73_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000017.1:46480-46536_length:57_mod0000 -M_T0_RID402_S0_NC_028491.1:36087-36159_length:73_mod0000 -M_T0_RID406_S0_NC_033720.1:8569-8637_length:69_mod0000 -M_T0_RID406_S0_NZ_JBDYSJ010000002.1:605544-605617_length:74_mod0000 -M_T0_RID406_S1_NC_033620.1:71763-71841_length:79_mod0000 -M_T0_RID407_S0_NC_028491.1:95220-95304_length:85_mod0000 -M_T0_RID407_S0_NZ_JBDYRX010000004.1:531865-531922_length:58_mod0000 -M_T0_RID408_S0_NZ_JBDYLZ010000006.1:20241-20331_length:91_mod0000 -M_T0_RID408_S1_NC_030391.1:1047-1152_length:106_mod0000 -M_T0_RID409_S1_NC_029904.1:2927-3013_length:87_mod0000 -M_T0_RID410_S0_NC_028369.1:7176-7240_length:65_mod0000 -M_T0_RID410_S1_NC_027923.1:107200-107294_length:95_mod0000 -M_T0_RID411_S1_NC_027916.2:12656-12743_length:88_mod0000 -M_T0_RID412_S0_NC_028362.1:1734-1810_length:77_mod0000 -M_T0_RID414_S0_NC_027646.1:3518-3556_length:39_mod0000 -M_T0_RID415_S1_NC_033703.1:4454-4536_length:83_mod0000 -M_T0_RID415_S1_NZ_JBDYRX010000004.1:398358-398416_length:59_mod0000 -M_T0_RID419_S0_NZ_JBDYSJ010000002.1:339543-339583_length:41_mod0000 -M_T0_RID420_S0_NC_029919.1:1092-1170_length:79_mod0000 -M_T0_RID420_S1_NC_029132.1:86139-86240_length:102_mod0000 -M_T0_RID421_S0_NZ_JBDYRX010000004.1:42510-42680_length:171_mod0001 -M_T0_RID421_S1_NC_028099.1:99392-99421_length:30_mod0000 -M_T0_RID422_S0_NC_028236.1:7738-7797_length:60_mod0000 -M_T0_RID422_S0_NZ_JBDYLZ010000014.1:21662-21716_length:55_mod0000 -M_T0_RID422_S0_NZ_JBDYSJ010000002.1:476168-476219_length:52_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:131159-131244_length:86_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:465551-465658_length:108_mod0000 -M_T0_RID424_S0_NC_029132.1:124479-124602_length:124_mod0000 -M_T0_RID424_S1_NZ_JBDYLZ010000006.1:180426-180481_length:56_mod0000 -M_T0_RID424_S1_NZ_JBDYSJ010000003.1:445372-445447_length:76_mod0000 -M_T0_RID425_S0_NZ_JBDYLZ010000006.1:11120-11222_length:103_mod0000 -M_T0_RID426_S1_NZ_JBDYRX010000002.1:460851-460904_length:54_mod0000 -M_T0_RID426_S1_NZ_JBDYSJ010000001.1:882579-882628_length:50_mod0000 -M_T0_RID427_S0_NZ_JBDYSJ010000001.1:460394-460459_length:66_mod0000 -M_T0_RID428_S1_NZ_JBDYLZ010000007.1:203593-203667_length:75_mod0000 -M_T0_RID432_S1_NZ_JBDYRX010000004.1:37215-37282_length:68_mod0000 -M_T0_RID433_S0_NC_028371.1:7751-7803_length:53_mod0000 -M_T0_RID433_S0_NZ_JBDYRX010000001.1:940205-940283_length:79_mod0000 -M_T0_RID434_S0_NZ_JBDYRX010000003.1:278075-278140_length:66_mod0000 -M_T0_RID435_S1_NC_031225.1:6315-6360_length:46_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000001.1:992235-992354_length:120_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000002.1:28179-28253_length:75_mod0000 -M_T0_RID436_S0_NZ_JBDYRX010000004.1:193926-194033_length:108_mod0000 -M_T0_RID438_S0_NZ_JBDYRX010000004.1:427488-427551_length:64_mod0000 -M_T0_RID441_S1_NC_028486.1:4288-4332_length:45_mod0000 -M_T0_RID441_S1_NC_031135.1:1215-1254_length:40_mod0000 -M_T0_RID441_S1_NC_033620.1:171185-171273_length:89_mod0000 -M_T0_RID441_S1_NZ_JBDYRX010000001.1:944430-944505_length:76_mod0000 -M_T0_RID442_S1_NZ_JBDYSJ010000001.1:795030-795132_length:103_mod0000 -M_T0_RID444_S1_NC_029927.1:739-780_length:42_mod0000 -M_T0_RID445_S0_NC_030400.1:9136-9237_length:102_mod0000 -M_T0_RID445_S1_NC_037578.1:3062-3107_length:46_mod0000 -M_T0_RID446_S0_NC_029996.1:10622-10695_length:74_mod0000 -M_T0_RID446_S1_NC_034266.1:27796-27894_length:99_mod0000 -M_T0_RID447_S1_NC_031259.1:1711-1781_length:71_mod0000 -M_T0_RID450_S0_NZ_JBDYRX010000003.1:719829-719908_length:80_mod0000 -M_T0_RID451_S0_NC_027214.1:8775-8830_length:56_mod0000 -M_T0_RID451_S0_NC_028367.1:5391-5502_length:112_mod0000 -M_T0_RID451_S1_NZ_JBDYRX010000002.1:31090-31200_length:111_mod0000 -M_T0_RID452_S1_NC_030205.1:1725-1812_length:88_mod0000 -M_T0_RID453_S0_NC_033761.1:8903-9009_length:107_mod0001 -M_T0_RID455_S0_NC_027799.1:284-375_length:92_mod0000 -M_T0_RID455_S1_NZ_JBDYLZ010000014.1:95838-95936_length:99_mod0000 -M_T0_RID455_S1_NZ_JBDYSJ010000002.1:210490-210557_length:68_mod0000 -M_T0_RID456_S0_NZ_JBDYLZ010000007.1:109571-109660_length:90_mod0000 -M_T0_RID456_S1_NC_030240.1:55430-55543_length:114_mod0000 -M_T0_RID457_S1_NZ_JBDYLZ010000009.1:123168-123262_length:95_mod0000 -M_T0_RID457_S1_NZ_JBDYSJ010000004.1:21364-21417_length:54_mod0000 -M_T0_RID458_S1_NC_034266.1:128171-128258_length:88_mod0000 -M_T0_RID458_S1_NZ_JBDYLZ010000008.1:129533-129587_length:55_mod0000 -M_T0_RID458_S1_NZ_JBDYRX010000002.1:29087-29147_length:61_mod0000 -M_T0_RID459_S0_NZ_JBDYRX010000001.1:1023086-1023182_length:97_mod0000 -M_T0_RID459_S1_NC_023442.1:114262-114356_length:95_mod0000 -M_T0_RID460_S0_NC_029052.1:1193-1273_length:81_mod0000 -M_T0_RID462_S1_NZ_JBDYRX010000001.1:1005315-1005420_length:106_mod0000 -M_T0_RID463_S0_NC_028372.1:9914-9999_length:86_mod0000 -M_T0_RID463_S1_NZ_JBDYSJ010000004.1:218365-218453_length:89_mod0000 -M_T0_RID465_S0_NZ_JBDYSJ010000001.1:787887-787945_length:59_mod0000 -M_T0_RID465_S1_NC_029311.1:1797-1831_length:35_mod0000 -M_T0_RID466_S0_NZ_JBDYRX010000003.1:730520-730588_length:69_mod0000 -M_T0_RID470_S1_NC_033820.1:3073-3102_length:30_mod0000 -M_T0_RID471_S1_NZ_JBDYLZ010000008.1:35202-35290_length:89_mod0000 -M_T0_RID472_S0_NZ_JBDYLZ010000011.1:10802-10846_length:45_mod0000 -M_T0_RID472_S1_NZ_JBDYRX010000001.1:652634-652707_length:74_mod0000 -M_T0_RID474_S0_NC_030225.1:5289-5336_length:48_mod0000 -M_T0_RID475_S0_NZ_JBDYLZ010000006.1:151548-151631_length:84_mod0000 -M_T0_RID475_S0_NZ_JBDYRX010000002.1:464041-464153_length:113_mod0000 -M_T0_RID476_S0_NZ_JBDYLZ010000015.1:62860-62918_length:59_mod0000 -M_T0_RID477_S0_NC_027214.1:4315-4391_length:77_mod0000 -M_T0_RID477_S0_NC_030231.1:4362-4445_length:84_mod0000 -M_T0_RID477_S1_NC_027926.1:5336-5385_length:50_mod0000 -M_T0_RID479_S0_NC_034240.1:10006-10105_length:100_mod0000 -M_T0_RID479_S0_NC_034377.1:6973-7006_length:34_mod0000 -M_T0_RID479_S1_NC_029309.1:1183-1291_length:109_mod0000 -M_T0_RID479_S1_NZ_JBDYRX010000004.1:294593-294685_length:93_mod0000 -M_T0_RID480_S0_NC_030148.1:14092-14146_length:55_mod0000 -M_T0_RID481_S1_NC_027920.1:4910-4956_length:47_mod0000 -M_T0_RID481_S1_NC_028252.1:1447-1525_length:79_mod0000 -M_T0_RID481_S1_NC_029038.1:3990-4034_length:45_mod0000 -M_T0_RID482_S0_NC_031287.1:3748-3826_length:79_mod0000 -M_T0_RID483_S0_NC_029311.1:111589-111673_length:85_mod0000 -M_T0_RID484_S0_NZ_JBDYRX010000001.1:874633-874662_length:30_mod0000 -M_T0_RID484_S1_NZ_JBDYRX010000002.1:457659-457735_length:77_mod0000 -M_T0_RID487_S0_NC_023339.1:3452-3542_length:91_mod0000 -M_T0_RID488_S1_NC_030800.1:3767-3843_length:77_mod0000 -M_T0_RID490_S1_NC_028249.1:6706-6755_length:50_mod0000 -M_T0_RID490_S1_NC_033815.1:382-420_length:39_mod0000 -M_T0_RID491_S0_NC_029549.1:1543-1601_length:59_mod0000 -M_T0_RID491_S1_NC_023442.1:106362-106456_length:95_mod0001 -M_T0_RID491_S1_NZ_JBDYSJ010000002.1:433503-433622_length:120_mod0000 -M_T0_RID492_S1_NC_017967.1:4737-4790_length:54_mod0000 -M_T0_RID497_S1_NC_028231.1:2435-2530_length:96_mod0000 -M_T0_RID498_S1_NC_028368.1:10324-10389_length:66_mod0000 -M_T0_RID498_S1_NC_031088.1:10285-10350_length:66_mod0000 -M_T0_RID499_S0_NZ_JBDYLZ010000012.1:63930-64011_length:82_mod0000 -M_T0_RID500_S0_NZ_JBDYSJ010000003.1:369722-369827_length:106_mod0000 -M_T0_RID501_S0_NC_034214.1:4534-4626_length:93_mod0000 -M_T0_RID503_S1_NZ_JBDYLZ010000014.1:65584-65643_length:60_mod0001 -M_T0_RID504_S0_NC_033727.1:6181-6283_length:103_mod0000 -M_T0_RID504_S0_NC_037572.1:353-481_length:129_mod0000 -M_T0_RID506_S0_NZ_JBDYSJ010000001.1:230782-230869_length:88_mod0000 -M_T0_RID506_S1_NZ_JBDYRX010000001.1:155361-155441_length:81_mod0000 -M_T0_RID507_S0_NZ_JBDYRX010000001.1:64196-64251_length:56_mod0001 -M_T0_RID507_S0_NZ_JBDYRX010000002.1:311911-312021_length:111_mod0000 -M_T0_RID508_S1_NC_028382.1:618-664_length:47_mod0000 -M_T0_RID509_S0_NZ_JBDYRX010000002.1:83623-83710_length:88_mod0000 -M_T0_RID509_S0_NZ_JBDYSJ010000002.1:32694-32813_length:120_mod0000 -M_T0_RID512_S0_NC_031301.1:7499-7600_length:102_mod0000 -M_T0_RID512_S0_NZ_JBDYSJ010000001.1:497297-497384_length:88_mod0001 -M_T0_RID512_S1_NC_023299.1:173-222_length:50_mod0000 -M_T0_RID514_S0_NC_028144.1:1039-1130_length:92_mod0000 -M_T0_RID515_S1_NC_028239.1:1870-1935_length:66_mod0000 -M_T0_RID516_S0_NC_028099.1:69736-69811_length:76_mod0000 -M_T0_RID518_S0_NZ_JBDYSJ010000002.1:172879-172954_length:76_mod0000 -M_T0_RID518_S1_NC_028374.1:22488-22593_length:106_mod0000 -M_T0_RID519_S0_NZ_JBDYSJ010000004.1:83804-83909_length:106_mod0000 -M_T0_RID519_S1_NC_023442.1:37132-37228_length:97_mod0000 -M_T0_RID520_S1_NC_033821.1:5336-5462_length:127_mod0000 -M_T0_RID521_S1_NC_028362.1:8323-8409_length:87_mod0000 -M_T0_RID521_S1_NC_033620.1:165922-166009_length:88_mod0000 -M_T0_RID526_S0_NZ_JBDYLZ010000008.1:191196-191301_length:106_mod0000 -M_T0_RID527_S0_NZ_JBDYRX010000001.1:664374-664450_length:77_mod0000 -M_T0_RID530_S1_NC_029255.1:118676-118738_length:63_mod0000 -M_T0_RID531_S0_NC_030240.1:18050-18083_length:34_mod0000 -M_T0_RID535_S0_NZ_JBDYRX010000003.1:273784-273814_length:31_mod0000 -M_T0_RID535_S0_NZ_JBDYSJ010000001.1:408974-409045_length:72_mod0000 -M_T0_RID536_S1_NZ_JBDYLZ010000007.1:187492-187559_length:68_mod0001 -M_T0_RID537_S0_NC_031106.1:5925-5990_length:66_mod0000 -M_T0_RID539_S0_NC_023442.1:25605-25715_length:111_mod0000 -M_T0_RID539_S0_NC_030922.1:6177-6250_length:74_mod0000 -M_T0_RID539_S1_NC_033732.1:488-545_length:58_mod0000 -M_T0_RID539_S1_NZ_JBDYRX010000003.1:428710-428748_length:39_mod0000 -M_T0_RID540_S1_NC_028636.1:8122-8203_length:82_mod0000 -M_T0_RID540_S1_NC_033777.1:478-533_length:56_mod0000 -M_T0_RID541_S0_NZ_JBDYLZ010000009.1:17788-17882_length:95_mod0000 -M_T0_RID543_S0_NZ_JBDYLZ010000006.1:137222-137319_length:98_mod0000 -M_T0_RID545_S1_NC_033620.1:141319-141407_length:89_mod0000 -M_T0_RID547_S0_NC_029901.1:2272-2382_length:111_mod0000 -M_T0_RID548_S0_NC_027916.2:50899-50962_length:64_mod0000 -M_T0_RID549_S0_NZ_JBDYRX010000003.1:184280-184329_length:50_mod0000 -M_T0_RID549_S1_NC_027016.1:166476-166540_length:65_mod0001 -M_T0_RID552_S0_NC_031244.1:259-371_length:113_mod0000 -M_T0_RID552_S1_NZ_JBDYSJ010000001.1:904809-904898_length:90_mod0000 -M_T0_RID555_S0_NC_029255.1:86976-87025_length:50_mod0000 -M_T0_RID555_S0_NC_033700.1:23881-23958_length:78_mod0000 -M_T0_RID555_S1_NZ_JBDYSJ010000003.1:459317-459387_length:71_mod0000 -M_T0_RID556_S0_NC_029800.1:2415-2467_length:53_mod0000 -M_T0_RID556_S0_NZ_JBDYRX010000003.1:269557-269627_length:71_mod0000 -M_T0_RID556_S1_NC_018151.1:436-524_length:89_mod0000 -M_T0_RID556_S1_NC_029997.2:2602-2635_length:34_mod0000 -M_T0_RID560_S0_NC_030691.1:8709-8769_length:61_mod0000 -M_T0_RID563_S0_NZ_JBDYSJ010000001.1:279557-279665_length:109_mod0000 -M_T0_RID563_S1_NC_029255.1:16285-16387_length:103_mod0000 -M_T0_RID563_S1_NC_030651.1:8044-8106_length:63_mod0000 -M_T0_RID564_S1_NC_030380.1:905-947_length:43_mod0000 -M_T0_RID566_S0_NZ_JBDYRX010000002.1:228758-228796_length:39_mod0000 -M_T0_RID566_S1_NC_027916.2:158878-158953_length:76_mod0000 -M_T0_RID568_S0_NC_033718.1:5028-5099_length:72_mod0000 -M_T0_RID569_S1_NZ_JBDYSJ010000002.1:4445-4500_length:56_mod0000 -M_T0_RID571_S1_NC_030200.1:53402-53457_length:56_mod0000 -M_T0_RID571_S1_NC_031291.1:6265-6343_length:79_mod0000 -M_T0_RID573_S0_NZ_JBDYSJ010000001.1:821929-821988_length:60_mod0000 -M_T0_RID573_S1_NZ_JBDYRX010000002.1:420333-420420_length:88_mod0000 -M_T0_RID578_S0_NC_028389.1:883-929_length:47_mod0000 -M_T0_RID578_S1_NC_027920.1:2737-2802_length:66_mod0000 -M_T0_RID578_S1_NZ_JBDYRX010000001.1:125147-125264_length:118_mod0000 -M_T0_RID579_S1_NC_028636.1:80919-81006_length:88_mod0000 -M_T0_RID579_S1_NZ_JBDYRX010000003.1:600760-600842_length:83_mod0000 -M_T0_RID579_S1_NZ_JBDYSJ010000001.1:621908-622008_length:101_mod0000 -M_T0_RID580_S0_NC_031236.1:9639-9701_length:63_mod0000 -M_T0_RID580_S0_NC_033620.1:115666-115748_length:83_mod0000 -M_T0_RID584_S1_NZ_JBDYRX010000003.1:30143-30232_length:90_mod0000 -M_T0_RID587_S1_NC_030236.1:1921-2018_length:98_mod0000 -M_T0_RID588_S0_NZ_JBDYRX010000004.1:487902-487980_length:79_mod0000 -M_T0_RID592_S0_NZ_JBDYRX010000004.1:290162-290207_length:46_mod0000 -M_T0_RID596_S0_NC_028491.1:22873-22918_length:46_mod0000 -M_T0_RID597_S0_NZ_JBDYRX010000004.1:248380-248414_length:35_mod0000 -M_T0_RID598_S0_NZ_JBDYLZ010000013.1:99135-99225_length:91_mod0000 -M_T0_RID598_S0_NZ_JBDYRX010000004.1:521129-521194_length:66_mod0000 -M_T0_RID598_S1_NC_027781.1:1542-1623_length:82_mod0000 -M_T0_RID598_S1_NC_033828.1:1452-1571_length:120_mod0000 -M_T0_RID599_S0_NZ_JBDYLZ010000018.1:17132-17215_length:84_mod0000 -M_T0_RID601_S1_NZ_JBDYRX010000004.1:64749-64831_length:83_mod0000 -M_T0_RID601_S1_NZ_JBDYSJ010000004.1:72990-73054_length:65_mod0000 -M_T0_RID603_S1_NZ_JBDYRX010000003.1:148174-148218_length:45_mod0000 -M_T0_RID606_S1_NZ_JBDYRX010000004.1:81494-81540_length:47_mod0000 -M_T0_RID608_S1_NZ_JBDYLZ010000006.1:54120-54159_length:40_mod0000 -M_T0_RID608_S1_NZ_JBDYSJ010000003.1:75571-75624_length:54_mod0000 -M_T0_RID609_S0_NZ_JBDYLZ010000017.1:21746-21833_length:88_mod0000 -M_T0_RID610_S1_NZ_JBDYRX010000004.1:416636-416711_length:76_mod0000 -M_T0_RID617_S1_NZ_JBDYLZ010000013.1:81956-82016_length:61_mod0000 -M_T0_RID618_S0_NZ_JBDYRX010000001.1:154047-154079_length:33_mod0000 -M_T0_RID619_S0_NZ_JBDYRX010000001.1:929162-929284_length:123_mod0000 -M_T0_RID620_S1_NZ_JBDYRX010000004.1:231083-231194_length:112_mod0000 -M_T0_RID622_S0_NC_029117.1:1274-1341_length:68_mod0000 -M_T0_RID625_S1_NZ_JBDYRX010000003.1:351246-351297_length:52_mod0000 -M_T0_RID626_S0_NZ_JBDYRX010000003.1:54224-54264_length:41_mod0000 -M_T0_RID627_S1_NZ_JBDYRX010000002.1:425465-425547_length:83_mod0000 -M_T0_RID629_S1_NC_028264.1:4326-4405_length:80_mod0000 -M_T0_RID630_S0_NZ_JBDYSJ010000002.1:388835-388868_length:34_mod0000 -M_T0_RID633_S1_NZ_JBDYRX010000003.1:253941-254012_length:72_mod0000 -M_T0_RID634_S1_NC_033815.1:2695-2865_length:171_mod0000 -M_T0_RID635_S1_NC_033700.1:17426-17511_length:86_mod0000 -M_T0_RID636_S0_NC_029086.1:7004-7042_length:39_mod0000 -M_T0_RID638_S1_NZ_JBDYSJ010000001.1:82298-82352_length:55_mod0000 -M_T0_RID640_S0_NC_033756.1:5658-5786_length:129_mod0001 -M_T0_RID641_S0_NC_027706.1:187-292_length:106_mod0000 -M_T0_RID642_S0_NC_034266.1:154137-154203_length:67_mod0000 -M_T0_RID642_S0_NZ_JBDYRX010000003.1:290122-290229_length:108_mod0000 -M_T0_RID643_S0_NC_017937.1:1077-1164_length:88_mod0000 -M_T0_RID643_S0_NZ_JBDYRX010000002.1:527817-527928_length:112_mod0000 -M_T0_RID645_S0_NC_030799.1:4650-4688_length:39_mod0000 -M_T0_RID645_S1_NZ_JBDYLZ010000008.1:186276-186348_length:73_mod0000 -M_T0_RID651_S1_NC_033733.1:2956-3039_length:84_mod0001 -M_T0_RID651_S1_NZ_JBDYRX010000001.1:479171-479229_length:59_mod0000 -M_T0_RID653_S1_NC_029311.1:77186-77261_length:76_mod0000 -M_T0_RID654_S0_NZ_JBDYSJ010000001.1:904727-904802_length:76_mod0000 -M_T0_RID655_S0_NZ_JBDYSJ010000001.1:482269-482365_length:97_mod0000 -M_T0_RID655_S1_NZ_JBDYRX010000002.1:520330-520420_length:91_mod0000 -M_T0_RID656_S0_NC_028259.1:1542-1591_length:50_mod0000 -M_T0_RID656_S0_NZ_JBDYLZ010000019.1:6097-6185_length:89_mod0000 -M_T0_RID660_S1_NC_034266.1:157401-157477_length:77_mod0000 -M_T0_RID664_S0_NC_027916.2:59946-59993_length:48_mod0000 -M_T0_RID664_S0_NZ_JBDYLZ010000015.1:82686-82741_length:56_mod0000 -M_T0_RID664_S0_NZ_JBDYSJ010000003.1:87421-87503_length:83_mod0000 -M_T0_RID668_S0_NZ_JBDYRX010000004.1:18573-18663_length:91_mod0000 -M_T0_RID670_S0_NC_027920.1:1301-1393_length:93_mod0000 -M_T0_RID673_S1_NC_033703.1:545-616_length:72_mod0000 -M_T0_RID673_S1_NZ_JBDYRX010000001.1:644803-644895_length:93_mod0000 -M_T0_RID679_S0_NZ_JBDYRX010000002.1:605076-605139_length:64_mod0000 -M_T0_RID679_S1_NC_033703.1:1306-1364_length:59_mod0000 -M_T0_RID680_S0_NZ_JBDYRX010000002.1:632837-632879_length:43_mod0000 -M_T0_RID681_S1_NZ_JBDYSJ010000002.1:496144-496188_length:45_mod0000 -M_T0_RID682_S0_NZ_JBDYSJ010000001.1:116469-116509_length:41_mod0000 -M_T0_RID683_S0_NZ_JBDYRX010000001.1:675311-675352_length:42_mod0000 -M_T0_RID683_S0_NZ_JBDYSJ010000004.1:71365-71456_length:92_mod0000 -M_T0_RID683_S1_NC_029255.1:7610-7675_length:66_mod0000 -M_T0_RID686_S0_NC_027429.1:2932-2966_length:35_mod0000 -M_T0_RID686_S1_NC_027923.1:107955-107999_length:45_mod0000 -M_T0_RID686_S1_NC_029132.1:95050-95160_length:111_mod0000 -M_T0_RID689_S1_NZ_JBDYSJ010000004.1:138231-138318_length:88_mod0000 -M_T0_RID691_S1_NC_033710.1:3870-3926_length:57_mod0000 -M_T0_RID692_S1_NC_027531.1:1508-1612_length:105_mod0000 -M_T0_RID695_S0_NC_030200.1:124072-124139_length:68_mod0000 -M_T0_RID697_S0_NC_028921.1:5390-5470_length:81_mod0000 -M_T0_RID699_S0_NC_031083.1:4910-4975_length:66_mod0000 -M_T0_RID699_S1_NZ_JBDYLZ010000010.1:101894-101946_length:53_mod0000 -M_T0_RID700_S1_NZ_JBDYSJ010000001.1:915360-915453_length:94_mod0000 -M_T0_RID702_S1_NC_028099.1:63829-63929_length:101_mod0000 -M_T0_RID706_S0_NC_027210.1:7432-7505_length:74_mod0000 -M_T0_RID707_S1_NZ_JBDYRX010000002.1:367432-367522_length:91_mod0001 -M_T0_RID707_S1_NZ_JBDYSJ010000004.1:260063-260128_length:66_mod0000 -M_T0_RID709_S1_NZ_JBDYRX010000003.1:29327-29484_length:158_mod0000 -M_T0_RID710_S1_NC_033720.1:7987-8089_length:103_mod0000 -M_T0_RID711_S0_NZ_JBDYLZ010000006.1:173182-173278_length:97_mod0000 -M_T0_RID711_S1_NC_033700.1:20537-20567_length:31_mod0000 -M_T0_RID711_S1_NZ_JBDYSJ010000001.1:181184-181271_length:88_mod0000 -M_T0_RID714_S0_NC_037612.1:3005-3122_length:118_mod0000 -M_T0_RID715_S0_NC_027788.1:468-551_length:84_mod0000 -M_T0_RID715_S1_NZ_JBDYLZ010000006.1:219162-219260_length:99_mod0000 -M_T0_RID717_S0_NC_030654.1:1669-1721_length:53_mod0000 -M_T0_RID719_S1_NZ_JBDYSJ010000001.1:826609-826678_length:70_mod0000 -M_T0_RID722_S1_NC_027923.1:41169-41259_length:91_mod0001 -M_T0_RID727_S0_NC_029997.2:28478-28523_length:46_mod0000 -M_T0_RID728_S0_NZ_JBDYRX010000002.1:879157-879230_length:74_mod0000 -M_T0_RID729_S1_NZ_JBDYLZ010000008.1:194207-194253_length:47_mod0000 -M_T0_RID731_S1_NC_030117.1:17286-17318_length:33_mod0000 -M_T0_RID736_S0_NZ_JBDYRX010000001.1:178466-178588_length:123_mod0000 -M_T0_RID737_S0_NC_028491.1:18226-18284_length:59_mod0000 -M_T0_RID739_S1_NZ_JBDYLZ010000011.1:127333-127376_length:44_mod0000 -M_T0_RID743_S0_NC_037573.1:1169-1247_length:79_mod0000 -M_T0_RID747_S1_NZ_JBDYRX010000002.1:430138-430204_length:67_mod0000 -M_T0_RID749_S1_NZ_JBDYRX010000003.1:71924-71986_length:63_mod0000 -M_T0_RID752_S0_NC_031336.1:9006-9046_length:41_mod0000 -M_T0_RID753_S0_NZ_JBDYSJ010000003.1:446526-446575_length:50_mod0000 -M_T0_RID757_S0_NC_028136.1:1312-1355_length:44_mod0000 -M_T0_RID757_S1_NC_027016.1:202899-202969_length:71_mod0000 -M_T0_RID757_S1_NZ_JBDYRX010000004.1:461576-461693_length:118_mod0000 -M_T0_RID759_S1_NC_029691.1:3622-3733_length:112_mod0000 -M_T0_RID763_S1_NC_027916.2:99012-99086_length:75_mod0000 -M_T0_RID763_S1_NC_028265.1:10302-10344_length:43_mod0000 -M_T0_RID763_S1_NC_030798.1:7132-7233_length:102_mod0000 -M_T0_RID763_S1_NZ_JBDYLZ010000015.1:37189-37249_length:61_mod0000 -M_T0_RID765_S0_NC_028261.1:4356-4443_length:88_mod0000 -M_T0_RID767_S1_NC_027916.2:86943-87045_length:103_mod0000 -M_T0_RID768_S0_NC_028491.1:2854-2933_length:80_mod0000 -M_T0_RID768_S0_NC_030200.1:40203-40312_length:110_mod0000 -M_T0_RID771_S0_NZ_JBDYLZ010000019.1:13804-13871_length:68_mod0000 -M_T0_RID778_S1_NC_031275.1:5153-5201_length:49_mod0000 -M_T0_RID781_S1_NZ_JBDYRX010000003.1:540287-540355_length:69_mod0000 -M_T0_RID783_S1_NZ_JBDYLZ010000010.1:89260-89349_length:90_mod0000 -M_T0_RID785_S1_NC_027199.1:11719-11818_length:100_mod0000 -M_T0_RID786_S1_NZ_JBDYLZ010000008.1:173777-173859_length:83_mod0000 -M_T0_RID788_S0_NC_030922.1:1394-1483_length:90_mod0000 -M_T0_RID793_S0_NZ_JBDYRX010000003.1:539904-539954_length:51_mod0001 -M_T0_RID797_S1_NZ_JBDYRX010000004.1:414620-414694_length:75_mod0000 -M_T0_RID807_S1_NC_030117.1:45331-45378_length:48_mod0000 -M_T0_RID810_S0_NC_028491.1:85062-85136_length:75_mod0001 -M_T0_RID811_S1_NC_030697.1:295-351_length:57_mod0000 -M_T0_RID813_S1_NC_027016.1:91244-91325_length:82_mod0000 -M_T0_RID817_S1_NC_030240.1:108663-108730_length:68_mod0001 -M_T0_RID823_S0_NC_033620.1:158427-158465_length:39_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000003.1:241332-241406_length:75_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000004.1:228843-228928_length:86_mod0000 -M_T0_RID827_S0_NZ_JBDYSJ010000004.1:239871-239973_length:103_mod0000 -M_T0_RID832_S0_NZ_JBDYLZ010000015.1:88774-88854_length:81_mod0000 -M_T0_RID833_S0_NZ_JBDYSJ010000001.1:590978-591039_length:62_mod0000 -M_T0_RID837_S1_NZ_JBDYRX010000001.1:656888-656964_length:77_mod0000 -M_T0_RID840_S0_NC_028396.1:529-621_length:93_mod0000 -M_T0_RID844_S1_NZ_JBDYLZ010000007.1:237741-237786_length:46_mod0000 -M_T0_RID847_S0_NZ_JBDYRX010000003.1:703429-703507_length:79_mod0000 -M_T0_RID852_S0_NC_030240.1:105292-105367_length:76_mod0000 -M_T0_RID856_S0_NZ_JBDYRX010000003.1:28070-28132_length:63_mod0000 -M_T0_RID856_S1_NC_027644.1:3712-3804_length:93_mod0000 -M_T0_RID858_S0_NZ_JBDYSJ010000003.1:197400-197485_length:86_mod0000 -M_T0_RID858_S1_NZ_JBDYSJ010000004.1:175908-175948_length:41_mod0000 -M_T0_RID859_S0_NC_033777.1:2010-2066_length:57_mod0000 -M_T0_RID862_S1_NC_030799.1:1806-1881_length:76_mod0000 -M_T0_RID865_S1_NZ_JBDYSJ010000002.1:326035-326087_length:53_mod0000 -M_T0_RID873_S1_NC_028119.1:2502-2583_length:82_mod0000 -M_T0_RID880_S0_NC_033620.1:55069-55148_length:80_mod0000 -M_T0_RID882_S0_NZ_JBDYRX010000002.1:484332-484416_length:85_mod0000 -M_T0_RID882_S1_NC_034266.1:103121-103153_length:33_mod0000 -M_T0_RID885_S0_NZ_JBDYRX010000003.1:244205-244252_length:48_mod0000 -M_T0_RID885_S1_NC_036636.1:5051-5143_length:93_mod0000 -M_T0_RID887_S0_NC_029132.1:58239-58309_length:71_mod0000 -M_T0_RID895_S1_NZ_JBDYRX010000004.1:290403-290535_length:133_mod0000 -M_T0_RID900_S0_NZ_JBDYRX010000003.1:442650-442708_length:59_mod0000 -M_T0_RID903_S0_NC_029994.1:1129-1161_length:33_mod0000 -M_T0_RID910_S1_NC_030801.1:531-591_length:61_mod0000 -M_T0_RID913_S1_NZ_JBDYSJ010000001.1:289314-289350_length:37_mod0000 -M_T0_RID923_S1_NC_028374.1:1835-1919_length:85_mod0000 -M_T0_RID930_S0_NC_033727.1:5848-5935_length:88_mod0000 -M_T0_RID941_S0_NZ_JBDYLZ010000020.1:17961-18008_length:48_mod0000 -M_T0_RID951_S0_NZ_JBDYLZ010000007.1:258088-258169_length:82_mod0000 -M_T0_RID960_S1_NZ_JBDYRX010000001.1:365497-365549_length:53_mod0000 -M_T0_RID963_S0_NZ_JBDYSJ010000002.1:471116-471242_length:127_mod0000 -M_T0_RID967_S0_NC_028145.1:2423-2491_length:69_mod0000 -M_T0_RID969_S1_NC_027917.1:3392-3477_length:86_mod0000 -M_T0_RID973_S1_NC_028243.1:233-298_length:66_mod0000 -M_T0_RID975_S0_NZ_JBDYLZ010000006.1:262785-262833_length:49_mod0000 -M_T0_RID977_S0_NC_029311.1:110890-110930_length:41_mod0000 -M_T0_RID978_S1_NC_033707.1:4471-4569_length:99_mod0000 -M_T0_RID978_S1_NZ_JBDYLZ010000011.1:12262-12308_length:47_mod0000 -M_T0_RID987_S1_NZ_JBDYRX010000002.1:268856-268924_length:69_mod0000 -M_T0_RID993_S0_NZ_JBDYSJ010000002.1:495946-496025_length:80_mod0000 -M_T0_RID997_S0_NC_029303.1:1692-1771_length:80_mod0000 -M_T0_RID1003_S0_NZ_JBDYSJ010000001.1:678727-678783_length:57_mod0000 -M_T0_RID1022_S1_NC_030746.1:3635-3726_length:92_mod0000 -M_T0_RID1023_S1_NZ_JBDYLZ010000006.1:264893-265013_length:121_mod0000 -M_T0_RID1048_S0_NZ_JBDYLZ010000008.1:126930-127042_length:113_mod0000 -M_T0_RID1070_S0_NZ_JBDYRX010000003.1:112054-112158_length:105_mod0000 diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/expected/temp/reads/prefilter/merge/Lib_LVsim1_collapsed.read_ids b/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/expected/temp/reads/prefilter/merge/Lib_LVsim1_collapsed.read_ids deleted file mode 100644 index fa544d4..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/expected/temp/reads/prefilter/merge/Lib_LVsim1_collapsed.read_ids +++ /dev/null @@ -1,1300 +0,0 @@ -M_T0_RID0_S0_NC_030117.1:111953-112007_length:55_mod0000 -M_T0_RID0_S0_NZ_JBDYLZ010000006.1:232651-232713_length:63_mod0000 -M_T0_RID0_S0_NZ_JBDYRX010000003.1:638778-638845_length:68_mod0000 -M_T0_RID0_S0_NZ_JBDYSJ010000001.1:480453-480521_length:69_mod0000 -M_T0_RID0_S1_NC_029996.1:52049-52114_length:66_mod0000 -M_T0_RID0_S1_NC_029997.2:98154-98247_length:94_mod0001 -M_T0_RID0_S1_NC_033619.1:5054-5125_length:72_mod0000 -M_T0_RID1_S0_NZ_JBDYLZ010000006.1:89475-89546_length:72_mod0000 -M_T0_RID2_S0_NC_030240.1:124812-124864_length:53_mod0000 -M_T0_RID2_S0_NZ_JBDYLZ010000014.1:79367-79450_length:84_mod0000 -M_T0_RID2_S1_NC_029132.1:78897-78961_length:65_mod0000 -M_T0_RID3_S1_NC_029996.1:125237-125310_length:74_mod0000 -M_T0_RID3_S1_NC_030229.1:666-744_length:79_mod0000 -M_T0_RID4_S0_NZ_JBDYRX010000001.1:960749-960798_length:50_mod0000 -M_T0_RID4_S1_NZ_JBDYSJ010000003.1:80602-80671_length:70_mod0000 -M_T0_RID5_S0_NC_028371.1:3473-3533_length:61_mod0000 -M_T0_RID5_S0_NZ_JBDYLZ010000014.1:31093-31169_length:77_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000003.1:463476-463555_length:80_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000004.1:91279-91382_length:104_mod0000 -M_T0_RID5_S1_NC_031272.1:12737-12796_length:60_mod0000 -M_T0_RID5_S1_NZ_JBDYSJ010000001.1:152930-152976_length:47_mod0000 -M_T0_RID6_S0_NC_018093.1:1833-1947_length:115_mod0000 -M_T0_RID6_S1_NZ_JBDYSJ010000001.1:525478-525555_length:78_mod0000 -M_T0_RID7_S0_NC_027121.1:14835-14908_length:74_mod0000 -M_T0_RID7_S0_NC_030117.1:123232-123357_length:126_mod0000 -M_T0_RID7_S0_NC_033733.1:1775-1866_length:92_mod0000 -M_T0_RID7_S0_NC_033757.1:335-408_length:74_mod0000 -M_T0_RID7_S0_NC_033816.1:2121-2169_length:49_mod0000 -M_T0_RID7_S0_NZ_JBDYRX010000001.1:768041-768147_length:107_mod0000 -M_T0_RID7_S1_NZ_JBDYRX010000003.1:741729-741847_length:119_mod0000 -M_T0_RID8_S0_NC_028255.1:2339-2453_length:115_mod0000 -M_T0_RID8_S0_NC_028362.1:3644-3681_length:38_mod0000 -M_T0_RID8_S0_NC_030295.1:5058-5146_length:89_mod0000 -M_T0_RID8_S0_NZ_JBDYLZ010000011.1:65064-65142_length:79_mod0000 -M_T0_RID8_S1_NC_029996.1:15385-15439_length:55_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000001.1:372140-372170_length:31_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000002.1:184902-185028_length:127_mod0000 -M_T0_RID9_S0_NC_018175.1:751-814_length:64_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000001.1:128705-128756_length:52_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000003.1:717567-717638_length:72_mod0000 -M_T0_RID9_S1_NZ_JBDYRX010000001.1:708791-708875_length:85_mod0001 -M_T0_RID10_S1_NC_034266.1:180760-180821_length:62_mod0000 -M_T0_RID11_S0_NC_027126.1:6629-6712_length:84_mod0000 -M_T0_RID11_S0_NC_027426.1:3579-3717_length:139_mod0000 -M_T0_RID11_S1_NC_030117.1:3968-4065_length:98_mod0000 -M_T0_RID12_S0_NC_027016.1:206020-206105_length:86_mod0000 -M_T0_RID13_S0_NC_027915.1:11194-11270_length:77_mod0000 -M_T0_RID13_S1_NZ_JBDYLZ010000012.1:21748-21797_length:50_mod0000 -M_T0_RID13_S1_NZ_JBDYSJ010000002.1:219548-219618_length:71_mod0000 -M_T0_RID14_S0_NC_033816.1:7896-7995_length:100_mod0000 -M_T0_RID14_S0_NZ_JBDYRX010000001.1:272205-272307_length:103_mod0000 -M_T0_RID14_S0_NZ_JBDYSJ010000001.1:204692-204745_length:54_mod0000 -M_T0_RID14_S1_NC_031321.1:1201-1285_length:85_mod0000 -M_T0_RID14_S1_NC_034217.1:1799-1845_length:47_mod0000 -M_T0_RID15_S0_NZ_JBDYSJ010000001.1:485204-485240_length:37_mod0001 -M_T0_RID15_S1_NC_023442.1:20190-20253_length:64_mod0001 -M_T0_RID15_S1_NC_028259.1:6855-6912_length:58_mod0000 -M_T0_RID15_S1_NZ_JBDYLZ010000014.1:31347-31473_length:127_mod0000 -M_T0_RID16_S0_NC_033718.1:9155-9282_length:128_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000014.1:112132-112219_length:88_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000018.1:30565-30632_length:68_mod0001 -M_T0_RID17_S1_NC_030658.1:888-970_length:83_mod0001 -M_T0_RID17_S1_NC_030873.1:769-848_length:80_mod0000 -M_T0_RID17_S1_NZ_JBDYRX010000004.1:479027-479133_length:107_mod0000 -M_T0_RID17_S1_NZ_JBDYSJ010000002.1:142153-142239_length:87_mod0000 -M_T0_RID18_S0_NC_033830.1:429-498_length:70_mod0000 -M_T0_RID18_S1_NC_027429.1:4469-4544_length:76_mod0000 -M_T0_RID19_S0_NC_028491.1:2563-2618_length:56_mod0000 -M_T0_RID19_S0_NC_031227.1:5693-5751_length:59_mod0000 -M_T0_RID20_S1_NC_029562.1:5000-5036_length:37_mod0000 -M_T0_RID20_S1_NZ_JBDYSJ010000004.1:235888-235979_length:92_mod0000 -M_T0_RID21_S0_NC_028242.1:2691-2737_length:47_mod0000 -M_T0_RID21_S0_NC_029052.1:6412-6494_length:83_mod0000 -M_T0_RID21_S0_NZ_JBDYSJ010000002.1:218541-218623_length:83_mod0000 -M_T0_RID21_S1_NZ_JBDYLZ010000006.1:140228-140329_length:102_mod0000 -M_T0_RID21_S1_NZ_JBDYRX010000001.1:693665-693710_length:46_mod0000 -M_T0_RID22_S0_NC_030402.1:754-835_length:82_mod0000 -M_T0_RID22_S0_NC_034216.1:12941-13048_length:108_mod0000 -M_T0_RID22_S1_NZ_JBDYRX010000001.1:435105-435213_length:109_mod0000 -M_T0_RID23_S0_NC_030701.1:5103-5151_length:49_mod0000 -M_T0_RID23_S0_NC_033762.1:10-98_length:89_mod0000 -M_T0_RID23_S0_NC_037617.1:942-1060_length:119_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000002.1:499806-499888_length:83_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000004.1:201196-201277_length:82_mod0000 -M_T0_RID23_S1_NC_031275.1:7710-7771_length:62_mod0000 -M_T0_RID24_S0_NC_030240.1:57723-57766_length:44_mod0000 -M_T0_RID24_S0_NZ_JBDYLZ010000012.1:969-1002_length:34_mod0000 -M_T0_RID24_S0_NZ_JBDYRX010000001.1:197011-197061_length:51_mod0000 -M_T0_RID24_S1_NC_027121.1:8433-8469_length:37_mod0000 -M_T0_RID24_S1_NZ_JBDYRX010000001.1:668610-668664_length:55_mod0000 -M_T0_RID25_S0_NZ_JBDYSJ010000002.1:6311-6403_length:93_mod0000 -M_T0_RID25_S1_NC_029997.2:85189-85282_length:94_mod0000 -M_T0_RID25_S1_NC_034384.1:2318-2377_length:60_mod0000 -M_T0_RID25_S1_NZ_JBDYRX010000002.1:614807-614869_length:63_mod0000 -M_T0_RID25_S1_NZ_JBDYSJ010000004.1:88035-88153_length:119_mod0000 -M_T0_RID26_S0_NC_028491.1:86460-86530_length:71_mod0000 -M_T0_RID26_S0_NZ_JBDYSJ010000003.1:64065-64167_length:103_mod0000 -M_T0_RID26_S1_NZ_JBDYSJ010000002.1:180789-180849_length:61_mod0001 -M_T0_RID27_S0_NZ_JBDYRX010000002.1:879317-879417_length:101_mod0001 -M_T0_RID27_S0_NZ_JBDYSJ010000002.1:371147-371261_length:115_mod0000 -M_T0_RID27_S1_NC_024911.1:1404-1530_length:127_mod0000 -M_T0_RID27_S1_NC_034266.1:112117-112169_length:53_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000003.1:302019-302061_length:43_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000004.1:327071-327150_length:80_mod0001 -M_T0_RID28_S0_NC_027812.1:1778-1877_length:100_mod0000 -M_T0_RID28_S0_NC_028833.1:23931-24017_length:87_mod0000 -M_T0_RID28_S0_NC_034159.1:870-906_length:37_mod0000 -M_T0_RID28_S0_NZ_JBDYSJ010000003.1:260828-260864_length:37_mod0000 -M_T0_RID29_S0_NC_027137.1:5905-5940_length:36_mod0000 -M_T0_RID29_S0_NC_027208.1:2702-2783_length:82_mod0000 -M_T0_RID29_S0_NC_029996.1:60558-60653_length:96_mod0000 -M_T0_RID29_S0_NC_033722.1:167-248_length:82_mod0000 -M_T0_RID30_S0_NC_017977.1:8983-9015_length:33_mod0000 -M_T0_RID30_S0_NC_034219.1:4140-4199_length:60_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000001.1:753768-753819_length:52_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000002.1:441798-441831_length:34_mod0000 -M_T0_RID30_S0_NZ_JBDYSJ010000001.1:878513-878614_length:102_mod0000 -M_T0_RID30_S1_NC_028492.1:144-210_length:67_mod0000 -M_T0_RID30_S1_NZ_JBDYRX010000004.1:168829-168933_length:105_mod0000 -M_T0_RID30_S1_NZ_JBDYSJ010000002.1:584020-584104_length:85_mod0000 -M_T0_RID31_S0_NZ_JBDYSJ010000002.1:273852-273897_length:46_mod0000 -M_T0_RID31_S1_NC_031450.1:2281-2311_length:31_mod0000 -M_T0_RID31_S1_NZ_JBDYSJ010000002.1:454313-454400_length:88_mod0000 -M_T0_RID32_S0_NC_023442.1:31719-31785_length:67_mod0000 -M_T0_RID32_S1_NC_028133.1:1439-1562_length:124_mod0000 -M_T0_RID32_S1_NZ_JBDYSJ010000002.1:412312-412351_length:40_mod0000 -M_T0_RID33_S1_NC_034266.1:78437-78516_length:80_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000001.1:102672-102747_length:76_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000002.1:784464-784511_length:48_mod0000 -M_T0_RID33_S1_NZ_JBDYSJ010000003.1:324967-325032_length:66_mod0000 -M_T0_RID34_S0_NC_018457.1:737-780_length:44_mod0000 -M_T0_RID34_S0_NC_028253.1:2464-2519_length:56_mod0000 -M_T0_RID34_S0_NZ_JBDYRX010000003.1:19821-19946_length:126_mod0000 -M_T0_RID34_S1_NC_029255.1:103099-103196_length:98_mod0000 -M_T0_RID34_S1_NZ_JBDYRX010000001.1:214312-214398_length:87_mod0001 -M_T0_RID35_S0_NZ_JBDYRX010000001.1:286577-286647_length:71_mod0000 -M_T0_RID35_S0_NZ_JBDYRX010000002.1:303458-303514_length:57_mod0000 -M_T0_RID35_S1_NC_028374.1:16776-16870_length:95_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:363132-363178_length:47_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:829523-829581_length:59_mod0000 -M_T0_RID36_S0_NC_029311.1:99001-99097_length:97_mod0000 -M_T0_RID37_S0_NC_033620.1:94230-94306_length:77_mod0000 -M_T0_RID37_S0_NZ_JBDYLZ010000012.1:26095-26141_length:47_mod0000 -M_T0_RID37_S1_NC_029311.1:32048-32093_length:46_mod0000 -M_T0_RID37_S1_NZ_JBDYSJ010000001.1:902396-902441_length:46_mod0000 -M_T0_RID38_S0_NC_030691.1:6883-6932_length:50_mod0000 -M_T0_RID38_S1_NZ_JBDYRX010000004.1:200501-200575_length:75_mod0000 -M_T0_RID39_S1_NC_028136.1:1274-1340_length:67_mod0000 -M_T0_RID39_S1_NZ_JBDYSJ010000002.1:503066-503117_length:52_mod0000 -M_T0_RID40_S0_NC_030234.1:4344-4414_length:71_mod0000 -M_T0_RID41_S0_NC_031088.1:9201-9299_length:99_mod0000 -M_T0_RID41_S0_NZ_JBDYLZ010000009.1:31815-31852_length:38_mod0000 -M_T0_RID41_S1_NC_028244.1:5988-6042_length:55_mod0000 -M_T0_RID41_S1_NZ_JBDYLZ010000006.1:65238-65362_length:125_mod0000 -M_T0_RID41_S1_NZ_JBDYRX010000003.1:765215-765280_length:66_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:32817-32939_length:123_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:462782-462843_length:62_mod0000 -M_T0_RID43_S0_NZ_JBDYLZ010000008.1:49878-49973_length:96_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000001.1:889979-890062_length:84_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000004.1:406662-406696_length:35_mod0000 -M_T0_RID44_S1_NZ_JBDYLZ010000006.1:90744-90777_length:34_mod0000 -M_T0_RID45_S0_NC_027712.1:10734-10821_length:88_mod0000 -M_T0_RID45_S0_NC_029311.1:44548-44620_length:73_mod0000 -M_T0_RID45_S0_NC_030693.1:5273-5361_length:89_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000008.1:40421-40495_length:75_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000009.1:55082-55112_length:31_mod0000 -M_T0_RID45_S1_NC_028232.1:6596-6658_length:63_mod0000 -M_T0_RID46_S0_NZ_JBDYSJ010000003.1:168383-168513_length:131_mod0000 -M_T0_RID47_S0_NC_029932.1:1175-1250_length:76_mod0000 -M_T0_RID47_S1_NC_027633.1:3344-3412_length:69_mod0000 -M_T0_RID48_S0_NC_018174.1:5223-5261_length:39_mod0000 -M_T0_RID48_S0_NC_023443.1:462-562_length:101_mod0000 -M_T0_RID48_S0_NZ_JBDYRX010000002.1:697197-697270_length:74_mod0000 -M_T0_RID49_S0_NC_029309.1:6196-6271_length:76_mod0000 -M_T0_RID49_S0_NZ_JBDYRX010000002.1:627468-627514_length:47_mod0000 -M_T0_RID49_S1_NC_028375.1:6864-6975_length:112_mod0000 -M_T0_RID50_S0_NC_027634.1:1642-1737_length:96_mod0000 -M_T0_RID50_S0_NC_030117.1:58855-58929_length:75_mod0000 -M_T0_RID50_S0_NC_030397.1:2093-2139_length:47_mod0001 -M_T0_RID50_S0_NZ_JBDYRX010000002.1:579910-579949_length:40_mod0000 -M_T0_RID50_S1_NC_028099.1:106360-106431_length:72_mod0000 -M_T0_RID50_S1_NZ_JBDYLZ010000012.1:83521-83604_length:84_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:803598-803655_length:58_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:945690-945779_length:90_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000006.1:184353-184397_length:45_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000018.1:32304-32360_length:57_mod0000 -M_T0_RID51_S1_NZ_JBDYRX010000001.1:868994-869082_length:89_mod0000 -M_T0_RID51_S1_NZ_JBDYSJ010000003.1:168788-168850_length:63_mod0000 -M_T0_RID52_S0_NZ_JBDYRX010000002.1:889544-889674_length:131_mod0000 -M_T0_RID52_S1_NC_030801.1:2462-2542_length:81_mod0000 -M_T0_RID53_S0_NC_029053.1:3050-3132_length:83_mod0000 -M_T0_RID53_S0_NC_033792.1:955-1008_length:54_mod0000 -M_T0_RID53_S0_NZ_JBDYRX010000003.1:127692-127758_length:67_mod0000 -M_T0_RID53_S1_NC_027533.1:2013-2051_length:39_mod0000 -M_T0_RID53_S1_NC_031307.1:5253-5307_length:55_mod0000 -M_T0_RID54_S0_NC_031079.1:45-96_length:52_mod0000 -M_T0_RID54_S1_NC_027712.1:6686-6777_length:92_mod0000 -M_T0_RID54_S1_NC_029996.1:22662-22724_length:63_mod0000 -M_T0_RID55_S0_NC_030141.1:2102-2247_length:146_mod0000 -M_T0_RID55_S0_NC_031304.1:2692-2762_length:71_mod0000 -M_T0_RID55_S0_NC_033704.1:4049-4166_length:118_mod0000 -M_T0_RID55_S0_NZ_JBDYRX010000001.1:247013-247049_length:37_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:448811-448874_length:64_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:513869-513936_length:68_mod0000 -M_T0_RID56_S0_NC_027016.1:52570-52626_length:57_mod0000 -M_T0_RID56_S0_NC_031449.1:9465-9556_length:92_mod0000 -M_T0_RID56_S0_NZ_JBDYLZ010000007.1:245259-245319_length:61_mod0001 -M_T0_RID56_S1_NZ_JBDYLZ010000007.1:103507-103590_length:84_mod0000 -M_T0_RID57_S0_NC_018070.1:8325-8447_length:123_mod0000 -M_T0_RID57_S0_NC_027426.1:3804-3851_length:48_mod0000 -M_T0_RID57_S1_NC_028099.1:83564-83601_length:38_mod0000 -M_T0_RID58_S0_NC_027121.1:14888-14980_length:93_mod0000 -M_T0_RID58_S0_NC_029550.1:232-272_length:41_mod0000 -M_T0_RID58_S1_NZ_JBDYLZ010000015.1:60370-60453_length:84_mod0000 -M_T0_RID59_S0_NZ_JBDYLZ010000011.1:108912-108996_length:85_mod0000 -M_T0_RID59_S0_NZ_JBDYRX010000004.1:15220-15308_length:89_mod0000 -M_T0_RID60_S1_NC_027641.1:1140-1184_length:45_mod0000 -M_T0_RID60_S1_NC_029085.1:8080-8154_length:75_mod0001 -M_T0_RID60_S1_NZ_JBDYRX010000001.1:262196-262266_length:71_mod0000 -M_T0_RID60_S1_NZ_JBDYSJ010000002.1:87924-88000_length:77_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:191465-191498_length:34_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:569149-569214_length:66_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000003.1:457685-457761_length:77_mod0000 -M_T0_RID62_S0_NC_023303.1:251-301_length:51_mod0000 -M_T0_RID62_S0_NZ_JBDYRX010000001.1:304278-304333_length:56_mod0000 -M_T0_RID62_S1_NC_023427.1:835-900_length:66_mod0000 -M_T0_RID62_S1_NC_027016.1:54356-54406_length:51_mod0000 -M_T0_RID62_S1_NC_028133.1:2961-2996_length:36_mod0000 -M_T0_RID62_S1_NC_031083.1:3710-3834_length:125_mod0000 -M_T0_RID62_S1_NC_031463.1:8948-8994_length:47_mod0000 -M_T0_RID62_S1_NZ_JBDYRX010000003.1:182597-182668_length:72_mod0001 -M_T0_RID62_S1_NZ_JBDYSJ010000001.1:192588-192667_length:80_mod0001 -M_T0_RID63_S0_NC_028144.1:6011-6113_length:103_mod0000 -M_T0_RID63_S0_NC_030240.1:102727-102785_length:59_mod0000 -M_T0_RID63_S0_NC_033760.1:1443-1573_length:131_mod0000 -M_T0_RID63_S0_NZ_JBDYLZ010000020.1:7118-7208_length:91_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000002.1:745773-745875_length:103_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000003.1:142067-142124_length:58_mod0000 -M_T0_RID63_S0_NZ_JBDYSJ010000003.1:151524-151569_length:46_mod0000 -M_T0_RID63_S1_NC_031236.1:11052-11140_length:89_mod0001 -M_T0_RID64_S0_NC_030748.1:1054-1124_length:71_mod0000 -M_T0_RID64_S1_NC_031093.1:6116-6176_length:61_mod0000 -M_T0_RID66_S0_NZ_JBDYLZ010000015.1:96499-96580_length:82_mod0000 -M_T0_RID66_S0_NZ_JBDYSJ010000002.1:346193-346225_length:33_mod0000 -M_T0_RID66_S1_NC_031305.1:4622-4714_length:93_mod0000 -M_T0_RID66_S1_NZ_JBDYRX010000002.1:340389-340472_length:84_mod0000 -M_T0_RID67_S0_NC_028134.1:42-92_length:51_mod0000 -M_T0_RID67_S0_NC_030447.1:1980-2070_length:91_mod0000 -M_T0_RID67_S0_NZ_JBDYRX010000004.1:332043-332120_length:78_mod0000 -M_T0_RID67_S0_NZ_JBDYSJ010000003.1:241049-241147_length:99_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000001.1:247375-247406_length:32_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000002.1:355091-355166_length:76_mod0000 -M_T0_RID68_S1_NC_034266.1:8834-8941_length:108_mod0000 -M_T0_RID68_S1_NZ_JBDYLZ010000016.1:69565-69646_length:82_mod0000 -M_T0_RID69_S0_NC_028368.1:19515-19575_length:61_mod0000 -M_T0_RID69_S0_NC_034266.1:30444-30515_length:72_mod0000 -M_T0_RID69_S0_NZ_JBDYLZ010000013.1:100003-100090_length:88_mod0000 -M_T0_RID69_S1_NZ_JBDYLZ010000016.1:63861-63942_length:82_mod0000 -M_T0_RID70_S0_NC_018404.1:2315-2374_length:60_mod0000 -M_T0_RID70_S1_NC_027713.1:293-401_length:109_mod0000 -M_T0_RID70_S1_NC_033830.1:3068-3146_length:79_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000007.1:118774-118860_length:87_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000016.1:66813-66865_length:53_mod0000 -M_T0_RID71_S0_NC_033620.1:14671-14724_length:54_mod0000 -M_T0_RID71_S1_NC_029562.1:2435-2497_length:63_mod0000 -M_T0_RID72_S0_NC_033716.1:7859-7951_length:93_mod0000 -M_T0_RID72_S1_NC_030117.1:83819-83856_length:38_mod0000 -M_T0_RID72_S1_NZ_JBDYLZ010000008.1:123604-123689_length:86_mod0000 -M_T0_RID73_S0_NC_030115.1:6022-6140_length:119_mod0000 -M_T0_RID73_S0_NC_030229.1:2674-2768_length:95_mod0000 -M_T0_RID73_S0_NC_033733.1:4354-4441_length:88_mod0001 -M_T0_RID74_S0_NC_031093.1:8592-8666_length:75_mod0000 -M_T0_RID74_S0_NZ_JBDYSJ010000002.1:362489-362559_length:71_mod0000 -M_T0_RID74_S1_NC_029302.1:212-295_length:84_mod0000 -M_T0_RID75_S0_NZ_JBDYRX010000001.1:235615-235682_length:68_mod0000 -M_T0_RID75_S1_NC_030235.1:6658-6691_length:34_mod0000 -M_T0_RID75_S1_NZ_JBDYLZ010000022.1:8709-8767_length:59_mod0000 -M_T0_RID75_S1_NZ_JBDYRX010000003.1:478660-478720_length:61_mod0000 -M_T0_RID76_S0_NC_018070.1:8778-8882_length:105_mod0000 -M_T0_RID76_S0_NC_029255.1:61305-61383_length:79_mod0000 -M_T0_RID76_S1_NC_027428.1:2290-2358_length:69_mod0000 -M_T0_RID76_S1_NC_030200.1:88040-88083_length:44_mod0000 -M_T0_RID76_S1_NC_033720.1:158-194_length:37_mod0000 -M_T0_RID77_S1_NC_033730.1:7657-7785_length:129_mod0000 -M_T0_RID78_S0_NC_023442.1:36825-36879_length:55_mod0000 -M_T0_RID78_S0_NC_027016.1:111926-112014_length:89_mod0000 -M_T0_RID78_S0_NZ_JBDYRX010000003.1:310444-310522_length:79_mod0000 -M_T0_RID78_S1_NC_030871.1:4415-4481_length:67_mod0000 -M_T0_RID78_S1_NC_031220.1:5976-6009_length:34_mod0000 -M_T0_RID79_S0_NC_029997.2:83992-84041_length:50_mod0000 -M_T0_RID79_S0_NC_030240.1:97988-98049_length:62_mod0000 -M_T0_RID79_S1_NC_033792.1:2479-2556_length:78_mod0000 -M_T0_RID79_S1_NZ_JBDYRX010000003.1:341785-341851_length:67_mod0001 -M_T0_RID80_S1_NZ_JBDYLZ010000010.1:13735-13769_length:35_mod0000 -M_T0_RID80_S1_NZ_JBDYSJ010000001.1:511944-512037_length:94_mod0000 -M_T0_RID81_S1_NC_027923.1:15413-15450_length:38_mod0000 -M_T0_RID82_S0_NC_027916.2:67438-67522_length:85_mod0001 -M_T0_RID82_S0_NC_028398.1:2368-2442_length:75_mod0000 -M_T0_RID82_S0_NC_033779.1:2219-2288_length:70_mod0000 -M_T0_RID82_S0_NZ_JBDYLZ010000016.1:9019-9115_length:97_mod0000 -M_T0_RID82_S0_NZ_JBDYRX010000001.1:261558-261662_length:105_mod0001 -M_T0_RID82_S1_NC_027016.1:72621-72680_length:60_mod0000 -M_T0_RID82_S1_NC_027535.1:2160-2253_length:94_mod0000 -M_T0_RID83_S1_NC_030159.1:273-312_length:40_mod0000 -M_T0_RID83_S1_NZ_JBDYLZ010000007.1:155539-155585_length:47_mod0000 -M_T0_RID83_S1_NZ_JBDYRX010000002.1:263346-263422_length:77_mod0000 -M_T0_RID84_S0_NZ_JBDYRX010000003.1:240685-240765_length:81_mod0000 -M_T0_RID84_S1_NZ_JBDYRX010000003.1:51637-51745_length:109_mod0000 -M_T0_RID85_S0_NZ_JBDYRX010000002.1:107354-107402_length:49_mod0000 -M_T0_RID85_S1_NC_023297.1:177-263_length:87_mod0000 -M_T0_RID85_S1_NC_030201.1:3764-3811_length:48_mod0000 -M_T0_RID85_S1_NZ_JBDYRX010000002.1:35225-35277_length:53_mod0000 -M_T0_RID86_S1_NC_028137.1:1830-1905_length:76_mod0000 -M_T0_RID86_S1_NC_033828.1:2664-2773_length:110_mod0000 -M_T0_RID86_S1_NZ_JBDYSJ010000001.1:383616-383681_length:66_mod0000 -M_T0_RID87_S0_NC_027631.1:5088-5147_length:60_mod0000 -M_T0_RID87_S0_NZ_JBDYLZ010000008.1:117199-117277_length:79_mod0000 -M_T0_RID87_S1_NZ_JBDYRX010000002.1:176453-176540_length:88_mod0000 -M_T0_RID89_S0_NC_028814.1:25832-25905_length:74_mod0000 -M_T0_RID89_S0_NZ_JBDYLZ010000010.1:109306-109408_length:103_mod0000 -M_T0_RID89_S1_NC_029064.1:9889-9971_length:83_mod0000 -M_T0_RID91_S0_NC_029997.2:19677-19742_length:66_mod0000 -M_T0_RID91_S0_NZ_JBDYSJ010000002.1:541980-542048_length:69_mod0001 -M_T0_RID91_S1_NC_028636.1:131522-131574_length:53_mod0000 -M_T0_RID91_S1_NZ_JBDYLZ010000015.1:73113-73211_length:99_mod0000 -M_T0_RID91_S1_NZ_JBDYRX010000002.1:531098-531224_length:127_mod0000 -M_T0_RID91_S1_NZ_JBDYSJ010000001.1:75425-75512_length:88_mod0000 -M_T0_RID92_S0_NC_033847.1:907-971_length:65_mod0001 -M_T0_RID92_S0_NZ_JBDYRX010000001.1:204153-204204_length:52_mod0000 -M_T0_RID93_S0_NC_029131.1:6029-6095_length:67_mod0000 -M_T0_RID93_S1_NZ_JBDYRX010000002.1:30248-30359_length:112_mod0000 -M_T0_RID94_S0_NC_028142.1:627-700_length:74_mod0000 -M_T0_RID94_S0_NC_033702.1:1317-1400_length:84_mod0000 -M_T0_RID94_S0_NC_033717.1:1284-1386_length:103_mod0000 -M_T0_RID95_S0_NC_018072.1:2591-2635_length:45_mod0000 -M_T0_RID95_S0_NC_027136.1:2231-2280_length:50_mod0000 -M_T0_RID95_S0_NC_029996.1:90789-90865_length:77_mod0000 -M_T0_RID95_S0_NZ_JBDYRX010000002.1:319590-319635_length:46_mod0000 -M_T0_RID95_S1_NC_033620.1:5347-5437_length:91_mod0000 -M_T0_RID96_S0_NC_028636.1:10556-10617_length:62_mod0000 -M_T0_RID96_S1_NC_028143.1:314-390_length:77_mod0000 -M_T0_RID97_S1_NZ_JBDYRX010000001.1:866338-866401_length:64_mod0001 -M_T0_RID97_S1_NZ_JBDYRX010000003.1:178272-178304_length:33_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000013.1:5680-5725_length:46_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000028.1:866-932_length:67_mod0000 -M_T0_RID98_S1_NC_029996.1:10631-10716_length:86_mod0000 -M_T0_RID99_S0_NC_030838.1:2068-2122_length:55_mod0000 -M_T0_RID99_S0_NC_031248.1:3321-3367_length:47_mod0000 -M_T0_RID99_S1_NC_027916.2:30126-30210_length:85_mod0000 -M_T0_RID99_S1_NC_030240.1:40035-40122_length:88_mod0000 -M_T0_RID99_S1_NC_031336.1:14128-14251_length:124_mod0001 -M_T0_RID99_S1_NZ_JBDYSJ010000001.1:396202-396267_length:66_mod0000 -M_T0_RID100_S0_NC_028376.1:14572-14682_length:111_mod0000 -M_T0_RID100_S0_NC_030697.1:970-1055_length:86_mod0000 -M_T0_RID100_S0_NZ_JBDYRX010000002.1:758402-758505_length:104_mod0000 -M_T0_RID101_S0_NZ_JBDYSJ010000001.1:645109-645147_length:39_mod0000 -M_T0_RID102_S0_NC_029255.1:63250-63323_length:74_mod0000 -M_T0_RID102_S0_NZ_JBDYSJ010000001.1:237444-237513_length:70_mod0000 -M_T0_RID103_S0_NC_028476.1:713-824_length:112_mod0000 -M_T0_RID103_S1_NC_031314.1:1276-1385_length:110_mod0000 -M_T0_RID103_S1_NC_031463.1:18479-18581_length:103_mod0000 -M_T0_RID103_S1_NZ_JBDYRX010000003.1:535271-535363_length:93_mod0000 -M_T0_RID105_S0_NC_030118.1:8503-8572_length:70_mod0000 -M_T0_RID105_S1_NC_027712.1:9939-9971_length:33_mod0000 -M_T0_RID105_S1_NC_030472.1:4177-4227_length:51_mod0000 -M_T0_RID106_S1_NC_028382.1:483-531_length:49_mod0000 -M_T0_RID106_S1_NZ_JBDYLZ010000017.1:12627-12692_length:66_mod0000 -M_T0_RID106_S1_NZ_JBDYRX010000001.1:885175-885267_length:93_mod0000 -M_T0_RID106_S1_NZ_JBDYSJ010000001.1:754603-754673_length:71_mod0000 -M_T0_RID107_S0_NZ_JBDYRX010000002.1:887203-887264_length:62_mod0000 -M_T0_RID107_S1_NC_027016.1:87956-88044_length:89_mod0000 -M_T0_RID107_S1_NC_028478.1:299-392_length:94_mod0000 -M_T0_RID107_S1_NZ_JBDYRX010000003.1:166903-166964_length:62_mod0001 -M_T0_RID107_S1_NZ_JBDYSJ010000001.1:252763-252845_length:83_mod0000 -M_T0_RID108_S1_NC_033767.1:689-744_length:56_mod0000 -M_T0_RID108_S1_NZ_JBDYSJ010000003.1:468268-468339_length:72_mod0000 -M_T0_RID109_S0_NZ_JBDYRX010000001.1:988451-988536_length:86_mod0000 -M_T0_RID110_S1_NC_028099.1:36637-36726_length:90_mod0000 -M_T0_RID110_S1_NZ_JBDYLZ010000015.1:71842-71908_length:67_mod0000 -M_T0_RID111_S0_NC_030232.1:3068-3100_length:33_mod0000 -M_T0_RID111_S0_NZ_JBDYRX010000002.1:284375-284457_length:83_mod0000 -M_T0_RID111_S1_NC_028491.1:22651-22727_length:77_mod0000 -M_T0_RID112_S1_NZ_JBDYRX010000004.1:227206-227261_length:56_mod0000 -M_T0_RID112_S1_NZ_JBDYSJ010000003.1:186720-186750_length:31_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000008.1:103905-103950_length:46_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000017.1:43421-43530_length:110_mod0000 -M_T0_RID114_S0_NZ_JBDYSJ010000001.1:888974-889061_length:88_mod0000 -M_T0_RID114_S1_NC_028485.1:4265-4351_length:87_mod0000 -M_T0_RID114_S1_NC_030654.1:5564-5612_length:49_mod0000 -M_T0_RID114_S1_NC_033763.1:670-745_length:76_mod0000 -M_T0_RID114_S1_NZ_JBDYSJ010000001.1:20373-20432_length:60_mod0000 -M_T0_RID115_S0_NC_033781.1:4795-4906_length:112_mod0000 -M_T0_RID115_S1_NC_031236.1:618-674_length:57_mod0000 -M_T0_RID116_S0_NC_028833.1:24900-24930_length:31_mod0000 -M_T0_RID116_S0_NZ_JBDYSJ010000001.1:278209-278280_length:72_mod0000 -M_T0_RID117_S0_NC_028491.1:76819-76945_length:127_mod0000 -M_T0_RID117_S0_NC_028636.1:51360-51406_length:47_mod0000 -M_T0_RID117_S0_NZ_JBDYRX010000002.1:695385-695511_length:127_mod0000 -M_T0_RID117_S0_NZ_JBDYSJ010000004.1:214232-214301_length:70_mod0000 -M_T0_RID117_S1_NZ_JBDYSJ010000001.1:254125-254189_length:65_mod0000 -M_T0_RID118_S1_NC_017967.1:3728-3792_length:65_mod0000 -M_T0_RID118_S1_NZ_JBDYLZ010000012.1:104385-104434_length:50_mod0000 -M_T0_RID118_S1_NZ_JBDYRX010000003.1:569089-569158_length:70_mod0000 -M_T0_RID119_S0_NC_027138.1:1980-2027_length:48_mod0000 -M_T0_RID119_S0_NZ_JBDYRX010000001.1:479636-479698_length:63_mod0000 -M_T0_RID119_S1_NC_030750.1:2333-2363_length:31_mod0000 -M_T0_RID120_S0_NZ_JBDYRX010000004.1:143311-143407_length:97_mod0000 -M_T0_RID120_S0_NZ_JBDYSJ010000002.1:211897-211962_length:66_mod0000 -M_T0_RID120_S1_NC_029255.1:99346-99425_length:80_mod0000 -M_T0_RID120_S1_NZ_JBDYLZ010000008.1:182987-183039_length:53_mod0000 -M_T0_RID121_S1_NZ_JBDYRX010000003.1:22645-22773_length:129_mod0000 -M_T0_RID122_S0_NZ_JBDYSJ010000002.1:28060-28162_length:103_mod0000 -M_T0_RID122_S1_NZ_JBDYRX010000002.1:593335-593394_length:60_mod0000 -M_T0_RID123_S1_NC_029932.1:780-841_length:62_mod0000 -M_T0_RID123_S1_NZ_JBDYRX010000002.1:624572-624628_length:57_mod0000 -M_T0_RID123_S1_NZ_JBDYSJ010000003.1:205052-205133_length:82_mod0000 -M_T0_RID124_S0_NC_018105.1:1032-1078_length:47_mod0000 -M_T0_RID124_S0_NC_027016.1:37306-37377_length:72_mod0000 -M_T0_RID124_S0_NC_027430.1:2075-2124_length:50_mod0000 -M_T0_RID124_S0_NC_033751.1:1175-1283_length:109_mod0000 -M_T0_RID124_S0_NZ_JBDYLZ010000012.1:107683-107735_length:53_mod0000 -M_T0_RID124_S1_NC_029783.1:12839-12935_length:97_mod0000 -M_T0_RID125_S1_NC_024911.1:585-717_length:133_mod0000 -M_T0_RID125_S1_NZ_JBDYRX010000002.1:524061-524121_length:61_mod0000 -M_T0_RID126_S0_NZ_JBDYSJ010000003.1:204369-204435_length:67_mod0000 -M_T0_RID126_S1_NC_027136.1:6692-6786_length:95_mod0000 -M_T0_RID126_S1_NZ_JBDYLZ010000007.1:147969-148026_length:58_mod0000 -M_T0_RID126_S1_NZ_JBDYSJ010000001.1:849768-849826_length:59_mod0000 -M_T0_RID127_S0_NZ_JBDYLZ010000019.1:20624-20673_length:50_mod0000 -M_T0_RID127_S1_NC_033619.1:4029-4155_length:127_mod0000 -M_T0_RID127_S1_NZ_JBDYRX010000004.1:112527-112563_length:37_mod0000 -M_T0_RID128_S0_NC_033620.1:26172-26261_length:90_mod0000 -M_T0_RID128_S0_NZ_JBDYSJ010000001.1:127550-127596_length:47_mod0000 -M_T0_RID128_S1_NZ_JBDYLZ010000010.1:81225-81326_length:102_mod0000 -M_T0_RID129_S0_NC_028372.1:12347-12414_length:68_mod0001 -M_T0_RID129_S0_NC_030844.1:4967-5083_length:117_mod0001 -M_T0_RID129_S1_NZ_JBDYSJ010000001.1:451837-451880_length:44_mod0000 -M_T0_RID130_S0_NZ_JBDYSJ010000001.1:904477-904569_length:93_mod0000 -M_T0_RID130_S1_NC_030400.1:8920-8964_length:45_mod0000 -M_T0_RID131_S0_NC_030200.1:24540-24653_length:114_mod0000 -M_T0_RID131_S0_NZ_JBDYRX010000004.1:307376-307435_length:60_mod0001 -M_T0_RID131_S1_NZ_JBDYRX010000002.1:215925-215981_length:57_mod0000 -M_T0_RID132_S0_NC_029132.1:26524-26609_length:86_mod0000 -M_T0_RID132_S0_NZ_JBDYRX010000002.1:856095-856160_length:66_mod0000 -M_T0_RID132_S1_NC_028099.1:70003-70100_length:98_mod0000 -M_T0_RID132_S1_NC_028636.1:77454-77493_length:40_mod0000 -M_T0_RID133_S0_NC_027210.1:8798-8910_length:113_mod0000 -M_T0_RID133_S1_NZ_JBDYLZ010000014.1:82781-82835_length:55_mod0000 -M_T0_RID134_S0_NC_034266.1:203255-203287_length:33_mod0000 -M_T0_RID134_S1_NC_033705.1:7105-7262_length:158_mod0000 -M_T0_RID135_S0_NC_033733.1:6746-6806_length:61_mod0000 -M_T0_RID135_S1_NZ_JBDYSJ010000004.1:255279-255341_length:63_mod0000 -M_T0_RID136_S0_NZ_JBDYSJ010000001.1:562721-562768_length:48_mod0000 -M_T0_RID136_S1_NC_030200.1:80911-80976_length:66_mod0001 -M_T0_RID136_S1_NZ_JBDYLZ010000009.1:44314-44384_length:71_mod0000 -M_T0_RID136_S1_NZ_JBDYLZ010000018.1:9886-9961_length:76_mod0000 -M_T0_RID136_S1_NZ_JBDYRX010000001.1:825042-825123_length:82_mod0000 -M_T0_RID137_S0_NC_031083.1:11357-11420_length:64_mod0000 -M_T0_RID137_S0_NZ_JBDYSJ010000002.1:311215-311270_length:56_mod0000 -M_T0_RID137_S1_NC_034266.1:15288-15392_length:105_mod0000 -M_T0_RID137_S1_NZ_JBDYSJ010000002.1:109720-109762_length:43_mod0000 -M_T0_RID138_S0_NC_033730.1:4735-4793_length:59_mod0000 -M_T0_RID139_S0_NC_029076.1:5391-5472_length:82_mod0000 -M_T0_RID139_S0_NC_029131.1:3428-3518_length:91_mod0000 -M_T0_RID139_S1_NC_027128.1:7467-7524_length:58_mod0000 -M_T0_RID139_S1_NC_033730.1:8262-8350_length:89_mod0000 -M_T0_RID140_S0_NC_031216.1:8965-9047_length:83_mod0000 -M_T0_RID140_S1_NC_029996.1:128484-128577_length:94_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000007.1:238838-238873_length:36_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000015.1:16859-16896_length:38_mod0000 -M_T0_RID142_S0_NC_027916.2:139729-139809_length:81_mod0001 -M_T0_RID142_S0_NC_030873.1:562-633_length:72_mod0000 -M_T0_RID142_S0_NZ_JBDYSJ010000003.1:9947-10048_length:102_mod0001 -M_T0_RID144_S0_NC_030200.1:1026-1085_length:60_mod0001 -M_T0_RID144_S0_NZ_JBDYRX010000002.1:297802-297909_length:108_mod0000 -M_T0_RID145_S0_NZ_JBDYSJ010000001.1:690815-690908_length:94_mod0000 -M_T0_RID146_S0_NC_028636.1:8587-8640_length:54_mod0000 -M_T0_RID147_S0_NC_030839.1:401-442_length:42_mod0000 -M_T0_RID147_S1_NZ_JBDYRX010000002.1:330619-330694_length:76_mod0000 -M_T0_RID148_S1_NZ_JBDYRX010000002.1:14264-14309_length:46_mod0000 -M_T0_RID149_S0_NZ_JBDYSJ010000001.1:617340-617447_length:108_mod0000 -M_T0_RID149_S1_NC_028249.1:10239-10323_length:85_mod0000 -M_T0_RID149_S1_NZ_JBDYLZ010000008.1:120921-120959_length:39_mod0000 -M_T0_RID150_S1_NZ_JBDYRX010000004.1:384747-384794_length:48_mod0000 -M_T0_RID152_S1_NZ_JBDYRX010000004.1:353714-353802_length:89_mod0000 -M_T0_RID153_S0_NZ_JBDYRX010000003.1:52603-52715_length:113_mod0000 -M_T0_RID153_S1_NC_028364.1:137-249_length:113_mod0000 -M_T0_RID154_S0_NZ_JBDYRX010000003.1:602237-602274_length:38_mod0000 -M_T0_RID154_S1_NC_028386.1:1116-1181_length:66_mod0000 -M_T0_RID154_S1_NC_033620.1:12644-12716_length:73_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000002.1:675599-675679_length:81_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000003.1:514528-514581_length:54_mod0000 -M_T0_RID155_S0_NC_033701.1:9275-9317_length:43_mod0000 -M_T0_RID156_S1_NC_023295.1:2064-2141_length:78_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000006.1:281471-281567_length:97_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000011.1:132268-132312_length:45_mod0000 -M_T0_RID158_S1_NC_028241.1:531-607_length:77_mod0000 -M_T0_RID159_S0_NC_029311.1:69011-69045_length:35_mod0000 -M_T0_RID159_S0_NC_031216.1:6290-6405_length:116_mod0000 -M_T0_RID159_S0_NC_033620.1:32537-32621_length:85_mod0000 -M_T0_RID159_S0_NZ_JBDYSJ010000002.1:600959-600995_length:37_mod0000 -M_T0_RID161_S1_NC_030240.1:83741-83790_length:50_mod0000 -M_T0_RID162_S0_NZ_JBDYLZ010000008.1:5183-5216_length:34_mod0000 -M_T0_RID162_S1_NC_017862.1:7381-7452_length:72_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:584559-584609_length:51_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:726659-726738_length:80_mod0000 -M_T0_RID163_S0_NC_033620.1:156883-156969_length:87_mod0000 -M_T0_RID163_S1_NC_030275.1:100083-100169_length:87_mod0000 -M_T0_RID164_S0_NZ_JBDYLZ010000018.1:17968-18030_length:63_mod0000 -M_T0_RID164_S1_NC_033620.1:130668-130713_length:46_mod0000 -M_T0_RID164_S1_NZ_JBDYRX010000004.1:519479-519563_length:85_mod0000 -M_T0_RID165_S0_NC_027917.1:1959-2051_length:93_mod0000 -M_T0_RID166_S0_NZ_JBDYRX010000004.1:59696-59805_length:110_mod0000 -M_T0_RID167_S0_NZ_JBDYLZ010000007.1:38370-38443_length:74_mod0000 -M_T0_RID168_S0_NC_030225.1:5381-5465_length:85_mod0001 -M_T0_RID168_S0_NC_030236.1:5080-5154_length:75_mod0000 -M_T0_RID169_S0_NC_028263.1:913-994_length:82_mod0000 -M_T0_RID169_S0_NZ_JBDYLZ010000007.1:16953-17017_length:65_mod0000 -M_T0_RID169_S1_NC_017970.1:7200-7322_length:123_mod0000 -M_T0_RID169_S1_NC_027016.1:84360-84421_length:62_mod0000 -M_T0_RID169_S1_NC_031295.1:1211-1283_length:73_mod0001 -M_T0_RID170_S1_NZ_JBDYRX010000001.1:71554-71642_length:89_mod0000 -M_T0_RID171_S0_NC_023429.1:1938-1983_length:46_mod0000 -M_T0_RID171_S0_NZ_JBDYRX010000001.1:944221-944313_length:93_mod0001 -M_T0_RID171_S1_NC_028891.1:8612-8645_length:34_mod0000 -M_T0_RID172_S0_NC_031455.1:2261-2316_length:56_mod0000 -M_T0_RID172_S1_NC_028383.1:1536-1621_length:86_mod0000 -M_T0_RID172_S1_NC_031293.1:5209-5302_length:94_mod0000 -M_T0_RID172_S1_NZ_JBDYSJ010000002.1:22259-22312_length:54_mod0000 -M_T0_RID173_S0_NC_033710.1:8523-8561_length:39_mod0000 -M_T0_RID173_S0_NZ_JBDYRX010000004.1:391209-391337_length:129_mod0000 -M_T0_RID173_S1_NZ_JBDYLZ010000022.1:5769-5818_length:50_mod0000 -M_T0_RID173_S1_NZ_JBDYSJ010000001.1:629973-630049_length:77_mod0000 -M_T0_RID174_S1_NC_030158.1:2752-2787_length:36_mod0000 -M_T0_RID174_S1_NC_031339.1:433-463_length:31_mod0000 -M_T0_RID174_S1_NZ_JBDYLZ010000006.1:10668-10748_length:81_mod0000 -M_T0_RID175_S0_NZ_JBDYLZ010000018.1:25042-25131_length:90_mod0000 -M_T0_RID175_S1_NZ_JBDYSJ010000001.1:899529-899569_length:41_mod0000 -M_T0_RID176_S0_NC_030200.1:58204-58287_length:84_mod0000 -M_T0_RID176_S0_NZ_JBDYRX010000002.1:668726-668775_length:50_mod0000 -M_T0_RID176_S1_NZ_JBDYSJ010000003.1:471518-471566_length:49_mod0001 -M_T0_RID177_S1_NZ_JBDYRX010000002.1:466682-466753_length:72_mod0000 -M_T0_RID178_S0_NC_028099.1:31084-31207_length:124_mod0000 -M_T0_RID178_S0_NC_033620.1:149729-149799_length:71_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000001.1:853106-853172_length:67_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000002.1:203092-203185_length:94_mod0000 -M_T0_RID179_S0_NC_023442.1:39001-39088_length:88_mod0000 -M_T0_RID179_S0_NZ_JBDYRX010000004.1:52140-52225_length:86_mod0000 -M_T0_RID179_S0_NZ_JBDYSJ010000001.1:721050-721084_length:35_mod0001 -M_T0_RID180_S0_NZ_JBDYSJ010000002.1:534591-534638_length:48_mod0000 -M_T0_RID180_S1_NC_029801.1:1212-1290_length:79_mod0000 -M_T0_RID181_S0_NC_023420.2:1575-1682_length:108_mod0000 -M_T0_RID181_S0_NZ_JBDYSJ010000001.1:400625-400659_length:35_mod0000 -M_T0_RID181_S1_NZ_JBDYLZ010000022.1:10488-10567_length:80_mod0000 -M_T0_RID182_S1_NC_030115.1:4690-4735_length:46_mod0000 -M_T0_RID183_S0_NC_029996.1:43664-43722_length:59_mod0000 -M_T0_RID185_S1_NZ_JBDYRX010000003.1:308336-308406_length:71_mod0001 -M_T0_RID185_S1_NZ_JBDYRX010000004.1:191608-191699_length:92_mod0000 -M_T0_RID187_S0_NC_029132.1:3505-3621_length:117_mod0000 -M_T0_RID187_S1_NC_028833.1:12138-12185_length:48_mod0001 -M_T0_RID187_S1_NZ_JBDYLZ010000007.1:48250-48349_length:100_mod0000 -M_T0_RID187_S1_NZ_JBDYRX010000001.1:251442-251541_length:100_mod0000 -M_T0_RID188_S0_NC_033620.1:60461-60546_length:86_mod0000 -M_T0_RID188_S0_NC_033745.1:5844-5924_length:81_mod0000 -M_T0_RID188_S1_NC_030746.1:5743-5836_length:94_mod0000 -M_T0_RID188_S1_NZ_JBDYSJ010000001.1:693404-693463_length:60_mod0000 -M_T0_RID190_S0_NC_028099.1:110295-110391_length:97_mod0000 -M_T0_RID190_S0_NC_031463.1:15502-15572_length:71_mod0000 -M_T0_RID190_S0_NZ_JBDYSJ010000002.1:205146-205255_length:110_mod0000 -M_T0_RID190_S1_NC_031291.1:89-172_length:84_mod0000 -M_T0_RID190_S1_NZ_JBDYRX010000001.1:953429-953485_length:57_mod0001 -M_T0_RID191_S0_NC_028811.1:13630-13691_length:62_mod0000 -M_T0_RID191_S0_NC_029255.1:128444-128478_length:35_mod0000 -M_T0_RID191_S1_NC_027706.1:673-702_length:30_mod0000 -M_T0_RID192_S0_NC_030202.1:1974-2037_length:64_mod0000 -M_T0_RID192_S0_NZ_JBDYSJ010000002.1:499003-499042_length:40_mod0000 -M_T0_RID192_S1_NC_028266.1:2491-2562_length:72_mod0000 -M_T0_RID192_S1_NC_029935.1:3672-3749_length:78_mod0000 -M_T0_RID193_S0_NC_030796.1:1139-1218_length:80_mod0000 -M_T0_RID193_S0_NZ_JBDYLZ010000006.1:65091-65167_length:77_mod0000 -M_T0_RID193_S1_NC_029311.1:3962-4023_length:62_mod0000 -M_T0_RID193_S1_NC_029854.1:2071-2138_length:68_mod0001 -M_T0_RID193_S1_NZ_JBDYLZ010000018.1:32241-32282_length:42_mod0000 -M_T0_RID193_S1_NZ_JBDYSJ010000004.1:33272-33325_length:54_mod0000 -M_T0_RID194_S0_NZ_JBDYRX010000001.1:29953-30068_length:116_mod0000 -M_T0_RID194_S1_NC_027117.1:4-75_length:72_mod0000 -M_T0_RID194_S1_NZ_JBDYSJ010000002.1:458031-458124_length:94_mod0000 -M_T0_RID195_S0_NC_029126.1:5551-5630_length:80_mod0000 -M_T0_RID195_S0_NC_030117.1:78912-78948_length:37_mod0000 -M_T0_RID195_S0_NZ_JBDYLZ010000010.1:56983-57024_length:42_mod0000 -M_T0_RID196_S0_NC_028891.1:12640-12710_length:71_mod0000 -M_T0_RID196_S0_NZ_JBDYSJ010000001.1:166064-166125_length:62_mod0000 -M_T0_RID196_S1_NC_029306.1:173-274_length:102_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000001.1:85071-85115_length:45_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000003.1:358250-358311_length:62_mod0001 -M_T0_RID198_S1_NZ_JBDYLZ010000012.1:46495-46566_length:72_mod0000 -M_T0_RID198_S1_NZ_JBDYSJ010000001.1:185655-185715_length:61_mod0000 -M_T0_RID199_S0_NZ_JBDYRX010000001.1:904336-904396_length:61_mod0000 -M_T0_RID200_S1_NZ_JBDYRX010000001.1:660511-660552_length:42_mod0000 -M_T0_RID201_S0_NZ_JBDYLZ010000028.1:698-764_length:67_mod0000 -M_T0_RID201_S1_NZ_JBDYSJ010000001.1:587635-587727_length:93_mod0000 -M_T0_RID202_S0_NZ_JBDYLZ010000009.1:73121-73183_length:63_mod0000 -M_T0_RID203_S1_NC_027923.1:89467-89574_length:108_mod0000 -M_T0_RID203_S1_NC_028470.1:6286-6372_length:87_mod0000 -M_T0_RID204_S0_NZ_JBDYSJ010000003.1:424711-424783_length:73_mod0000 -M_T0_RID204_S1_NZ_JBDYLZ010000009.1:157953-158008_length:56_mod0000 -M_T0_RID205_S0_NC_028806.1:14973-15042_length:70_mod0001 -M_T0_RID205_S0_NC_031336.1:5585-5707_length:123_mod0000 -M_T0_RID205_S0_NC_033710.1:1140-1174_length:35_mod0001 -M_T0_RID205_S0_NC_034377.1:309-345_length:37_mod0000 -M_T0_RID205_S0_NZ_JBDYRX010000001.1:648020-648102_length:83_mod0000 -M_T0_RID206_S0_NZ_JBDYRX010000003.1:657781-657875_length:95_mod0000 -M_T0_RID206_S1_NZ_JBDYSJ010000002.1:507837-507900_length:64_mod0000 -M_T0_RID207_S0_NC_029782.1:2571-2655_length:85_mod0000 -M_T0_RID207_S0_NC_033756.1:9757-9804_length:48_mod0000 -M_T0_RID207_S1_NC_028470.1:3881-3944_length:64_mod0000 -M_T0_RID207_S1_NC_029111.1:391-425_length:35_mod0000 -M_T0_RID208_S1_NC_028137.1:3146-3238_length:93_mod0000 -M_T0_RID209_S1_NC_027016.1:200405-200534_length:130_mod0000 -M_T0_RID209_S1_NZ_JBDYRX010000003.1:693765-693849_length:85_mod0000 -M_T0_RID211_S0_NC_030749.1:1821-1921_length:101_mod0000 -M_T0_RID211_S0_NZ_JBDYSJ010000002.1:199161-199238_length:78_mod0000 -M_T0_RID212_S0_NC_028462.1:2849-2888_length:40_mod0000 -M_T0_RID212_S0_NC_031272.1:7400-7455_length:56_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:220611-220694_length:84_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:824198-824247_length:50_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000002.1:522607-522670_length:64_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000003.1:35532-35575_length:44_mod0000 -M_T0_RID213_S1_NC_027619.1:3998-4074_length:77_mod0000 -M_T0_RID214_S0_NC_017990.1:4036-4109_length:74_mod0000 -M_T0_RID214_S0_NZ_JBDYRX010000004.1:6306-6380_length:75_mod0000 -M_T0_RID214_S1_NZ_JBDYLZ010000016.1:26291-26346_length:56_mod0001 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:332282-332360_length:79_mod0000 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:457564-457597_length:34_mod0000 -M_T0_RID215_S1_NZ_JBDYRX010000004.1:547476-547541_length:66_mod0000 -M_T0_RID217_S0_NC_030922.1:6414-6531_length:118_mod0000 -M_T0_RID217_S0_NZ_JBDYRX010000001.1:366993-367094_length:102_mod0000 -M_T0_RID217_S1_NC_017970.1:8697-8737_length:41_mod0000 -M_T0_RID217_S1_NC_018482.1:2018-2099_length:82_mod0000 -M_T0_RID219_S0_NZ_JBDYLZ010000006.1:135272-135372_length:101_mod0001 -M_T0_RID219_S1_NZ_JBDYRX010000003.1:132173-132251_length:79_mod0000 -M_T0_RID220_S0_NC_033725.1:8661-8722_length:62_mod0000 -M_T0_RID220_S1_NZ_JBDYRX010000003.1:133141-133229_length:89_mod0000 -M_T0_RID221_S0_NZ_JBDYRX010000001.1:771011-771087_length:77_mod0000 -M_T0_RID222_S0_NC_037572.1:1818-1871_length:54_mod0000 -M_T0_RID222_S1_NC_028485.1:810-872_length:63_mod0000 -M_T0_RID222_S1_NC_030793.1:2889-2992_length:104_mod0000 -M_T0_RID222_S1_NZ_JBDYRX010000001.1:301419-301533_length:115_mod0001 -M_T0_RID223_S1_NC_033620.1:157690-157751_length:62_mod0000 -M_T0_RID224_S0_NC_017937.1:2859-2949_length:91_mod0000 -M_T0_RID224_S1_NC_028388.1:2224-2291_length:68_mod0001 -M_T0_RID224_S1_NC_033700.1:22817-22886_length:70_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000001.1:692859-692944_length:86_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000004.1:483631-483701_length:71_mod0000 -M_T0_RID225_S1_NC_029311.1:72416-72523_length:108_mod0000 -M_T0_RID225_S1_NC_030240.1:91908-91984_length:77_mod0000 -M_T0_RID226_S0_NZ_JBDYRX010000001.1:678003-678073_length:71_mod0000 -M_T0_RID226_S1_NZ_JBDYRX010000001.1:984964-985038_length:75_mod0000 -M_T0_RID227_S0_NC_028636.1:35420-35507_length:88_mod0000 -M_T0_RID227_S0_NZ_JBDYLZ010000014.1:18260-18351_length:92_mod0000 -M_T0_RID227_S1_NZ_JBDYLZ010000010.1:2424-2519_length:96_mod0000 -M_T0_RID229_S0_NZ_JBDYRX010000002.1:664717-664801_length:85_mod0000 -M_T0_RID230_S0_NC_033822.1:1869-1967_length:99_mod0000 -M_T0_RID230_S0_NZ_JBDYRX010000002.1:244562-244600_length:39_mod0000 -M_T0_RID231_S0_NC_034017.1:4341-4449_length:109_mod0000 -M_T0_RID231_S0_NZ_JBDYRX010000002.1:364966-365054_length:89_mod0000 -M_T0_RID231_S1_NZ_JBDYRX010000004.1:275949-276005_length:57_mod0001 -M_T0_RID233_S0_NC_030402.1:4056-4127_length:72_mod0000 -M_T0_RID234_S0_NZ_JBDYSJ010000001.1:910286-910315_length:30_mod0000 -M_T0_RID234_S1_NZ_JBDYSJ010000003.1:84105-84229_length:125_mod0000 -M_T0_RID235_S0_NC_029997.2:52965-53016_length:52_mod0000 -M_T0_RID235_S0_NZ_JBDYRX010000004.1:469577-469661_length:85_mod0000 -M_T0_RID235_S1_NC_029993.1:68-156_length:89_mod0000 -M_T0_RID236_S0_NC_027209.1:15-106_length:92_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000001.1:879200-879251_length:52_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000002.1:665177-665206_length:30_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:172535-172571_length:37_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:365370-365448_length:79_mod0000 -M_T0_RID237_S1_NZ_JBDYRX010000003.1:311400-311455_length:56_mod0000 -M_T0_RID237_S1_NZ_JBDYSJ010000001.1:341900-342051_length:152_mod0001 -M_T0_RID237_S1_NZ_JBDYSJ010000002.1:210078-210161_length:84_mod0000 -M_T0_RID239_S1_NZ_JBDYLZ010000008.1:60180-60243_length:64_mod0000 -M_T0_RID240_S0_NC_028376.1:8889-8978_length:90_mod0000 -M_T0_RID240_S0_NZ_JBDYLZ010000011.1:107039-107086_length:48_mod0000 -M_T0_RID240_S1_NC_029255.1:88189-88282_length:94_mod0000 -M_T0_RID242_S0_NC_031275.1:6726-6767_length:42_mod0000 -M_T0_RID242_S1_NZ_JBDYRX010000003.1:456427-456495_length:69_mod0000 -M_T0_RID243_S0_NC_038232.1:593-634_length:42_mod0000 -M_T0_RID244_S0_NZ_JBDYRX010000004.1:71169-71250_length:82_mod0000 -M_T0_RID244_S1_NC_031105.1:1094-1177_length:84_mod0000 -M_T0_RID244_S1_NZ_JBDYRX010000003.1:93344-93453_length:110_mod0000 -M_T0_RID245_S1_NC_027916.2:74440-74509_length:70_mod0000 -M_T0_RID246_S0_NZ_JBDYLZ010000007.1:253179-253255_length:77_mod0000 -M_T0_RID246_S0_NZ_JBDYRX010000003.1:373773-373844_length:72_mod0000 -M_T0_RID247_S1_NC_034240.1:6159-6240_length:82_mod0000 -M_T0_RID247_S1_NZ_JBDYLZ010000006.1:319402-319479_length:78_mod0000 -M_T0_RID248_S1_NZ_JBDYLZ010000021.1:15403-15484_length:82_mod0000 -M_T0_RID248_S1_NZ_JBDYSJ010000002.1:614316-614362_length:47_mod0000 -M_T0_RID249_S1_NZ_JBDYSJ010000002.1:599779-599834_length:56_mod0000 -M_T0_RID250_S0_NC_027916.2:147626-147747_length:122_mod0000 -M_T0_RID250_S0_NC_033620.1:26136-26203_length:68_mod0000 -M_T0_RID251_S1_NZ_JBDYRX010000003.1:388429-388516_length:88_mod0001 -M_T0_RID252_S0_NZ_JBDYRX010000003.1:533554-533659_length:106_mod0000 -M_T0_RID252_S0_NZ_JBDYSJ010000004.1:89796-89871_length:76_mod0000 -M_T0_RID254_S0_NC_029312.1:1320-1415_length:96_mod0000 -M_T0_RID254_S1_NC_033722.1:1513-1562_length:50_mod0000 -M_T0_RID254_S1_NZ_JBDYRX010000003.1:600746-600803_length:58_mod0000 -M_T0_RID255_S1_NZ_JBDYLZ010000009.1:84943-85024_length:82_mod0000 -M_T0_RID256_S0_NZ_JBDYRX010000002.1:72764-72831_length:68_mod0000 -M_T0_RID256_S1_NZ_JBDYSJ010000003.1:105583-105635_length:53_mod0001 -M_T0_RID257_S0_NC_029997.2:11591-11678_length:88_mod0000 -M_T0_RID257_S0_NZ_JBDYLZ010000007.1:42813-42887_length:75_mod0000 -M_T0_RID258_S0_NC_030151.1:5275-5349_length:75_mod0000 -M_T0_RID258_S1_NC_023442.1:46718-46759_length:42_mod0000 -M_T0_RID258_S1_NC_027641.1:2606-2691_length:86_mod0000 -M_T0_RID259_S0_NZ_JBDYRX010000001.1:515399-515441_length:43_mod0000 -M_T0_RID259_S1_NC_033710.1:2139-2199_length:61_mod0001 -M_T0_RID260_S0_NZ_JBDYRX010000004.1:304887-304994_length:108_mod0000 -M_T0_RID261_S0_NC_024913.1:363-436_length:74_mod0000 -M_T0_RID261_S1_NZ_JBDYSJ010000003.1:83891-83937_length:47_mod0000 -M_T0_RID262_S0_NC_028964.1:8465-8506_length:42_mod0000 -M_T0_RID262_S1_NC_028369.1:11507-11563_length:57_mod0000 -M_T0_RID263_S1_NZ_JBDYLZ010000007.1:59938-60023_length:86_mod0000 -M_T0_RID264_S1_NC_030240.1:10284-10380_length:97_mod0000 -M_T0_RID266_S0_NZ_JBDYRX010000003.1:575037-575078_length:42_mod0000 -M_T0_RID268_S0_NZ_JBDYRX010000001.1:768153-768245_length:93_mod0000 -M_T0_RID268_S0_NZ_JBDYSJ010000001.1:798703-798770_length:68_mod0000 -M_T0_RID270_S0_NC_029132.1:95722-95798_length:77_mod0000 -M_T0_RID270_S1_NZ_JBDYSJ010000004.1:222075-222158_length:84_mod0000 -M_T0_RID271_S0_NC_033620.1:162451-162504_length:54_mod0000 -M_T0_RID272_S0_NC_033620.1:33874-33960_length:87_mod0000 -M_T0_RID273_S1_NC_030744.1:7300-7340_length:41_mod0000 -M_T0_RID273_S1_NZ_JBDYRX010000002.1:841729-841840_length:112_mod0000 -M_T0_RID274_S1_NC_037571.1:1402-1475_length:74_mod0000 -M_T0_RID274_S1_NC_037615.1:1507-1556_length:50_mod0000 -M_T0_RID274_S1_NZ_JBDYRX010000002.1:803747-803830_length:84_mod0001 -M_T0_RID276_S0_NZ_JBDYSJ010000001.1:37440-37524_length:85_mod0000 -M_T0_RID276_S1_NZ_JBDYSJ010000003.1:418336-418453_length:118_mod0000 -M_T0_RID277_S1_NZ_JBDYLZ010000010.1:25227-25303_length:77_mod0000 -M_T0_RID277_S1_NZ_JBDYRX010000004.1:42366-42442_length:77_mod0000 -M_T0_RID280_S1_NC_029255.1:110657-110707_length:51_mod0000 -M_T0_RID280_S1_NZ_JBDYLZ010000007.1:148039-148124_length:86_mod0000 -M_T0_RID280_S1_NZ_JBDYSJ010000003.1:358558-358656_length:99_mod0000 -M_T0_RID281_S0_NZ_JBDYRX010000001.1:319973-320043_length:71_mod0000 -M_T0_RID281_S1_NC_033717.1:9058-9157_length:100_mod0000 -M_T0_RID281_S1_NZ_JBDYLZ010000009.1:175718-175802_length:85_mod0000 -M_T0_RID282_S0_NZ_JBDYRX010000002.1:378265-378345_length:81_mod0001 -M_T0_RID283_S1_NC_027016.1:6355-6413_length:59_mod0000 -M_T0_RID283_S1_NC_028230.1:391-510_length:120_mod0000 -M_T0_RID285_S1_NC_034376.1:1364-1410_length:47_mod0000 -M_T0_RID286_S1_NC_027918.1:6177-6259_length:83_mod0000 -M_T0_RID287_S0_NZ_JBDYRX010000003.1:370134-370205_length:72_mod0000 -M_T0_RID289_S0_NZ_JBDYRX010000001.1:744827-744955_length:129_mod0000 -M_T0_RID289_S1_NC_028259.1:3827-3878_length:52_mod0000 -M_T0_RID290_S0_NC_030240.1:45198-45233_length:36_mod0000 -M_T0_RID290_S0_NC_030691.1:1722-1773_length:52_mod0000 -M_T0_RID290_S1_NC_029133.1:4034-4132_length:99_mod0000 -M_T0_RID291_S1_NC_028981.1:5970-6046_length:77_mod0000 -M_T0_RID291_S1_NZ_JBDYSJ010000002.1:464139-464169_length:31_mod0000 -M_T0_RID293_S1_NC_030232.1:2260-2327_length:68_mod0000 -M_T0_RID295_S1_NC_027916.2:61867-61920_length:54_mod0000 -M_T0_RID295_S1_NC_028806.1:27530-27608_length:79_mod0000 -M_T0_RID296_S0_NZ_JBDYSJ010000001.1:184354-184410_length:57_mod0000 -M_T0_RID296_S1_NC_028867.1:5870-5944_length:75_mod0000 -M_T0_RID296_S1_NC_029034.2:6068-6170_length:103_mod0000 -M_T0_RID296_S1_NC_029575.1:1786-1824_length:39_mod0000 -M_T0_RID296_S1_NC_031313.1:8320-8423_length:104_mod0000 -M_T0_RID296_S1_NZ_JBDYRX010000001.1:732093-732144_length:52_mod0000 -M_T0_RID300_S0_NC_030870.1:888-963_length:76_mod0000 -M_T0_RID300_S1_NC_028239.1:12981-13075_length:95_mod0001 -M_T0_RID301_S0_NC_027016.1:47977-48089_length:113_mod0000 -M_T0_RID301_S0_NC_029997.2:77533-77588_length:56_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000001.1:795273-795348_length:76_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000003.1:723584-723651_length:68_mod0000 -M_T0_RID302_S1_NC_033820.1:4695-4770_length:76_mod0000 -M_T0_RID303_S0_NZ_JBDYSJ010000002.1:596456-596511_length:56_mod0000 -M_T0_RID303_S1_NZ_JBDYLZ010000013.1:92895-92926_length:32_mod0000 -M_T0_RID304_S0_NC_031463.1:20675-20751_length:77_mod0000 -M_T0_RID306_S0_NC_027916.2:96621-96699_length:79_mod0000 -M_T0_RID307_S0_NC_028266.1:10941-10980_length:40_mod0000 -M_T0_RID308_S1_NZ_JBDYLZ010000010.1:103191-103276_length:86_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:370261-370296_length:36_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:387786-387861_length:76_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000003.1:389721-389777_length:57_mod0000 -M_T0_RID309_S1_NC_026944.1:4310-4395_length:86_mod0000 -M_T0_RID309_S1_NZ_JBDYSJ010000001.1:151328-151382_length:55_mod0000 -M_T0_RID311_S0_NZ_JBDYLZ010000006.1:59717-59765_length:49_mod0000 -M_T0_RID311_S1_NZ_JBDYLZ010000023.1:5604-5703_length:100_mod0000 -M_T0_RID312_S1_NC_018382.1:3769-3816_length:48_mod0000 -M_T0_RID313_S1_NZ_JBDYRX010000002.1:139751-139865_length:115_mod0000 -M_T0_RID314_S0_NZ_JBDYSJ010000004.1:132522-132621_length:100_mod0000 -M_T0_RID315_S0_NC_033823.1:7820-7860_length:41_mod0000 -M_T0_RID317_S0_NC_034214.1:5951-5996_length:46_mod0000 -M_T0_RID317_S0_NZ_JBDYLZ010000015.1:71185-71277_length:93_mod0000 -M_T0_RID317_S0_NZ_JBDYRX010000004.1:174342-174382_length:41_mod0000 -M_T0_RID317_S1_NC_030293.1:5902-5968_length:67_mod0001 -M_T0_RID318_S0_NC_028814.1:27392-27476_length:85_mod0000 -M_T0_RID318_S0_NZ_JBDYRX010000001.1:771856-771930_length:75_mod0000 -M_T0_RID318_S1_NZ_JBDYLZ010000006.1:119310-119391_length:82_mod0000 -M_T0_RID319_S0_NC_034266.1:62140-62218_length:79_mod0000 -M_T0_RID319_S1_NC_028981.1:4292-4341_length:50_mod0000 -M_T0_RID319_S1_NC_031455.1:2498-2551_length:54_mod0000 -M_T0_RID319_S1_NZ_JBDYRX010000004.1:60929-61033_length:105_mod0000 -M_T0_RID322_S1_NZ_JBDYRX010000003.1:440227-440291_length:65_mod0000 -M_T0_RID323_S0_NC_030240.1:40893-40967_length:75_mod0000 -M_T0_RID323_S0_NZ_JBDYLZ010000007.1:249215-249268_length:54_mod0000 -M_T0_RID324_S0_NC_029311.1:87639-87764_length:126_mod0000 -M_T0_RID324_S0_NZ_JBDYSJ010000002.1:545609-545688_length:80_mod0000 -M_T0_RID324_S1_NZ_JBDYSJ010000003.1:210751-210786_length:36_mod0000 -M_T0_RID325_S1_NC_031240.1:7762-7813_length:52_mod0000 -M_T0_RID326_S0_NZ_JBDYLZ010000009.1:5470-5539_length:70_mod0000 -M_T0_RID328_S1_NZ_JBDYRX010000002.1:171169-171268_length:100_mod0000 -M_T0_RID329_S0_NZ_JBDYRX010000002.1:757356-757453_length:98_mod0000 -M_T0_RID329_S1_NZ_JBDYLZ010000008.1:68972-69065_length:94_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:680879-680974_length:96_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:706464-706551_length:88_mod0000 -M_T0_RID331_S0_NC_029255.1:77095-77131_length:37_mod0000 -M_T0_RID331_S0_NC_030240.1:62248-62311_length:64_mod0000 -M_T0_RID331_S1_NC_030126.1:1582-1653_length:72_mod0001 -M_T0_RID331_S1_NC_033707.1:5319-5406_length:88_mod0000 -M_T0_RID331_S1_NZ_JBDYLZ010000016.1:42739-42823_length:85_mod0000 -M_T0_RID332_S0_NZ_JBDYSJ010000004.1:35297-35358_length:62_mod0000 -M_T0_RID333_S0_NZ_JBDYLZ010000014.1:79014-79074_length:61_mod0000 -M_T0_RID333_S1_NC_027647.1:655-726_length:72_mod0000 -M_T0_RID333_S1_NC_033620.1:54726-54845_length:120_mod0000 -M_T0_RID334_S0_NZ_JBDYRX010000002.1:455003-455101_length:99_mod0000 -M_T0_RID335_S0_NZ_JBDYRX010000002.1:694573-694718_length:146_mod0000 -M_T0_RID335_S1_NZ_JBDYSJ010000001.1:102384-102461_length:78_mod0000 -M_T0_RID337_S0_NC_028368.1:13695-13792_length:98_mod0000 -M_T0_RID338_S0_NZ_JBDYRX010000001.1:578324-578379_length:56_mod0000 -M_T0_RID338_S1_NZ_JBDYRX010000003.1:471689-471760_length:72_mod0000 -M_T0_RID339_S1_NC_028362.1:1132-1236_length:105_mod0000 -M_T0_RID339_S1_NZ_JBDYRX010000003.1:626110-626150_length:41_mod0000 -M_T0_RID339_S1_NZ_JBDYSJ010000002.1:576422-576503_length:82_mod0000 -M_T0_RID340_S0_NC_028973.1:4682-4727_length:46_mod0000 -M_T0_RID340_S0_NC_029132.1:93532-93576_length:45_mod0000 -M_T0_RID341_S0_NC_030240.1:112206-112263_length:58_mod0000 -M_T0_RID341_S0_NC_034252.1:1229-1329_length:101_mod0000 -M_T0_RID342_S0_NZ_JBDYLZ010000011.1:111949-111982_length:34_mod0001 -M_T0_RID342_S1_NZ_JBDYLZ010000008.1:135318-135406_length:89_mod0001 -M_T0_RID343_S0_NC_029996.1:68953-69051_length:99_mod0000 -M_T0_RID344_S1_NC_030148.1:11118-11172_length:55_mod0000 -M_T0_RID345_S0_NZ_JBDYRX010000002.1:64932-64977_length:46_mod0000 -M_T0_RID346_S1_NZ_JBDYRX010000003.1:433612-433704_length:93_mod0000 -M_T0_RID347_S0_NC_036636.1:7712-7773_length:62_mod0000 -M_T0_RID347_S1_NZ_JBDYRX010000002.1:59074-59138_length:65_mod0000 -M_T0_RID347_S1_NZ_JBDYSJ010000003.1:117376-117430_length:55_mod0001 -M_T0_RID348_S0_NZ_JBDYRX010000001.1:1015831-1015930_length:100_mod0000 -M_T0_RID348_S1_NZ_JBDYRX010000001.1:141445-141557_length:113_mod0000 -M_T0_RID349_S0_NC_030391.1:4068-4155_length:88_mod0001 -M_T0_RID349_S0_NZ_JBDYRX010000001.1:226925-227009_length:85_mod0000 -M_T0_RID349_S1_NZ_JBDYRX010000003.1:358370-358434_length:65_mod0000 -M_T0_RID351_S0_NC_033753.1:4226-4317_length:92_mod0000 -M_T0_RID352_S1_NC_028259.1:56-127_length:72_mod0000 -M_T0_RID352_S1_NC_028395.1:155-248_length:94_mod0000 -M_T0_RID352_S1_NC_029931.1:9204-9241_length:38_mod0000 -M_T0_RID353_S0_NZ_JBDYLZ010000009.1:48165-48236_length:72_mod0000 -M_T0_RID354_S1_NZ_JBDYLZ010000012.1:45797-45922_length:126_mod0000 -M_T0_RID356_S0_NC_028378.1:3454-3530_length:77_mod0000 -M_T0_RID357_S0_NZ_JBDYRX010000002.1:120553-120591_length:39_mod0000 -M_T0_RID357_S1_NZ_JBDYSJ010000004.1:245908-245957_length:50_mod0000 -M_T0_RID358_S0_NC_029126.1:5901-5938_length:38_mod0000 -M_T0_RID358_S1_NC_028140.1:1554-1651_length:98_mod0000 -M_T0_RID358_S1_NZ_JBDYSJ010000002.1:580725-580785_length:61_mod0001 -M_T0_RID359_S0_NZ_JBDYRX010000001.1:601220-601298_length:79_mod0000 -M_T0_RID360_S0_NC_027916.2:77660-77740_length:81_mod0001 -M_T0_RID360_S0_NZ_JBDYLZ010000012.1:70482-70531_length:50_mod0000 -M_T0_RID360_S1_NC_017862.1:2881-2912_length:32_mod0000 -M_T0_RID360_S1_NC_028373.1:7802-7900_length:99_mod0000 -M_T0_RID361_S0_NZ_JBDYRX010000003.1:274684-274747_length:64_mod0000 -M_T0_RID362_S0_NC_029996.1:102820-102944_length:125_mod0001 -M_T0_RID362_S1_NC_027916.2:110368-110450_length:83_mod0000 -M_T0_RID362_S1_NZ_JBDYSJ010000002.1:480705-480765_length:61_mod0000 -M_T0_RID363_S0_NC_031089.1:6455-6543_length:89_mod0000 -M_T0_RID363_S0_NC_031218.1:1568-1623_length:56_mod0000 -M_T0_RID365_S1_NZ_JBDYSJ010000002.1:271975-272051_length:77_mod0000 -M_T0_RID366_S0_NZ_JBDYSJ010000001.1:487398-487484_length:87_mod0001 -M_T0_RID366_S1_NC_030843.1:4921-5005_length:85_mod0000 -M_T0_RID367_S0_NC_030127.1:2548-2589_length:42_mod0000 -M_T0_RID367_S0_NZ_JBDYLZ010000011.1:24860-24971_length:112_mod0000 -M_T0_RID367_S1_NZ_JBDYLZ010000006.1:96139-96201_length:63_mod0000 -M_T0_RID368_S0_NZ_JBDYSJ010000002.1:604782-604905_length:124_mod0001 -M_T0_RID369_S1_NC_031464.1:5161-5234_length:74_mod0000 -M_T0_RID370_S0_NC_027542.1:1019-1100_length:82_mod0000 -M_T0_RID371_S1_NC_028144.1:5011-5099_length:89_mod0000 -M_T0_RID371_S1_NZ_JBDYRX010000002.1:678499-678596_length:98_mod0000 -M_T0_RID372_S0_NZ_JBDYRX010000003.1:526040-526077_length:38_mod0000 -M_T0_RID372_S0_NZ_JBDYSJ010000002.1:283416-283463_length:48_mod0001 -M_T0_RID373_S0_NC_033705.1:55-95_length:41_mod0000 -M_T0_RID374_S0_NC_027016.1:151413-151449_length:37_mod0000 -M_T0_RID374_S0_NZ_JBDYSJ010000003.1:310288-310375_length:88_mod0000 -M_T0_RID374_S1_NZ_JBDYLZ010000012.1:57726-57851_length:126_mod0000 -M_T0_RID375_S0_NC_034377.1:6340-6385_length:46_mod0000 -M_T0_RID375_S1_NC_028099.1:112413-112504_length:92_mod0001 -M_T0_RID378_S0_NC_018448.1:5936-6007_length:72_mod0000 -M_T0_RID379_S1_NZ_JBDYRX010000001.1:727009-727109_length:101_mod0000 -M_T0_RID380_S0_NC_034253.1:5146-5187_length:42_mod0000 -M_T0_RID380_S1_NC_029905.1:2051-2094_length:44_mod0000 -M_T0_RID381_S0_NC_030240.1:103311-103373_length:63_mod0000 -M_T0_RID381_S0_NZ_JBDYLZ010000009.1:178104-178162_length:59_mod0000 -M_T0_RID382_S0_NC_027210.1:5895-5968_length:74_mod0000 -M_T0_RID382_S0_NC_029996.1:87376-87478_length:103_mod0000 -M_T0_RID382_S1_NC_027916.2:84236-84307_length:72_mod0000 -M_T0_RID383_S0_NZ_JBDYSJ010000001.1:683370-683456_length:87_mod0000 -M_T0_RID383_S1_NC_029132.1:79856-79920_length:65_mod0000 -M_T0_RID385_S0_NZ_JBDYLZ010000009.1:69071-69118_length:48_mod0000 -M_T0_RID386_S0_NC_034225.1:1556-1648_length:93_mod0000 -M_T0_RID387_S1_NC_028636.1:123682-123742_length:61_mod0000 -M_T0_RID388_S0_NZ_JBDYLZ010000008.1:71860-71983_length:124_mod0000 -M_T0_RID389_S0_NC_029051.1:9270-9318_length:49_mod0000 -M_T0_RID389_S0_NZ_JBDYLZ010000016.1:61192-61254_length:63_mod0000 -M_T0_RID390_S1_NC_028981.1:1738-1830_length:93_mod0000 -M_T0_RID391_S0_NC_028371.1:6428-6495_length:68_mod0000 -M_T0_RID391_S0_NZ_JBDYRX010000004.1:272450-272500_length:51_mod0000 -M_T0_RID391_S1_NZ_JBDYSJ010000002.1:543099-543205_length:107_mod0000 -M_T0_RID392_S0_NC_028970.1:5031-5099_length:69_mod0000 -M_T0_RID392_S1_NC_028824.1:19380-19469_length:90_mod0000 -M_T0_RID392_S1_NZ_JBDYLZ010000009.1:26519-26597_length:79_mod0000 -M_T0_RID393_S0_NZ_JBDYLZ010000015.1:66736-66802_length:67_mod0000 -M_T0_RID395_S0_NC_031304.1:4214-4304_length:91_mod0000 -M_T0_RID396_S0_NZ_JBDYSJ010000001.1:683444-683483_length:40_mod0000 -M_T0_RID397_S0_NC_028125.1:5157-5221_length:65_mod0000 -M_T0_RID398_S0_NC_028814.1:21296-21329_length:34_mod0000 -M_T0_RID398_S0_NZ_JBDYLZ010000008.1:89568-89611_length:44_mod0000 -M_T0_RID398_S1_NZ_JBDYRX010000003.1:160428-160514_length:87_mod0000 -M_T0_RID399_S1_NZ_JBDYRX010000002.1:383166-383266_length:101_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000006.1:321094-321166_length:73_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000017.1:46480-46536_length:57_mod0000 -M_T0_RID402_S0_NC_028491.1:36087-36159_length:73_mod0000 -M_T0_RID406_S0_NC_033720.1:8569-8637_length:69_mod0000 -M_T0_RID406_S0_NZ_JBDYSJ010000002.1:605544-605617_length:74_mod0000 -M_T0_RID406_S1_NC_033620.1:71763-71841_length:79_mod0000 -M_T0_RID407_S0_NC_028491.1:95220-95304_length:85_mod0000 -M_T0_RID407_S0_NZ_JBDYRX010000004.1:531865-531922_length:58_mod0000 -M_T0_RID408_S0_NZ_JBDYLZ010000006.1:20241-20331_length:91_mod0000 -M_T0_RID408_S1_NC_030391.1:1047-1152_length:106_mod0000 -M_T0_RID409_S1_NC_029904.1:2927-3013_length:87_mod0000 -M_T0_RID410_S0_NC_028369.1:7176-7240_length:65_mod0000 -M_T0_RID410_S1_NC_027923.1:107200-107294_length:95_mod0000 -M_T0_RID411_S1_NC_027916.2:12656-12743_length:88_mod0000 -M_T0_RID412_S0_NC_028362.1:1734-1810_length:77_mod0000 -M_T0_RID414_S0_NC_027646.1:3518-3556_length:39_mod0000 -M_T0_RID415_S1_NC_033703.1:4454-4536_length:83_mod0000 -M_T0_RID415_S1_NZ_JBDYRX010000004.1:398358-398416_length:59_mod0000 -M_T0_RID419_S0_NZ_JBDYSJ010000002.1:339543-339583_length:41_mod0000 -M_T0_RID420_S0_NC_029919.1:1092-1170_length:79_mod0000 -M_T0_RID420_S1_NC_029132.1:86139-86240_length:102_mod0000 -M_T0_RID421_S0_NZ_JBDYRX010000004.1:42510-42680_length:171_mod0001 -M_T0_RID421_S1_NC_028099.1:99392-99421_length:30_mod0000 -M_T0_RID422_S0_NC_028236.1:7738-7797_length:60_mod0000 -M_T0_RID422_S0_NZ_JBDYLZ010000014.1:21662-21716_length:55_mod0000 -M_T0_RID422_S0_NZ_JBDYSJ010000002.1:476168-476219_length:52_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:131159-131244_length:86_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:465551-465658_length:108_mod0000 -M_T0_RID424_S0_NC_029132.1:124479-124602_length:124_mod0000 -M_T0_RID424_S1_NZ_JBDYLZ010000006.1:180426-180481_length:56_mod0000 -M_T0_RID424_S1_NZ_JBDYSJ010000003.1:445372-445447_length:76_mod0000 -M_T0_RID425_S0_NZ_JBDYLZ010000006.1:11120-11222_length:103_mod0000 -M_T0_RID426_S1_NZ_JBDYRX010000002.1:460851-460904_length:54_mod0000 -M_T0_RID426_S1_NZ_JBDYSJ010000001.1:882579-882628_length:50_mod0000 -M_T0_RID427_S0_NZ_JBDYSJ010000001.1:460394-460459_length:66_mod0000 -M_T0_RID428_S1_NZ_JBDYLZ010000007.1:203593-203667_length:75_mod0000 -M_T0_RID432_S1_NZ_JBDYRX010000004.1:37215-37282_length:68_mod0000 -M_T0_RID433_S0_NC_028371.1:7751-7803_length:53_mod0000 -M_T0_RID433_S0_NZ_JBDYRX010000001.1:940205-940283_length:79_mod0000 -M_T0_RID434_S0_NZ_JBDYRX010000003.1:278075-278140_length:66_mod0000 -M_T0_RID435_S1_NC_031225.1:6315-6360_length:46_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000001.1:992235-992354_length:120_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000002.1:28179-28253_length:75_mod0000 -M_T0_RID436_S0_NZ_JBDYRX010000004.1:193926-194033_length:108_mod0000 -M_T0_RID438_S0_NZ_JBDYRX010000004.1:427488-427551_length:64_mod0000 -M_T0_RID441_S1_NC_028486.1:4288-4332_length:45_mod0000 -M_T0_RID441_S1_NC_031135.1:1215-1254_length:40_mod0000 -M_T0_RID441_S1_NC_033620.1:171185-171273_length:89_mod0000 -M_T0_RID441_S1_NZ_JBDYRX010000001.1:944430-944505_length:76_mod0000 -M_T0_RID442_S1_NZ_JBDYSJ010000001.1:795030-795132_length:103_mod0000 -M_T0_RID444_S1_NC_029927.1:739-780_length:42_mod0000 -M_T0_RID445_S0_NC_030400.1:9136-9237_length:102_mod0000 -M_T0_RID445_S1_NC_037578.1:3062-3107_length:46_mod0000 -M_T0_RID446_S0_NC_029996.1:10622-10695_length:74_mod0000 -M_T0_RID446_S1_NC_034266.1:27796-27894_length:99_mod0000 -M_T0_RID447_S1_NC_031259.1:1711-1781_length:71_mod0000 -M_T0_RID450_S0_NZ_JBDYRX010000003.1:719829-719908_length:80_mod0000 -M_T0_RID451_S0_NC_027214.1:8775-8830_length:56_mod0000 -M_T0_RID451_S0_NC_028367.1:5391-5502_length:112_mod0000 -M_T0_RID451_S1_NZ_JBDYRX010000002.1:31090-31200_length:111_mod0000 -M_T0_RID452_S1_NC_030205.1:1725-1812_length:88_mod0000 -M_T0_RID453_S0_NC_033761.1:8903-9009_length:107_mod0001 -M_T0_RID455_S0_NC_027799.1:284-375_length:92_mod0000 -M_T0_RID455_S1_NZ_JBDYLZ010000014.1:95838-95936_length:99_mod0000 -M_T0_RID455_S1_NZ_JBDYSJ010000002.1:210490-210557_length:68_mod0000 -M_T0_RID456_S0_NZ_JBDYLZ010000007.1:109571-109660_length:90_mod0000 -M_T0_RID456_S1_NC_030240.1:55430-55543_length:114_mod0000 -M_T0_RID457_S1_NZ_JBDYLZ010000009.1:123168-123262_length:95_mod0000 -M_T0_RID457_S1_NZ_JBDYSJ010000004.1:21364-21417_length:54_mod0000 -M_T0_RID458_S1_NC_034266.1:128171-128258_length:88_mod0000 -M_T0_RID458_S1_NZ_JBDYLZ010000008.1:129533-129587_length:55_mod0000 -M_T0_RID458_S1_NZ_JBDYRX010000002.1:29087-29147_length:61_mod0000 -M_T0_RID459_S0_NZ_JBDYRX010000001.1:1023086-1023182_length:97_mod0000 -M_T0_RID459_S1_NC_023442.1:114262-114356_length:95_mod0000 -M_T0_RID460_S0_NC_029052.1:1193-1273_length:81_mod0000 -M_T0_RID462_S1_NZ_JBDYRX010000001.1:1005315-1005420_length:106_mod0000 -M_T0_RID463_S0_NC_028372.1:9914-9999_length:86_mod0000 -M_T0_RID463_S1_NZ_JBDYSJ010000004.1:218365-218453_length:89_mod0000 -M_T0_RID465_S0_NZ_JBDYSJ010000001.1:787887-787945_length:59_mod0000 -M_T0_RID465_S1_NC_029311.1:1797-1831_length:35_mod0000 -M_T0_RID466_S0_NZ_JBDYRX010000003.1:730520-730588_length:69_mod0000 -M_T0_RID470_S1_NC_033820.1:3073-3102_length:30_mod0000 -M_T0_RID471_S1_NZ_JBDYLZ010000008.1:35202-35290_length:89_mod0000 -M_T0_RID472_S0_NZ_JBDYLZ010000011.1:10802-10846_length:45_mod0000 -M_T0_RID472_S1_NZ_JBDYRX010000001.1:652634-652707_length:74_mod0000 -M_T0_RID474_S0_NC_030225.1:5289-5336_length:48_mod0000 -M_T0_RID475_S0_NZ_JBDYLZ010000006.1:151548-151631_length:84_mod0000 -M_T0_RID475_S0_NZ_JBDYRX010000002.1:464041-464153_length:113_mod0000 -M_T0_RID476_S0_NZ_JBDYLZ010000015.1:62860-62918_length:59_mod0000 -M_T0_RID477_S0_NC_027214.1:4315-4391_length:77_mod0000 -M_T0_RID477_S0_NC_030231.1:4362-4445_length:84_mod0000 -M_T0_RID477_S1_NC_027926.1:5336-5385_length:50_mod0000 -M_T0_RID479_S0_NC_034240.1:10006-10105_length:100_mod0000 -M_T0_RID479_S0_NC_034377.1:6973-7006_length:34_mod0000 -M_T0_RID479_S1_NC_029309.1:1183-1291_length:109_mod0000 -M_T0_RID479_S1_NZ_JBDYRX010000004.1:294593-294685_length:93_mod0000 -M_T0_RID480_S0_NC_030148.1:14092-14146_length:55_mod0000 -M_T0_RID481_S1_NC_027920.1:4910-4956_length:47_mod0000 -M_T0_RID481_S1_NC_028252.1:1447-1525_length:79_mod0000 -M_T0_RID481_S1_NC_029038.1:3990-4034_length:45_mod0000 -M_T0_RID482_S0_NC_031287.1:3748-3826_length:79_mod0000 -M_T0_RID483_S0_NC_029311.1:111589-111673_length:85_mod0000 -M_T0_RID484_S0_NZ_JBDYRX010000001.1:874633-874662_length:30_mod0000 -M_T0_RID484_S1_NZ_JBDYRX010000002.1:457659-457735_length:77_mod0000 -M_T0_RID487_S0_NC_023339.1:3452-3542_length:91_mod0000 -M_T0_RID488_S1_NC_030800.1:3767-3843_length:77_mod0000 -M_T0_RID490_S1_NC_028249.1:6706-6755_length:50_mod0000 -M_T0_RID490_S1_NC_033815.1:382-420_length:39_mod0000 -M_T0_RID491_S0_NC_029549.1:1543-1601_length:59_mod0000 -M_T0_RID491_S1_NC_023442.1:106362-106456_length:95_mod0001 -M_T0_RID491_S1_NZ_JBDYSJ010000002.1:433503-433622_length:120_mod0000 -M_T0_RID492_S1_NC_017967.1:4737-4790_length:54_mod0000 -M_T0_RID497_S1_NC_028231.1:2435-2530_length:96_mod0000 -M_T0_RID498_S1_NC_028368.1:10324-10389_length:66_mod0000 -M_T0_RID498_S1_NC_031088.1:10285-10350_length:66_mod0000 -M_T0_RID499_S0_NZ_JBDYLZ010000012.1:63930-64011_length:82_mod0000 -M_T0_RID500_S0_NZ_JBDYSJ010000003.1:369722-369827_length:106_mod0000 -M_T0_RID501_S0_NC_034214.1:4534-4626_length:93_mod0000 -M_T0_RID503_S1_NZ_JBDYLZ010000014.1:65584-65643_length:60_mod0001 -M_T0_RID504_S0_NC_033727.1:6181-6283_length:103_mod0000 -M_T0_RID504_S0_NC_037572.1:353-481_length:129_mod0000 -M_T0_RID506_S0_NZ_JBDYSJ010000001.1:230782-230869_length:88_mod0000 -M_T0_RID506_S1_NZ_JBDYRX010000001.1:155361-155441_length:81_mod0000 -M_T0_RID507_S0_NZ_JBDYRX010000001.1:64196-64251_length:56_mod0001 -M_T0_RID507_S0_NZ_JBDYRX010000002.1:311911-312021_length:111_mod0000 -M_T0_RID508_S1_NC_028382.1:618-664_length:47_mod0000 -M_T0_RID509_S0_NZ_JBDYRX010000002.1:83623-83710_length:88_mod0000 -M_T0_RID509_S0_NZ_JBDYSJ010000002.1:32694-32813_length:120_mod0000 -M_T0_RID512_S0_NC_031301.1:7499-7600_length:102_mod0000 -M_T0_RID512_S0_NZ_JBDYSJ010000001.1:497297-497384_length:88_mod0001 -M_T0_RID512_S1_NC_023299.1:173-222_length:50_mod0000 -M_T0_RID514_S0_NC_028144.1:1039-1130_length:92_mod0000 -M_T0_RID515_S1_NC_028239.1:1870-1935_length:66_mod0000 -M_T0_RID516_S0_NC_028099.1:69736-69811_length:76_mod0000 -M_T0_RID518_S0_NZ_JBDYSJ010000002.1:172879-172954_length:76_mod0000 -M_T0_RID518_S1_NC_028374.1:22488-22593_length:106_mod0000 -M_T0_RID519_S0_NZ_JBDYSJ010000004.1:83804-83909_length:106_mod0000 -M_T0_RID519_S1_NC_023442.1:37132-37228_length:97_mod0000 -M_T0_RID520_S1_NC_033821.1:5336-5462_length:127_mod0000 -M_T0_RID521_S1_NC_028362.1:8323-8409_length:87_mod0000 -M_T0_RID521_S1_NC_033620.1:165922-166009_length:88_mod0000 -M_T0_RID526_S0_NZ_JBDYLZ010000008.1:191196-191301_length:106_mod0000 -M_T0_RID527_S0_NZ_JBDYRX010000001.1:664374-664450_length:77_mod0000 -M_T0_RID530_S1_NC_029255.1:118676-118738_length:63_mod0000 -M_T0_RID531_S0_NC_030240.1:18050-18083_length:34_mod0000 -M_T0_RID535_S0_NZ_JBDYRX010000003.1:273784-273814_length:31_mod0000 -M_T0_RID535_S0_NZ_JBDYSJ010000001.1:408974-409045_length:72_mod0000 -M_T0_RID536_S1_NZ_JBDYLZ010000007.1:187492-187559_length:68_mod0001 -M_T0_RID537_S0_NC_031106.1:5925-5990_length:66_mod0000 -M_T0_RID539_S0_NC_023442.1:25605-25715_length:111_mod0000 -M_T0_RID539_S0_NC_030922.1:6177-6250_length:74_mod0000 -M_T0_RID539_S1_NC_033732.1:488-545_length:58_mod0000 -M_T0_RID539_S1_NZ_JBDYRX010000003.1:428710-428748_length:39_mod0000 -M_T0_RID540_S1_NC_028636.1:8122-8203_length:82_mod0000 -M_T0_RID540_S1_NC_033777.1:478-533_length:56_mod0000 -M_T0_RID541_S0_NZ_JBDYLZ010000009.1:17788-17882_length:95_mod0000 -M_T0_RID543_S0_NZ_JBDYLZ010000006.1:137222-137319_length:98_mod0000 -M_T0_RID545_S1_NC_033620.1:141319-141407_length:89_mod0000 -M_T0_RID547_S0_NC_029901.1:2272-2382_length:111_mod0000 -M_T0_RID548_S0_NC_027916.2:50899-50962_length:64_mod0000 -M_T0_RID549_S0_NZ_JBDYRX010000003.1:184280-184329_length:50_mod0000 -M_T0_RID549_S1_NC_027016.1:166476-166540_length:65_mod0001 -M_T0_RID552_S0_NC_031244.1:259-371_length:113_mod0000 -M_T0_RID552_S1_NZ_JBDYSJ010000001.1:904809-904898_length:90_mod0000 -M_T0_RID555_S0_NC_029255.1:86976-87025_length:50_mod0000 -M_T0_RID555_S0_NC_033700.1:23881-23958_length:78_mod0000 -M_T0_RID555_S1_NZ_JBDYSJ010000003.1:459317-459387_length:71_mod0000 -M_T0_RID556_S0_NC_029800.1:2415-2467_length:53_mod0000 -M_T0_RID556_S0_NZ_JBDYRX010000003.1:269557-269627_length:71_mod0000 -M_T0_RID556_S1_NC_018151.1:436-524_length:89_mod0000 -M_T0_RID556_S1_NC_029997.2:2602-2635_length:34_mod0000 -M_T0_RID560_S0_NC_030691.1:8709-8769_length:61_mod0000 -M_T0_RID563_S0_NZ_JBDYSJ010000001.1:279557-279665_length:109_mod0000 -M_T0_RID563_S1_NC_029255.1:16285-16387_length:103_mod0000 -M_T0_RID563_S1_NC_030651.1:8044-8106_length:63_mod0000 -M_T0_RID564_S1_NC_030380.1:905-947_length:43_mod0000 -M_T0_RID566_S0_NZ_JBDYRX010000002.1:228758-228796_length:39_mod0000 -M_T0_RID566_S1_NC_027916.2:158878-158953_length:76_mod0000 -M_T0_RID568_S0_NC_033718.1:5028-5099_length:72_mod0000 -M_T0_RID569_S1_NZ_JBDYSJ010000002.1:4445-4500_length:56_mod0000 -M_T0_RID571_S1_NC_030200.1:53402-53457_length:56_mod0000 -M_T0_RID571_S1_NC_031291.1:6265-6343_length:79_mod0000 -M_T0_RID573_S0_NZ_JBDYSJ010000001.1:821929-821988_length:60_mod0000 -M_T0_RID573_S1_NZ_JBDYRX010000002.1:420333-420420_length:88_mod0000 -M_T0_RID578_S0_NC_028389.1:883-929_length:47_mod0000 -M_T0_RID578_S1_NC_027920.1:2737-2802_length:66_mod0000 -M_T0_RID578_S1_NZ_JBDYRX010000001.1:125147-125264_length:118_mod0000 -M_T0_RID579_S1_NC_028636.1:80919-81006_length:88_mod0000 -M_T0_RID579_S1_NZ_JBDYRX010000003.1:600760-600842_length:83_mod0000 -M_T0_RID579_S1_NZ_JBDYSJ010000001.1:621908-622008_length:101_mod0000 -M_T0_RID580_S0_NC_031236.1:9639-9701_length:63_mod0000 -M_T0_RID580_S0_NC_033620.1:115666-115748_length:83_mod0000 -M_T0_RID584_S1_NZ_JBDYRX010000003.1:30143-30232_length:90_mod0000 -M_T0_RID587_S1_NC_030236.1:1921-2018_length:98_mod0000 -M_T0_RID588_S0_NZ_JBDYRX010000004.1:487902-487980_length:79_mod0000 -M_T0_RID592_S0_NZ_JBDYRX010000004.1:290162-290207_length:46_mod0000 -M_T0_RID596_S0_NC_028491.1:22873-22918_length:46_mod0000 -M_T0_RID597_S0_NZ_JBDYRX010000004.1:248380-248414_length:35_mod0000 -M_T0_RID598_S0_NZ_JBDYLZ010000013.1:99135-99225_length:91_mod0000 -M_T0_RID598_S0_NZ_JBDYRX010000004.1:521129-521194_length:66_mod0000 -M_T0_RID598_S1_NC_027781.1:1542-1623_length:82_mod0000 -M_T0_RID598_S1_NC_033828.1:1452-1571_length:120_mod0000 -M_T0_RID599_S0_NZ_JBDYLZ010000018.1:17132-17215_length:84_mod0000 -M_T0_RID601_S1_NZ_JBDYRX010000004.1:64749-64831_length:83_mod0000 -M_T0_RID601_S1_NZ_JBDYSJ010000004.1:72990-73054_length:65_mod0000 -M_T0_RID603_S1_NZ_JBDYRX010000003.1:148174-148218_length:45_mod0000 -M_T0_RID606_S1_NZ_JBDYRX010000004.1:81494-81540_length:47_mod0000 -M_T0_RID608_S1_NZ_JBDYLZ010000006.1:54120-54159_length:40_mod0000 -M_T0_RID608_S1_NZ_JBDYSJ010000003.1:75571-75624_length:54_mod0000 -M_T0_RID609_S0_NZ_JBDYLZ010000017.1:21746-21833_length:88_mod0000 -M_T0_RID610_S1_NZ_JBDYRX010000004.1:416636-416711_length:76_mod0000 -M_T0_RID617_S1_NZ_JBDYLZ010000013.1:81956-82016_length:61_mod0000 -M_T0_RID618_S0_NZ_JBDYRX010000001.1:154047-154079_length:33_mod0000 -M_T0_RID619_S0_NZ_JBDYRX010000001.1:929162-929284_length:123_mod0000 -M_T0_RID620_S1_NZ_JBDYRX010000004.1:231083-231194_length:112_mod0000 -M_T0_RID622_S0_NC_029117.1:1274-1341_length:68_mod0000 -M_T0_RID625_S1_NZ_JBDYRX010000003.1:351246-351297_length:52_mod0000 -M_T0_RID626_S0_NZ_JBDYRX010000003.1:54224-54264_length:41_mod0000 -M_T0_RID627_S1_NZ_JBDYRX010000002.1:425465-425547_length:83_mod0000 -M_T0_RID629_S1_NC_028264.1:4326-4405_length:80_mod0000 -M_T0_RID630_S0_NZ_JBDYSJ010000002.1:388835-388868_length:34_mod0000 -M_T0_RID633_S1_NZ_JBDYRX010000003.1:253941-254012_length:72_mod0000 -M_T0_RID634_S1_NC_033815.1:2695-2865_length:171_mod0000 -M_T0_RID635_S1_NC_033700.1:17426-17511_length:86_mod0000 -M_T0_RID636_S0_NC_029086.1:7004-7042_length:39_mod0000 -M_T0_RID638_S1_NZ_JBDYSJ010000001.1:82298-82352_length:55_mod0000 -M_T0_RID640_S0_NC_033756.1:5658-5786_length:129_mod0001 -M_T0_RID641_S0_NC_027706.1:187-292_length:106_mod0000 -M_T0_RID642_S0_NC_034266.1:154137-154203_length:67_mod0000 -M_T0_RID642_S0_NZ_JBDYRX010000003.1:290122-290229_length:108_mod0000 -M_T0_RID643_S0_NC_017937.1:1077-1164_length:88_mod0000 -M_T0_RID643_S0_NZ_JBDYRX010000002.1:527817-527928_length:112_mod0000 -M_T0_RID645_S0_NC_030799.1:4650-4688_length:39_mod0000 -M_T0_RID645_S1_NZ_JBDYLZ010000008.1:186276-186348_length:73_mod0000 -M_T0_RID651_S1_NC_033733.1:2956-3039_length:84_mod0001 -M_T0_RID651_S1_NZ_JBDYRX010000001.1:479171-479229_length:59_mod0000 -M_T0_RID653_S1_NC_029311.1:77186-77261_length:76_mod0000 -M_T0_RID654_S0_NZ_JBDYSJ010000001.1:904727-904802_length:76_mod0000 -M_T0_RID655_S0_NZ_JBDYSJ010000001.1:482269-482365_length:97_mod0000 -M_T0_RID655_S1_NZ_JBDYRX010000002.1:520330-520420_length:91_mod0000 -M_T0_RID656_S0_NC_028259.1:1542-1591_length:50_mod0000 -M_T0_RID656_S0_NZ_JBDYLZ010000019.1:6097-6185_length:89_mod0000 -M_T0_RID660_S1_NC_034266.1:157401-157477_length:77_mod0000 -M_T0_RID664_S0_NC_027916.2:59946-59993_length:48_mod0000 -M_T0_RID664_S0_NZ_JBDYLZ010000015.1:82686-82741_length:56_mod0000 -M_T0_RID664_S0_NZ_JBDYSJ010000003.1:87421-87503_length:83_mod0000 -M_T0_RID668_S0_NZ_JBDYRX010000004.1:18573-18663_length:91_mod0000 -M_T0_RID670_S0_NC_027920.1:1301-1393_length:93_mod0000 -M_T0_RID673_S1_NC_033703.1:545-616_length:72_mod0000 -M_T0_RID673_S1_NZ_JBDYRX010000001.1:644803-644895_length:93_mod0000 -M_T0_RID679_S0_NZ_JBDYRX010000002.1:605076-605139_length:64_mod0000 -M_T0_RID679_S1_NC_033703.1:1306-1364_length:59_mod0000 -M_T0_RID680_S0_NZ_JBDYRX010000002.1:632837-632879_length:43_mod0000 -M_T0_RID681_S1_NZ_JBDYSJ010000002.1:496144-496188_length:45_mod0000 -M_T0_RID682_S0_NZ_JBDYSJ010000001.1:116469-116509_length:41_mod0000 -M_T0_RID683_S0_NZ_JBDYRX010000001.1:675311-675352_length:42_mod0000 -M_T0_RID683_S0_NZ_JBDYSJ010000004.1:71365-71456_length:92_mod0000 -M_T0_RID683_S1_NC_029255.1:7610-7675_length:66_mod0000 -M_T0_RID686_S0_NC_027429.1:2932-2966_length:35_mod0000 -M_T0_RID686_S1_NC_027923.1:107955-107999_length:45_mod0000 -M_T0_RID686_S1_NC_029132.1:95050-95160_length:111_mod0000 -M_T0_RID689_S1_NZ_JBDYSJ010000004.1:138231-138318_length:88_mod0000 -M_T0_RID691_S1_NC_033710.1:3870-3926_length:57_mod0000 -M_T0_RID692_S1_NC_027531.1:1508-1612_length:105_mod0000 -M_T0_RID695_S0_NC_030200.1:124072-124139_length:68_mod0000 -M_T0_RID697_S0_NC_028921.1:5390-5470_length:81_mod0000 -M_T0_RID699_S0_NC_031083.1:4910-4975_length:66_mod0000 -M_T0_RID699_S1_NZ_JBDYLZ010000010.1:101894-101946_length:53_mod0000 -M_T0_RID700_S1_NZ_JBDYSJ010000001.1:915360-915453_length:94_mod0000 -M_T0_RID702_S1_NC_028099.1:63829-63929_length:101_mod0000 -M_T0_RID706_S0_NC_027210.1:7432-7505_length:74_mod0000 -M_T0_RID707_S1_NZ_JBDYRX010000002.1:367432-367522_length:91_mod0001 -M_T0_RID707_S1_NZ_JBDYSJ010000004.1:260063-260128_length:66_mod0000 -M_T0_RID709_S1_NZ_JBDYRX010000003.1:29327-29484_length:158_mod0000 -M_T0_RID710_S1_NC_033720.1:7987-8089_length:103_mod0000 -M_T0_RID711_S0_NZ_JBDYLZ010000006.1:173182-173278_length:97_mod0000 -M_T0_RID711_S1_NC_033700.1:20537-20567_length:31_mod0000 -M_T0_RID711_S1_NZ_JBDYSJ010000001.1:181184-181271_length:88_mod0000 -M_T0_RID714_S0_NC_037612.1:3005-3122_length:118_mod0000 -M_T0_RID715_S0_NC_027788.1:468-551_length:84_mod0000 -M_T0_RID715_S1_NZ_JBDYLZ010000006.1:219162-219260_length:99_mod0000 -M_T0_RID717_S0_NC_030654.1:1669-1721_length:53_mod0000 -M_T0_RID719_S1_NZ_JBDYSJ010000001.1:826609-826678_length:70_mod0000 -M_T0_RID722_S1_NC_027923.1:41169-41259_length:91_mod0001 -M_T0_RID727_S0_NC_029997.2:28478-28523_length:46_mod0000 -M_T0_RID728_S0_NZ_JBDYRX010000002.1:879157-879230_length:74_mod0000 -M_T0_RID729_S1_NZ_JBDYLZ010000008.1:194207-194253_length:47_mod0000 -M_T0_RID731_S1_NC_030117.1:17286-17318_length:33_mod0000 -M_T0_RID736_S0_NZ_JBDYRX010000001.1:178466-178588_length:123_mod0000 -M_T0_RID737_S0_NC_028491.1:18226-18284_length:59_mod0000 -M_T0_RID739_S1_NZ_JBDYLZ010000011.1:127333-127376_length:44_mod0000 -M_T0_RID743_S0_NC_037573.1:1169-1247_length:79_mod0000 -M_T0_RID747_S1_NZ_JBDYRX010000002.1:430138-430204_length:67_mod0000 -M_T0_RID749_S1_NZ_JBDYRX010000003.1:71924-71986_length:63_mod0000 -M_T0_RID752_S0_NC_031336.1:9006-9046_length:41_mod0000 -M_T0_RID753_S0_NZ_JBDYSJ010000003.1:446526-446575_length:50_mod0000 -M_T0_RID757_S0_NC_028136.1:1312-1355_length:44_mod0000 -M_T0_RID757_S1_NC_027016.1:202899-202969_length:71_mod0000 -M_T0_RID757_S1_NZ_JBDYRX010000004.1:461576-461693_length:118_mod0000 -M_T0_RID759_S1_NC_029691.1:3622-3733_length:112_mod0000 -M_T0_RID763_S1_NC_027916.2:99012-99086_length:75_mod0000 -M_T0_RID763_S1_NC_028265.1:10302-10344_length:43_mod0000 -M_T0_RID763_S1_NC_030798.1:7132-7233_length:102_mod0000 -M_T0_RID763_S1_NZ_JBDYLZ010000015.1:37189-37249_length:61_mod0000 -M_T0_RID765_S0_NC_028261.1:4356-4443_length:88_mod0000 -M_T0_RID767_S1_NC_027916.2:86943-87045_length:103_mod0000 -M_T0_RID768_S0_NC_028491.1:2854-2933_length:80_mod0000 -M_T0_RID768_S0_NC_030200.1:40203-40312_length:110_mod0000 -M_T0_RID771_S0_NZ_JBDYLZ010000019.1:13804-13871_length:68_mod0000 -M_T0_RID778_S1_NC_031275.1:5153-5201_length:49_mod0000 -M_T0_RID781_S1_NZ_JBDYRX010000003.1:540287-540355_length:69_mod0000 -M_T0_RID783_S1_NZ_JBDYLZ010000010.1:89260-89349_length:90_mod0000 -M_T0_RID785_S1_NC_027199.1:11719-11818_length:100_mod0000 -M_T0_RID786_S1_NZ_JBDYLZ010000008.1:173777-173859_length:83_mod0000 -M_T0_RID788_S0_NC_030922.1:1394-1483_length:90_mod0000 -M_T0_RID793_S0_NZ_JBDYRX010000003.1:539904-539954_length:51_mod0001 -M_T0_RID797_S1_NZ_JBDYRX010000004.1:414620-414694_length:75_mod0000 -M_T0_RID807_S1_NC_030117.1:45331-45378_length:48_mod0000 -M_T0_RID810_S0_NC_028491.1:85062-85136_length:75_mod0001 -M_T0_RID811_S1_NC_030697.1:295-351_length:57_mod0000 -M_T0_RID813_S1_NC_027016.1:91244-91325_length:82_mod0000 -M_T0_RID817_S1_NC_030240.1:108663-108730_length:68_mod0001 -M_T0_RID823_S0_NC_033620.1:158427-158465_length:39_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000003.1:241332-241406_length:75_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000004.1:228843-228928_length:86_mod0000 -M_T0_RID827_S0_NZ_JBDYSJ010000004.1:239871-239973_length:103_mod0000 -M_T0_RID832_S0_NZ_JBDYLZ010000015.1:88774-88854_length:81_mod0000 -M_T0_RID833_S0_NZ_JBDYSJ010000001.1:590978-591039_length:62_mod0000 -M_T0_RID837_S1_NZ_JBDYRX010000001.1:656888-656964_length:77_mod0000 -M_T0_RID840_S0_NC_028396.1:529-621_length:93_mod0000 -M_T0_RID844_S1_NZ_JBDYLZ010000007.1:237741-237786_length:46_mod0000 -M_T0_RID847_S0_NZ_JBDYRX010000003.1:703429-703507_length:79_mod0000 -M_T0_RID852_S0_NC_030240.1:105292-105367_length:76_mod0000 -M_T0_RID856_S0_NZ_JBDYRX010000003.1:28070-28132_length:63_mod0000 -M_T0_RID856_S1_NC_027644.1:3712-3804_length:93_mod0000 -M_T0_RID858_S0_NZ_JBDYSJ010000003.1:197400-197485_length:86_mod0000 -M_T0_RID858_S1_NZ_JBDYSJ010000004.1:175908-175948_length:41_mod0000 -M_T0_RID859_S0_NC_033777.1:2010-2066_length:57_mod0000 -M_T0_RID862_S1_NC_030799.1:1806-1881_length:76_mod0000 -M_T0_RID865_S1_NZ_JBDYSJ010000002.1:326035-326087_length:53_mod0000 -M_T0_RID873_S1_NC_028119.1:2502-2583_length:82_mod0000 -M_T0_RID880_S0_NC_033620.1:55069-55148_length:80_mod0000 -M_T0_RID882_S0_NZ_JBDYRX010000002.1:484332-484416_length:85_mod0000 -M_T0_RID882_S1_NC_034266.1:103121-103153_length:33_mod0000 -M_T0_RID885_S0_NZ_JBDYRX010000003.1:244205-244252_length:48_mod0000 -M_T0_RID885_S1_NC_036636.1:5051-5143_length:93_mod0000 -M_T0_RID887_S0_NC_029132.1:58239-58309_length:71_mod0000 -M_T0_RID895_S1_NZ_JBDYRX010000004.1:290403-290535_length:133_mod0000 -M_T0_RID900_S0_NZ_JBDYRX010000003.1:442650-442708_length:59_mod0000 -M_T0_RID903_S0_NC_029994.1:1129-1161_length:33_mod0000 -M_T0_RID910_S1_NC_030801.1:531-591_length:61_mod0000 -M_T0_RID913_S1_NZ_JBDYSJ010000001.1:289314-289350_length:37_mod0000 -M_T0_RID923_S1_NC_028374.1:1835-1919_length:85_mod0000 -M_T0_RID930_S0_NC_033727.1:5848-5935_length:88_mod0000 -M_T0_RID941_S0_NZ_JBDYLZ010000020.1:17961-18008_length:48_mod0000 -M_T0_RID951_S0_NZ_JBDYLZ010000007.1:258088-258169_length:82_mod0000 -M_T0_RID960_S1_NZ_JBDYRX010000001.1:365497-365549_length:53_mod0000 -M_T0_RID963_S0_NZ_JBDYSJ010000002.1:471116-471242_length:127_mod0000 -M_T0_RID967_S0_NC_028145.1:2423-2491_length:69_mod0000 -M_T0_RID969_S1_NC_027917.1:3392-3477_length:86_mod0000 -M_T0_RID973_S1_NC_028243.1:233-298_length:66_mod0000 -M_T0_RID975_S0_NZ_JBDYLZ010000006.1:262785-262833_length:49_mod0000 -M_T0_RID977_S0_NC_029311.1:110890-110930_length:41_mod0000 -M_T0_RID978_S1_NC_033707.1:4471-4569_length:99_mod0000 -M_T0_RID978_S1_NZ_JBDYLZ010000011.1:12262-12308_length:47_mod0000 -M_T0_RID987_S1_NZ_JBDYRX010000002.1:268856-268924_length:69_mod0000 -M_T0_RID993_S0_NZ_JBDYSJ010000002.1:495946-496025_length:80_mod0000 -M_T0_RID997_S0_NC_029303.1:1692-1771_length:80_mod0000 -M_T0_RID1003_S0_NZ_JBDYSJ010000001.1:678727-678783_length:57_mod0000 -M_T0_RID1022_S1_NC_030746.1:3635-3726_length:92_mod0000 -M_T0_RID1023_S1_NZ_JBDYLZ010000006.1:264893-265013_length:121_mod0000 -M_T0_RID1048_S0_NZ_JBDYLZ010000008.1:126930-127042_length:113_mod0000 -M_T0_RID1070_S0_NZ_JBDYRX010000003.1:112054-112158_length:105_mod0000 -M_T0_RID250_S0_NC_028636.1:14337-14398_length:62_mod0000 diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/config.yaml b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/config.yaml deleted file mode 100644 index ae3df34..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/config.yaml +++ /dev/null @@ -1,142 +0,0 @@ - -# - Only tested with Phred33 quality scores - -samples: config/samples.tsv - -units: config/units.tsv - - - -############# -### READS ### -############# -trim: - trim: - activate: true - tool: adapterremoval - params: "--trimns --maxns 10 --trimqualities --minlength 30 --mask-degenerate-bases --seed 12345" - - # Ignored for SE - collapse: - activate: true - params: "--collapse-conservatively" - -derep: - extension: - activate: false - k: 16 - params: "ibb=t prefilter=0 el=100 er=100 ecc=f ecco=f ignorebadquality extendrollback=0" - - derep: - activate: true - # vsearch or seqkit - tool: seqkit - params: "" - - low_complex: - params: "entropy=0.7 entropywindow=30 entropyk=4" - - - -############# -### ALIGN ### -############# -prefilter: - taxa: "Bacteria,Archaea,Viruses" - - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: - prok: - n_shards: 2 - path: "data/prok.{n_shard}-of-2.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal -N 1" - bt2l: False - acc2taxid: "data/prok.acc2taxid.gz" - virus: - n_shards: 1 - path: "data/virus.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/virus.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 25 --weight_type 1 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2" - - -euk: - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: - mitoch: - n_shards: 1 - path: "data/mitoch.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/mitoch.acc2taxid.gz" - plastid: - n_shards: 1 - path: "data/plastid.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/plastid.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 15 --sim_score_low 0.95 --weight_type 0 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2 --seed 12345" - - -############ -## REPORT ## -############ -report: - multiqc: "--no-ai --verbose --cl-config 'custom_logo: data/KU_long.png' --cl-config 'custom_logo_title: CAEG - Center for Ancient Environmental Genomics' --cl-config 'custom_logo_url: https://globe.ku.dk/research/caeg/'" - multiqc_db_url: "test_qc.sqlite" diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/samples.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/samples.tsv deleted file mode 100644 index 5994081..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/samples.tsv +++ /dev/null @@ -1,2 +0,0 @@ -sample alias group condition -Lib ancient diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/units.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/units.tsv deleted file mode 100644 index 4a8a376..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/units.tsv +++ /dev/null @@ -1,4 +0,0 @@ -sample library flowcell lane seq_type library_type material data machine run_n sample_n date center platform adapters -Lib LVsim1 BHXXXXXXXX L001 PE ds DNA data/test_L001_R{Read}.fq.gz SIMULATED 0000 S1 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Lib LVsim1 BHXXXXXXXX L002 PE ds DNA data/test_L002_R{Read}.fq.gz SIMULATED 0000 S2 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Lib LVsim2 BHXXXXXXXX L001 PE ds DNA data/test_L003_R{Read}.fq.gz SIMULATED 0000 S3 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/prok.acc2taxid.gz b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/prok.acc2taxid.gz deleted file mode 100644 index 5dbe5f2..0000000 Binary files a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/prok.acc2taxid.gz and /dev/null differ diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/names.dmp b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/names.dmp deleted file mode 100644 index a2db560..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/names.dmp +++ /dev/null @@ -1,6450 +0,0 @@ -1 | all | | synonym -1 | root | | scientific name -2 | "Bacteria" Cavalier-Smith 1987 | | authority -2 | "Bacteriobiota" Luketa 2012 | | authority -2 | Bacteria | Bacteria | scientific name -2 | Bacteria (ex Cavalier-Smith 1987) | | synonym -2 | Bacteria Woese et al. 2024 | | synonym -2 | Bacteriobiota | | synonym -2 | Monera | Monera | in-part -2 | Procaryotae | Procaryotae | in-part -2 | Prokaryota | Prokaryota | in-part -2 | Prokaryotae | Prokaryotae | in-part -2 | bacteria | bacteria | blast name -2 | bacteria | bacteria | genbank common name -2 | eubacteria | | common name -2 | prokaryote | prokaryote | in-part -2 | prokaryotes | prokaryotes | in-part -543 | Enterobacteraceae | | synonym -543 | Enterobacteraceae (ex Lapage 1979) Lapage 1982 | | authority -543 | Enterobacteriaceae | | scientific name -543 | Enterobacteriaceae (ex Rahn 1937) Ewing et al. 1980 | | authority -543 | Enterobacteriaceae Rahn 1937 (Approved Lists 1980) emend. Adeolu et al. 2016 | | authority -543 | enterobacteria | enterobacteria | blast name -543 | enterobacteria | enterobacteria | genbank common name -543 | gamma-3 proteobacteria | gamma-3 proteobacteria | in-part -548 | "Aerobacter aerogenes" Hormaeche and Edwards 1958 | | authority -548 | ATCC 13048 | ATCC 13048 | type material -548 | Aerobacter aerogenes | | synonym -548 | CCUG 1429 | CCUG 1429 | type material -548 | CIP 60.86 | CIP 60.86 | type material -548 | DSM 30053 | DSM 30053 | type material -548 | Enterobacter aerogenes | | synonym -548 | Enterobacter aerogenes Hormaeche and Edwards 1960 | | authority -548 | HAMBI 101 | HAMBI 101 | type material -548 | HAMBI 1898 | HAMBI 1898 | type material -548 | IFO 13534 | IFO 13534 | type material -548 | JCM 1235 | JCM 1235 | type material -548 | KCTC 2190 | KCTC 2190 | type material -548 | Klebsiella aerogenes | | scientific name -548 | Klebsiella aerogenes (Hormaeche and Edwards 1960) Tindall et al. 2017 | | authority -548 | Klebsiella mobilis | | synonym -548 | Klebsiella mobilis Bascomb et al. 1971 | | authority -548 | LMG 2094 | LMG 2094 | type material -548 | LMG:2094 | LMG:2094 | type material -548 | NBRC 13534 | NBRC 13534 | type material -548 | NCAIM B.01467 | NCAIM B.01467 | type material -548 | NCTC 10006 | NCTC 10006 | type material -568 | Hafnia | | scientific name -568 | Hafnia Moller 1954 | | authority -570 | "Donovania" Anderson et al. 1944 | | authority -570 | "Hyalococcus" Schroeter 1886 | | authority -570 | Calymmatobacterium | | synonym -570 | Calymmatobacterium Aragao and Vianna 1913 | | authority -570 | Donovania | | synonym -570 | Hyalococcus | | synonym -570 | Klebsiella | | scientific name -570 | Klebsiella Trevisan 1885 (Approved Lists 1980) | | authority -570 | Klebsiella Trevisan 1885 (Approved Lists 1980) emend. Carter et al. 1999 | | authority -570 | Klebsiella Trevisan 1885 (Approved Lists 1980) emend. Drancourt et al. 2001 | | authority -570 | Klebsiella Trevisan 1885 (Approved Lists 1980) emend. Ma et al. 2021 | | authority -573 | "Bacillus pneumoniae" (Schroeter 1886) Flugge 1886 | | authority -573 | "Bacterium pneumoniae crouposae" Zopf 1885 | | authority -573 | "Hyalococcus pneumoniae" Schroeter 1886 | | authority -573 | 'Klebsiella aerogenes' (Kruse) Taylor et al. 1956 | | synonym -573 | ATCC 13883 | ATCC 13883 | type material -573 | Bacillus pneumoniae | | synonym -573 | Bacterium pneumoniae crouposae | | synonym -573 | CCUG 225 | CCUG 225 | type material -573 | CDC 298-53 | CDC 298-53 | type material -573 | CIP 82.91 | CIP 82.91 | type material -573 | DSM 30104 | DSM 30104 | type material -573 | HAMBI 450 | HAMBI 450 | type material -573 | Hyalococcus pneumoniae | | synonym -573 | IAM 14200 | IAM 14200 | type material -573 | IFO 14940 | IFO 14940 | type material -573 | JCM 1662 | JCM 1662 | type material -573 | Klebsiella pneumoniae | | scientific name -573 | Klebsiella pneumoniae (Schroeter 1886) Trevisan 1887 | | authority -573 | Klebsiella pneumoniae aerogenes | | synonym -573 | Klebsiella sp. 2N3 | | includes -573 | Klebsiella sp. C1(2016) | | includes -573 | Klebsiella sp. M-AI-2 | | includes -573 | Klebsiella sp. PB12 | | includes -573 | Klebsiella sp. RCE-7 | | includes -573 | LMG 2095 | LMG 2095 | type material -573 | LMG:2095 | LMG:2095 | type material -573 | NBRC 14940 | NBRC 14940 | type material -573 | NCTC 9633 | NCTC 9633 | type material -574 | "Bacillus mucosus azaenae" Abel 1893 | | authority -574 | "Bacillus ozaenae" Abel 1893 | | authority -574 | "Bacterium ozaenae" (Abel 1893) Lehmann and Neumann 1896 | | authority -574 | ATCC 11296 | ATCC 11296 | type material -574 | Bacillus mucosus azaenae | | synonym -574 | Bacillus ozaenae | | synonym -574 | Bacterium ozaenae | | synonym -574 | CCUG 15938 | CCUG 15938 | type material -574 | CIP 52.211 | CIP 52.211 | type material -574 | DSM 16358 | DSM 16358 | type material -574 | JCM 1663 | JCM 1663 | type material -574 | Klebsiella ozaenae | | synonym -574 | Klebsiella ozaenae (Abel 1893) Bergey et al. 1925 (Approved Lists 1980) | | authority -574 | Klebsiella pneumoniae (SUBSP. OZAENAE) | | synonym -574 | Klebsiella pneumoniae ozaenae | | synonym -574 | Klebsiella pneumoniae subsp. ozaenae | | scientific name -574 | Klebsiella pneumoniae subsp. ozaenae (Abel 1893) Orskov 1984 | | authority -574 | Klebsiella sp. VTT E-96667 | | includes -574 | LMG 3113 | LMG 3113 | type material -574 | LMG:3113 | LMG:3113 | type material -574 | NBRC 105683 | NBRC 105683 | type material -574 | NBRC-105683 | NBRC-105683 | type material -574 | NBRC105683 | NBRC105683 | type material -574 | NBRC:105683 | NBRC:105683 | type material -574 | NCTC 5050 | NCTC 5050 | type material -1224 | "Alphaproteobacteriota" Whitman et al. 2018 | | synonym -1224 | "Proteobacteria" Garrity et al. 2005 | | authority -1224 | "Proteobacteriota" Panda et al. 2022 | | authority -1224 | Alphaproteobacteriota | | synonym -1224 | Proteobacteria | | synonym -1224 | Proteobacteria Stackebrandt et al. 1988 | | authority -1224 | Proteobacteriota | | synonym -1224 | Pseudomonadota | | scientific name -1224 | Pseudomonadota corrig. Garrity et al. 2021 | | authority -1224 | proteobacteria | proteobacteria | blast name -1224 | proteobacteria | proteobacteria | genbank common name -1224 | purple photosynthetic bacteria and relatives | | common name -1236 | "Pseudomonadia" Oren et al. 2016 | | authority -1236 | Gammaproteobacteria | | scientific name -1236 | Gammaproteobacteria Garrity et al. 2005 emend. Williams and Kelly 2013 | | authority -1236 | Proteobacteria gamma subdivision | | synonym -1236 | Pseudomonadia | | synonym -1236 | Purple bacteria, gamma subdivision | | synonym -1236 | g-proteobacteria | g-proteobacteria | blast name -1236 | g-proteobacteria | g-proteobacteria | genbank common name -1236 | gamma proteobacteria | | synonym -1236 | gamma subdivision | | synonym -1236 | gamma subgroup | | synonym -2157 | "Archaea" Woese et al. 1990 | | authority -2157 | "Archaebacteria" (sic) Woese and Fox 1977 | | authority -2157 | "Archaebiota" Luketa 2012 | | authority -2157 | Archaea | | scientific name -2157 | Archaea Woese et al. 2024 | | authority -2157 | Archaebacteria | | synonym -2157 | Archaebiota | | synonym -2157 | Mendosicutes | | synonym -2157 | Metabacteria | | synonym -2157 | Monera | Monera | in-part -2157 | Procaryotae | Procaryotae | in-part -2157 | Prokaryota | Prokaryota | in-part -2157 | Prokaryotae | Prokaryotae | in-part -2157 | archaea | | blast name -2157 | prokaryote | prokaryote | in-part -2157 | prokaryotes | prokaryotes | in-part -2235 | "Haloarchaeales" DasSarma and DasSarma 2008 | | authority -2235 | Haloarchaeales | | synonym -2235 | Halobacteriales | | scientific name -2235 | Halobacteriales Grant and Larsen 1989 | | authority -2235 | Halobacteriales Grant and Larsen 1989 emend. Gupta et al. 2015 | | authority -2235 | Haloferacales | | synonym -2235 | Haloferacales Gupta et al. 2015 | | authority -2235 | Natrialbales | | synonym -2235 | Natrialbales Gupta et al. 2015 | | authority -2759 | Eucarya | | synonym -2759 | Eucaryotae | | synonym -2759 | Eukarya | | synonym -2759 | Eukaryota | | scientific name -2759 | Eukaryotae | | synonym -2759 | eukaryotes | eukaryotes | blast name -2759 | eukaryotes | eukaryotes | genbank common name -2763 | Rhodophyceae | | synonym -2763 | Rhodophycota | | synonym -2763 | Rhodophyta | | scientific name -2763 | algae | algae | in-part -2763 | red algae | red algae | blast name -2763 | red algae | red algae | genbank common name -2763 | rhodophytes | | common name -2781 | Gracilariopsis | | scientific name -2781 | Gracilariopsis E.Y.Dawson, 1949 | | authority -2806 | Florideophyceae | | scientific name -2806 | Florideophycideae | | synonym -2870 | Chromophycota | | synonym -2870 | Fucophyceae | | synonym -2870 | Phaeophyceae | | scientific name -2870 | Phaeophyta | | synonym -2870 | algae | algae | in-part -2870 | brown algae | brown algae | blast name -2870 | brown algae | brown algae | genbank common name -2886 | Laminariales | | scientific name -2887 | Alariaceae | | scientific name -2888 | Alaria | Alaria | scientific name -3041 | Chlorophycota | | synonym -3041 | Chlorophyta | | scientific name -3041 | Chlorophyta Pascher, 1914 | | authority -3041 | Chlorophyta sensu Bremer 1985 | | synonym -3041 | Prasinophyceae | | includes -3041 | algae | algae | in-part -3041 | green algae | green algae | blast name -3041 | green algae | green algae | genbank common name -3041 | prasinophyte clade VII | | includes -3041 | prasinophytes | prasinophytes | in-part -3166 | Chlorophyceae | | scientific name -3166 | Chlorophyceae Christensen, 1994 | | authority -3176 | Zygnematales | | scientific name -3176 | Zygnematales C.E.Bessey, 1907 | | authority -3178 | Zygnemataceae | | scientific name -3178 | Zygnemataceae Kuetzing, 1843 | | authority -3193 | Embryophyta | | scientific name -3193 | higher plants | | common name -3193 | land plants | land plants | blast name -3193 | land plants | land plants | genbank common name -3193 | plants | | common name -3208 | Bryophyta | | scientific name -3208 | Musci | | synonym -3208 | bryophytes | bryophytes | in-part -3208 | mosses | mosses | blast name -3208 | mosses | mosses | genbank common name -3214 | Bryopsida | | scientific name -3214 | Bryopsida Pax, 1900 | | authority -3296 | Cycadophyta | | equivalent name -3296 | Cycadopsida | | scientific name -3296 | cycads | | genbank common name -3297 | Cycadales | | scientific name -3297 | Cycadales Pers. ex Bercht. & J.Presl, 1820 | | authority -3313 | Coniferales | | synonym -3313 | Pinidae | | scientific name -3313 | Pinidae Cronquist, Takht. & Zimmerm., 1966 | | authority -3394 | Cycadaceae | | scientific name -3394 | Cycadaceae Pers., 1807 | | authority -3395 | Cycas | | scientific name -3395 | Cycas L. | | authority -3395 | Epicycas | | synonym -3395 | Epicycas de Laub. | | authority -3398 | Angiospermae | | synonym -3398 | Magnoliophyta | | synonym -3398 | Magnoliopsida | | scientific name -3398 | angiosperms | | common name -3398 | flowering plants | flowering plants | blast name -3398 | flowering plants | flowering plants | genbank common name -3400 | Magnoliales | | scientific name -3400 | Magnoliales Bromhead, 1838 | | authority -3400 | Magnolianae | | in-part -3400 | Magnoliineae | | includes -3401 | Magnoliaceae | | scientific name -3401 | Magnoliaceae Juss., 1789 | | authority -3401 | magnolia family | | common name -3402 | Alcimandra | | synonym -3402 | Alcimandra Dandy, 1927 | | authority -3402 | Aromadendron | | synonym -3402 | Aromadendron Blume, 1825 | | authority -3402 | Dugandiodendron | | synonym -3402 | Dugandiodendron Lozano, 1975 | | authority -3402 | Elmerrillia | | synonym -3402 | Elmerrillia Dandy, 1927 | | authority -3402 | Kmeria | | synonym -3402 | Kmeria Dandy, 1927 | | authority -3402 | Lirianthe | | synonym -3402 | Lirianthe Spach, 1839 | | authority -3402 | Magnolia | | scientific name -3402 | Magnolia L., 1753 | | authority -3402 | Michelia | | synonym -3402 | Michelia L., 1753 | | authority -3402 | Pachylarnax | | synonym -3402 | Pachylarnax Dandy, 1927 | | authority -3402 | Parakmeria | | synonym -3402 | Parakmeria Hu & W.C.Cheng, 1951 | | authority -3402 | Talauma | | synonym -3402 | Talauma Juss., 1789 | | authority -3402 | Tsoongiodendron | | includes -3440 | Ranunculaceae | | scientific name -3440 | Ranunculaceae Juss., 1789 | | authority -3440 | buttercup family | | common name -3487 | Moraceae | | scientific name -3487 | Moraceae Gaudich., 1835 | | authority -3487 | mulberry family | | common name -3502 | Casuarinales | | includes -3502 | Casuarinales Bercht. & J. Presl, 1820 | | authority -3502 | Fagales | | scientific name -3502 | Fagales Engl., 1892 | | authority -3502 | Juglandales | | includes -3502 | Juglandales Bercht. & J. Presl, 1820 | | authority -3502 | Myricineae | | includes -3503 | Fagaceae | | scientific name -3503 | Fagaceae Dumort., 1829 | | authority -3503 | beech family | | common name -3511 | Quercus | | scientific name -3511 | Quercus L. | | authority -3524 | Caryophyllales | | scientific name -3524 | Caryophyllales Juss. ex Bercht. & J.Presl, 1820 | | authority -3524 | Centrospermae | | synonym -3524 | Nepenthineae | | includes -3524 | Physenales | | includes -3524 | Polygonales | | includes -3650 | Cucurbitaceae | | scientific name -3650 | Cucurbitaceae Juss., 1789 | | authority -3650 | cucumber family | | common name -3669 | Luffa | | scientific name -3669 | Luffa Mill., 1754 | | authority -3744 | Rhamnales | | includes -3744 | Rosales | | scientific name -3744 | Rosales Bercht. & J.Presl, 1820 | | authority -3744 | Rosanae | | includes -3744 | Urticales | | includes -3745 | Malaceae | | synonym -3745 | Malaceae Sm., 1903 | | authority -3745 | Rosaceae | | scientific name -3745 | Rosaceae Juss., 1789 | | authority -3745 | rose family | | common name -3764 | Rosa | | scientific name -3764 | Rosa L., 1753 | | authority -3803 | Fabaceae | | scientific name -3803 | Fabaceae Lindl., 1836 | | authority -3803 | Leguminosae | | synonym -3803 | pea family | | common name -3814 | Faboideae | | synonym -3814 | Faboideae Rudd, 1968 | | authority -3814 | Papilionoideae | | scientific name -3841 | Erythrina | | scientific name -3841 | Erythrina L. | | authority -4011 | Anacardiaceae | | scientific name -4011 | Anacardiaceae R.Br., 1818 | | authority -4011 | sumac family | | common name -4036 | Apiales | | scientific name -4036 | Apiales Nakai, 1930 | | authority -4036 | Araliales | | synonym -4036 | Araliales Juss. ex Bercht. & J.Presl, 1820 | | authority -4037 | Apiaceae | | scientific name -4037 | Apiaceae Lindl., 1836 | | authority -4037 | Umbelliferae | | synonym -4037 | carrot family | | common name -4055 | Gentianales | | scientific name -4055 | Gentianales Juss. ex Bercht. & J.Presl, 1820 | | authority -4143 | Lamiales | | scientific name -4143 | Lamiales Bromhead, 1838 | | authority -4143 | Scrophulariales | | includes -4149 | Buddlejaceae | | includes -4149 | Buddlejaceae K.Wilh., 1910 | | authority -4149 | Myoporaceae | | includes -4149 | Myoporaceae R.Br., 1810 | | authority -4149 | Scrophulariaceae | Scrophulariaceae | scientific name -4149 | Scrophulariaceae Juss., 1789 | | authority -4149 | Selaginaceae | | includes -4149 | Selaginaceae Choisy, 1823 | | authority -4149 | figwort family | | common name -4199 | Dipsacales | | scientific name -4199 | Dipsacales Juss. ex Bercht. & J.Presl, 1820 | | authority -4200 | Caprifoliaceae | | scientific name -4200 | Caprifoliaceae Juss., 1789 | | authority -4200 | honeysuckle famly | | common name -4209 | Asterales | | scientific name -4209 | Asterales Link, 1829 | | authority -4209 | Campanulales | | includes -4210 | Asteraceae | | scientific name -4210 | Asteraceae Bercht. & J.Presl, 1820 | | authority -4210 | Compositae | | equivalent name -4210 | daisy family | | common name -4231 | Helianthus | | scientific name -4231 | Helianthus L., 1753 | | authority -4231 | sunflowers | | common name -4321 | Icacinaceae | Icacinaceae | scientific name -4321 | Icacinaceae Miers, 1851 | | authority -4447 | Liliopsida | | scientific name -4447 | Monocotyledoneae | | synonym -4447 | monocots | monocots | blast name -4447 | monocots | monocots | genbank common name -4447 | monocotyledons | | common name -4454 | Araceae | | scientific name -4454 | Araceae Juss., 1789 | | authority -4454 | Lemnaceae | | includes -4454 | arum family | | common name -4479 | Bambusaceae | | synonym -4479 | Bambusaceae Nakai, 1943 | | authority -4479 | Gramineae | | synonym -4479 | Poaceae | | scientific name -4479 | Poaceae Barnhart, 1895 | | authority -4479 | grass family | | common name -4496 | Avena | | scientific name -4496 | Avena L., 1753 | | authority -4500 | Avena longiglumis | | scientific name -4500 | Avena longiglumis Durieu, 1845 | | authority -4523 | Neurachne | | scientific name -4523 | Neurachne R.Br. | | authority -4581 | Bambusa | | scientific name -4581 | Bambusa Schreb. | | authority -4581 | bamboos | | genbank common name -4667 | Liliales | | scientific name -4667 | Liliales Perleb, 1826 | | authority -4667 | Liliales/Asparagales group | Liliales/Asparagales group | in-part -4667 | Liliiflorae | Liliiflorae | in-part -4667 | Orchidales | | includes -4734 | Commelinidae | | synonym -4734 | Commeliniflorae | | synonym -4734 | commelinids | | scientific name -4747 | Orchidaceae | | scientific name -4747 | Orchidaceae Juss., 1789 | | authority -4747 | orchid family | | common name -4751 | Fungi | | scientific name -4751 | Mycota | | synonym -4751 | fungi | | blast name -4762 | Oomycetes | | synonym -4762 | Oomycetes G. Winter, 1880 | | authority -4762 | Oomycota | | scientific name -4762 | Oomycota Arx, 1967 | | authority -4762 | oomycetes | | blast name -4763 | Saprolegniales | | scientific name -4763 | Saprolegniales Prantl, 1874 | | authority -4764 | Saprolegniaceae | | scientific name -4769 | Saprolegnia | | scientific name -4890 | Ascomycota | | scientific name -4890 | ascomycete fungi | ascomycete fungi | blast name -4890 | ascomycete fungi | ascomycete fungi | genbank common name -4890 | sac fungi | | common name -4958 | Debaryomyces | | scientific name -4958 | Debaryomyces Lodder & Kreger-van Rij ex Kreger-van Rij, 1984 | | authority -4958 | Wingea | | synonym -4972 | ATCC 24291 | ATCC 24291 | type material -4972 | Bullera armeniaca | | synonym -4972 | CBS 4214 | CBS 4214 | type material -4972 | CCRC 21600 | CCRC 21600 | type material -4972 | CCRC:21600 | CCRC:21600 | type material -4972 | Cryptococcus hungaricus | | synonym -4972 | Cryptococcus sp. GU67 | | includes -4972 | DBVPG 7152 | DBVPG 7152 | type material -4972 | Dioszegia hungarica | | scientific name -4972 | Dioszegia hungarica Zsolt, 1957 | | authority -4972 | IFO 1052 | IFO 1052 | type material -4972 | IGC 3954 | IGC 3954 | type material -4972 | JCM 9046 | JCM 9046 | type material -4972 | MUCL 30660 | MUCL 30660 | type material -4972 | NRRL Y-6667 | NRRL Y-6667 | type material -4972 | UCD 68-187 | UCD 68-187 | type material -4972 | specimen-voucher:NRRL:Y:6667 | specimen-voucher:NRRL:Y:6667 | type material -5036 | Histoplasma | | scientific name -5036 | Histoplasma Darling, 1906 | | authority -5037 | ATCC 22635 [[Emmonsiella capsulata]] | ATCC 22635 [[Emmonsiella capsulata]] | type material -5037 | Ajellomyces capsulatus (Kwon-Chung) McGinnis & Katz, 1979 | | synonym -5037 | CBS 136.72 [[Emmonsiella capsulata]] | CBS 136.72 [[Emmonsiella capsulata]] | type material -5037 | Cryptococcus capsulatus | | synonym -5037 | Cryptococcus capsulatus (Darling) Castell. & Chalm., 1919 | | authority -5037 | Emmonsiella capsulata | | synonym -5037 | Emmonsiella capsulata Kwon-Chung, 1972 | | authority -5037 | Histoplasma capsulatum | | scientific name -5037 | Histoplasma capsulatum Darling, 1906 | | authority -5039 | ATCC 18188 | ATCC 18188 | type material -5039 | Ajellomyces dermatitidis | | synonym -5039 | Ajellomyces dermatitidis McDonough & A.L. Lewis, 1968 | | authority -5039 | Blastomyces dermatitidis | | scientific name -5039 | Blastomyces dermatitidis Gilchrist & W.R. Stokes, 1898 | | authority -5039 | Blastomycoides dermatitidis | | synonym -5039 | CBS 674.68 | CBS 674.68 | type material -5039 | UAMH 3539 | UAMH 3539 | type material -5039 | UAMH-3539 | UAMH-3539 | type material -5039 | UAMH3539 | UAMH3539 | type material -5039 | UAMH:3539 | UAMH:3539 | type material -5125 | Hypocreales | | scientific name -5125 | Hypocreales Lindau, 1897 | | authority -5125 | Pyrenomycetes | Pyrenomycetes | in-part -5139 | Sordariales | | scientific name -5139 | Sordariales Chadef. ex D. Hawksw. & O.E. Erikss., 1986 | | authority -5149 | Chaetomium | | scientific name -5149 | Chaetomium Kunze, 1817 | | authority -5197 | Lecanorales | | scientific name -5197 | Lecanorales Nannf., 1932 | | authority -5198 | Cladiaceae | | includes -5198 | Cladoniaceae | | scientific name -5198 | Cladoniaceae Zenker, 1827 | | authority -5199 | Cladina | | includes -5199 | Cladina (Nyl.) Nyl., 1866 | | authority -5199 | Cladonia | | scientific name -5204 | Basidiomycota | | scientific name -5204 | basidiomycete fungi | basidiomycete fungi | blast name -5204 | basidiomycete fungi | basidiomycete fungi | genbank common name -5204 | basidiomycetes | | common name -5234 | Christianseniales | | includes -5234 | Tremellales | | scientific name -5234 | Tremellales Fr., 1821 | | authority -5234 | anamorphic Tremellales | | includes -5234 | jelly fungi | | genbank common name -5234 | mitosporic Tremellales | | includes -5302 | Agaricomycotina | | scientific name -5302 | Agaricomycotina Doweld, 2001 | | authority -5302 | Hymenomycetes | | equivalent name -5303 | Aphyllophorales | | synonym -5303 | Polyporales | | scientific name -5303 | Polyporales Gaum., 1926 | | authority -5303 | anamorphic Aphyllophorales | | includes -5303 | anamorphic Polyporales | | includes -5303 | mitosporic Aphyllophorales | | includes -5303 | mitosporic Polyporales | | includes -5305 | Phanerochaete | | scientific name -5305 | Phanerochaete P. Karst., 1889 | | authority -5314 | Ganoderma | | scientific name -5314 | Ganoderma P. Karst., 1881 | | authority -5314 | Magoderna | | synonym -5314 | Magoderna Steyaert, 1972 | | authority -5317 | Coriolaceae | | synonym -5317 | Cryptoporaceae | | synonym -5317 | Echinochaetaceae | | synonym -5317 | Fomitaceae | | synonym -5317 | Ganodermataceae | | synonym -5317 | Grammotheleaceae | | synonym -5317 | Haddowiaceae | | synonym -5317 | Lentinaceae | | synonym -5317 | Lentinaceae Julich | | synonym -5317 | Lophariaceae | | synonym -5317 | Microporaceae | | synonym -5317 | Pachykytosporaceae | | synonym -5317 | Perenniporiaceae | | synonym -5317 | Polyporaceae | | scientific name -5317 | Sparsitubaceae | | synonym -5317 | Trametaceae | | synonym -5317 | bracket fungi | | genbank common name -5338 | Agaricales | | scientific name -5338 | Agaricales Underw., 1899 | | authority -5338 | Agaricales anamorphs | | synonym -5338 | Hymenogastrales | | synonym -5338 | Lycoperdales | | synonym -5338 | Nidulariales | | synonym -5338 | Tulostomatales | | synonym -5338 | anamorphic Agaricales | | synonym -5338 | gasteromycetes | gasteromycetes | includes -5338 | gill mushrooms | | genbank common name -5338 | mitosporic Agaricales | | includes -5455 | Colletotrichum | | scientific name -5455 | Colletotrichum Corda, 1831 | | authority -5455 | Glomerella | Glomerella | synonym -5455 | Glomerella Spauld. & H. Schrenk 1903 | | authority -5500 | Coccidioides | | scientific name -5500 | Coccidioides C.W. Stiles, 1896 | | authority -5501 | CBS 120936 | CBS 120936 | type material -5501 | CBS 144.34 | CBS 144.34 | type material -5501 | CBS H-19842 | CBS H-19842 | type material -5501 | Coccidioides immitis | | scientific name -5501 | Coccidioides immitis G.W. Stiles, 1896 | | authority -5501 | RMSCC 2394 | RMSCC 2394 | type material -5506 | Albonectria | | synonym -5506 | Albonectria Rossman & Samuels, 1999 | | authority -5506 | Bisifusarium | | synonym -5506 | Bisifusarium L. Lombard, Crous & W. Gams, 2015 | | authority -5506 | Cyanonectria | | synonym -5506 | Cyanonectria Samuels & P. Chaverri, 2009 | | authority -5506 | Fusarium | | scientific name -5506 | Fusarium Link, 1809 | | authority -5506 | Fusarium sect. Setofusarium | | synonym -5506 | Fusarium sect. Setofusarium Nirenberg & Samuels, 1989 | | authority -5506 | Fusisporium | | synonym -5506 | Fusisporium Link, 1809 | | authority -5506 | Geejayessia | | synonym -5506 | Geejayessia Schroers, Grafenhan & Seifert, 2011 | | authority -5506 | Gibberella | | synonym -5506 | Gibberella Sacc., 1877 | | authority -5506 | Haematonectria | | synonym -5506 | Haematonectria Samuels & Nirenberg, 1999 | | authority -5506 | Luteonectria | | synonym -5506 | Luteonectria Sand.-Den., L. Lombard, Schroers & Rossman, 2021 | | synonym -5506 | Neocosmospora | | synonym -5506 | Neocosmospora E.F. Sm., 1899 | | authority -5506 | Nothofusarium | | synonym -5506 | Nothofusarium Crous, Sand.-Den. & L. Lombard, 2021 | | authority -5506 | Rectifusarium | | synonym -5506 | Rectifusarium L. Lombard, Crous & W. Gams, 2015 | | authority -5506 | Setofusarium | | synonym -5506 | Setofusarium (Nirenberg & Samuels) Crous & Sand.-Den., 2021 | | authority -5550 | Bodinia | | synonym -5550 | Bodinia M. Ota & Langeron, 1923 | | authority -5550 | Grubyella | | synonym -5550 | Grubyella M. Ota & Langeron, 1923 | | authority -5550 | Trichophyton | | scientific name -5550 | Trichophyton Malmsten, 1848 | | authority -5551 | ATCC 32871 [[Trichophyton fischeri]] | ATCC 32871 [[Trichophyton fischeri]] | type material -5551 | ATCC 42631 [[Trichophyton raubitschekii]] | ATCC 42631 [[Trichophyton raubitschekii]] | type material -5551 | ATCC 62345 [[Trichophyton kanei]] | ATCC 62345 [[Trichophyton kanei]] | type material -5551 | CBS 100081 [[Trichophyton fischeri]] | CBS 100081 [[Trichophyton fischeri]] | type material -5551 | CBS 100084 [[Trichophyton raubitschekii]] | CBS 100084 [[Trichophyton raubitschekii]] | type material -5551 | CBS 289.86 [[Trichophyton kanei]] | CBS 289.86 [[Trichophyton kanei]] | type material -5551 | CBS 392.58 | CBS 392.58 | type material -5551 | Epidermophyton rubrum | | synonym -5551 | Epidermophyton rubrum Castell., 1910 | | authority -5551 | IMI 213848 [[Trichophyton fischeri]] | IMI 213848 [[Trichophyton fischeri]] | type material -5551 | Microsporum rubrum | | synonym -5551 | Microsporum rubrum Cazalbou, 1913 | | authority -5551 | Sabouraudites ruber | | synonym -5551 | Sabouraudites ruber (Cazalbou) Nann., 1934 | | synonym -5551 | TRTC 50887 [[Trichophyton kanei]] | TRTC 50887 [[Trichophyton kanei]] | type material -5551 | Trichophyton fischeri | | synonym -5551 | Trichophyton fischeri J. Kane, 1977 | | authority -5551 | Trichophyton kanei | | synonym -5551 | Trichophyton kanei Summerb., 1987 | | authority -5551 | Trichophyton megninii | | synonym -5551 | Trichophyton megninii R. Blanch., 1895 | | authority -5551 | Trichophyton raubitschekii | | synonym -5551 | Trichophyton raubitschekii J. Kane, Salkin, Weitzman & Smitka, 1981 | | authority -5551 | Trichophyton rubrum | | scientific name -5551 | Trichophyton rubrum (Castell.) Sabour., 1911 | | authority -5551 | Trichophyton rubrum var. raubitschekii | | synonym -5794 | Apicomplexa | | scientific name -5794 | Apicomplexa Levine 1980, emend. Adl et al. 2005 | | authority -5794 | apicomplexans | apicomplexans | blast name -5794 | apicomplexans | apicomplexans | genbank common name -5796 | Coccidia | | scientific name -5796 | coccidians | | synonym -5809 | Sarcocystidae | | scientific name -5809 | Sarcocystids | | synonym -5819 | Haemosporida | | scientific name -5819 | Haemosporina | | synonym -5819 | Haemospororida | | synonym -5819 | haemosporidians | | genbank common name -5820 | Plasmodium | Plasmodium | scientific name -5820 | Saurocytozoon | | synonym -5825 | Plasmodium chabaudi | | scientific name -5857 | Plasmodium fragile | | scientific name -5860 | Plasmodium vinckei | | scientific name -5860 | Plasmodium vinckei (Rodhain, 1952) | | authority -5863 | Piroplasmida | | scientific name -5863 | Piroplasmids | | genbank common name -5872 | Babesia equi | | synonym -5872 | Babesia equi Laveran, 1901 | | authority -5872 | Theileria equi | | scientific name -5872 | Theileria equi (Laveran, 1901) Mehlhorn & Schein 1998 | | authority -5873 | Theileria | | scientific name -5873 | Theileria Bettencourt et al. 1907 | | authority -5874 | Theileria annulata | | scientific name -6072 | Eumetazoa | | scientific name -6073 | Cnidaria | | scientific name -6073 | Coelenterata | Coelenterata | in-part -6073 | cnidarians | cnidarians | blast name -6073 | cnidarians | cnidarians | genbank common name -6073 | coelenterates | coelenterates | common name -6101 | Anthozoa | | scientific name -6101 | anthozoans | anthozoans | blast name -6101 | anthozoans | anthozoans | genbank common name -6102 | Ceriantipatharia | | includes -6102 | Hexacorallia | | scientific name -6125 | Madreporaria | | synonym -6125 | Scleractinia | | scientific name -6125 | stony corals | stony corals | blast name -6125 | stony corals | stony corals | genbank common name -6126 | Acroporidae | | scientific name -6127 | Acropora | | scientific name -6127 | staghorn corals | | genbank common name -6157 | Neorhabdocoela | | includes -6157 | Platyhelminthes | | scientific name -6157 | Proplicastomata | | includes -6157 | Turbellaria | | includes -6157 | Turbellarian Platyhelminths | | includes -6157 | flatworm | | common name -6157 | flatworms | flatworms | blast name -6157 | flatworms | flatworms | genbank common name -6159 | Tricladida | | scientific name -6199 | Cestoda | | scientific name -6199 | tapeworms | | genbank common name -6200 | Eucestoda | | scientific name -6217 | Nemertea | | scientific name -6217 | Nemertini | | synonym -6217 | bootlace worms | | common name -6217 | nemertines | | common name -6217 | ribbon worms | ribbon worms | blast name -6217 | ribbon worms | ribbon worms | genbank common name -6218 | Anopla | | synonym -6218 | Pilidiophora | | scientific name -6219 | Heteronemertea | | scientific name -6219 | Heteronemertini | | synonym -6219 | heteronemertine worms | | genbank common name -6222 | Cerebratulidae | | synonym -6222 | Lineidae | | scientific name -6231 | Nemata | | synonym -6231 | Nematoda | | scientific name -6231 | nematode | | common name -6231 | nematodes | nematodes | blast name -6231 | nematodes | nematodes | genbank common name -6231 | roundworm | | common name -6231 | roundworms | | common name -6236 | Rhabditida | | scientific name -6236 | Strongylida | | synonym -6249 | Ascaridida | | synonym -6249 | Ascaridomorpha | | scientific name -6267 | Anisakidae | | scientific name -6274 | Spirurida | | synonym -6274 | Spirurina | | scientific name -6447 | Mollusca | | scientific name -6447 | molluscs | molluscs | blast name -6447 | molluscs | molluscs | genbank common name -6447 | mollusks | | common name -6544 | Bivalvia | | scientific name -6544 | Lamellibranchiata | | synonym -6544 | Pelecypoda | | synonym -6544 | bivalves | bivalves | blast name -6544 | bivalves | bivalves | genbank common name -6599 | Heteroconchia | | scientific name -6656 | Arthropoda | | scientific name -6656 | arthropods | arthropods | blast name -6656 | arthropods | arthropods | genbank common name -6657 | Crustacea | | scientific name -6657 | crustaceans | crustaceans | blast name -6657 | crustaceans | crustaceans | genbank common name -6681 | Malacostraca | | scientific name -6682 | Eucarida | | scientific name -6683 | Decapoda | | scientific name -6692 | Pleocyemata | | scientific name -6712 | Astacidea | | scientific name -6712 | Astacura | | synonym -6712 | true lobsters and crayfishes | | genbank common name -6738 | Anomura | | scientific name -6738 | hermit crabs | hermit crabs | genbank common name -6744 | Coenobitoidea | | includes -6744 | Paguroidea | | scientific name -6745 | Paguridae | | scientific name -6746 | Pagurus | | scientific name -6746 | hermit crabs | hermit crabs | common name -6752 | Brachyura | | scientific name -6752 | short-tailed crabs | | genbank common name -6752 | true crabs | | common name -6960 | Atelocerata | Atelocerata | in-part -6960 | Hexapoda | | scientific name -6960 | Tracheata | Tracheata | in-part -6960 | Uniramia | Uniramia | in-part -6960 | hexapods | hexapods | blast name -6960 | hexapods | hexapods | genbank common name -6961 | Odonata | | scientific name -6961 | dragonflies & damselflies | dragonflies & damselflies | blast name -6961 | dragonflies & damselflies | dragonflies & damselflies | genbank common name -6970 | Dictyoptera | Dictyoptera | scientific name -6993 | Orthoptera | | scientific name -6993 | Saltatoria | | synonym -6993 | grasshoppers, crickets & katydids | grasshoppers, crickets & katydids | blast name -6993 | grasshoppers, crickets & katydids | grasshoppers, crickets & katydids | genbank common name -6994 | Ensifera | Ensifera | scientific name -6994 | crickets & katydids | | genbank common name -7041 | Coleoptera | | scientific name -7041 | beetles | beetles | blast name -7041 | beetles | beetles | genbank common name -7042 | Curculionidae | | scientific name -7042 | weevils | | genbank common name -7088 | Lepidoptera | | scientific name -7088 | moths & butterflies | moths & butterflies | blast name -7088 | moths & butterflies | moths & butterflies | genbank common name -7089 | Bombycidae | | scientific name -7089 | silkworm moths | | genbank common name -7100 | Noctuidae | | scientific name -7100 | noctuid moths | | common name -7100 | owlet moths | | genbank common name -7147 | Diptera | | scientific name -7147 | flies | flies | blast name -7147 | flies | flies | genbank common name -7148 | Nematocera | | scientific name -7157 | Culicidae | | scientific name -7157 | mosquitos | mosquitos | blast name -7157 | mosquitos | mosquitos | genbank common name -7158 | Aedes | Aedes | scientific name -7399 | Hymenoptera | | scientific name -7399 | hymenopterans | hymenopterans | blast name -7399 | hymenopterans | hymenopterans | genbank common name -7400 | Apocrita | | scientific name -7400 | wasps, ants & bees | wasps, ants & bees | blast name -7400 | wasps, ants & bees | wasps, ants & bees | common name -7401 | Ichneumonoidea | | scientific name -7402 | Braconidae | | scientific name -7434 | Aculeata | Aculeata | scientific name -7434 | Aculeata Latreille, 1802 | | authority -7458 | Apidae | | scientific name -7458 | bumble bees and honey bees | | genbank common name -7459 | Apis | | scientific name -7496 | Pterygota | Pterygota | scientific name -7496 | winged insects | | genbank common name -7516 | Neuroptera | | scientific name -7516 | Planipennia | | synonym -7516 | lacewings | | common name -7516 | net-winged insects | | genbank common name -7524 | Hemiptera | | scientific name -7524 | Homoptera | | includes -7524 | true bugs | true bugs | blast name -7524 | true bugs | true bugs | genbank common name -7581 | Comatulida | | scientific name -7586 | Echinodermata | | scientific name -7586 | echinoderms | echinoderms | blast name -7586 | echinoderms | echinoderms | genbank common name -7711 | Chordata | | scientific name -7711 | chordates | chordates | blast name -7711 | chordates | chordates | genbank common name -7742 | Vertebrata | Vertebrata | scientific name -7742 | Vertebrata Cuvier, 1812 | | authority -7742 | vertebrates | vertebrates | blast name -7742 | vertebrates | vertebrates | genbank common name -7776 | Gnathostomata | Gnathostomata | scientific name -7776 | jawed vertebrates | | genbank common name -7777 | Chondrichthyes | | scientific name -7777 | cartilaginous fishes | cartilaginous fishes | blast name -7777 | cartilaginous fishes | cartilaginous fishes | genbank common name -7777 | fish | fish | common name -7777 | fishes | fishes | common name -7778 | Elasmobranchii | | scientific name -7778 | elasmobranchs | | common name -7778 | sharks & rays | sharks & rays | blast name -7778 | sharks & rays | sharks & rays | genbank common name -7898 | Actinopterygi | | synonym -7898 | Actinopterygii | | scientific name -7898 | Osteichthyes | Osteichthyes | in-part -7898 | fish | fish | common name -7898 | fishes | fishes | common name -7898 | ray-finned fishes | ray-finned fishes | blast name -7898 | ray-finned fishes | ray-finned fishes | genbank common name -7952 | Cypriniformes | | scientific name -7952 | carps and others | | genbank common name -7953 | Cyprinidae | | scientific name -7982 | Cobitidae | | scientific name -7982 | loaches | | genbank common name -7983 | Misgurnus | | scientific name -8006 | Salmoniformes | | scientific name -8006 | salmons and trouts | | genbank common name -8015 | Salmonidae | | scientific name -8015 | salmonids | | genbank common name -8033 | Salvelinus | | scientific name -8034 | NHMW:91214 | NHMW:91214 | type material -8034 | NMW:91214 | NMW:91214 | type material -8034 | NMW:91214 | NMW:91214 | type material -8034 | Salmo leucomaenis | | synonym -8034 | Salmo leucomaenis Pallas, 1814 | | authority -8034 | Salvelinus leucomaenis | | scientific name -8034 | Salvelinus leucomaenis (Pallas, 1814) | | authority -8034 | ZMB:23552 | ZMB:23552 | type material -8034 | ZMB:23563 | ZMB:23563 | type material -8034 | amemasu char | | common name -8034 | whitespotted char | | genbank common name -8035 | Salmo pluvius | | synonym -8035 | Salmo pluvius Hilgendorf, 1876 | | authority -8035 | Salvelinus leucomaenis pluvius | | scientific name -8035 | Salvelinus pluvius | | synonym -8111 | Perciformes | | scientific name -8111 | Scorpaeniformes | | synonym -8111 | Serraniformes | | synonym -8111 | perches and others | | genbank common name -8113 | Cichlidae | | scientific name -8113 | cichlids | | genbank common name -8205 | Notothenioidei | | scientific name -8219 | Gobioidei | | scientific name -8220 | Gobiidae | | scientific name -8220 | Microdesmidae | | synonym -8220 | Trypauchenidae | | synonym -8220 | burrowing gobies | | common name -8220 | gobies | | genbank common name -8220 | wormfishes | | common name -8252 | Pleuronectiformes | | scientific name -8252 | flatfishes | | genbank common name -8256 | Pleuronectidae | | scientific name -8256 | righteye flounders | | genbank common name -8287 | Sarcopterygii | | scientific name -8292 | Amphibia | | scientific name -8292 | Lissamphibia | | includes -8292 | amphibians | amphibians | blast name -8292 | amphibians | amphibians | genbank common name -8293 | Caudata | | scientific name -8293 | Urodela | | synonym -8293 | salamanders | salamanders | blast name -8293 | salamanders | salamanders | genbank common name -8294 | Ambystomatidae | | scientific name -8294 | mole salamanders | mole salamanders | genbank common name -8295 | Ambystoma | | scientific name -8295 | big salamanders | | common name -8295 | mole salamanders | mole salamanders | genbank common name -8306 | Ambystoma talpoideum | | scientific name -8306 | Ambystoma talpoideum (Holbrook, 1838) | | authority -8306 | Salamandra talpoidea | | synonym -8306 | Salamandra talpoidea Holbrook, 1838 | | authority -8306 | mole salamander | | genbank common name -8342 | Anura | | scientific name -8342 | Salientia | | synonym -8342 | anurans | | common name -8342 | frogs | | common name -8342 | frogs & toads | frogs & toads | blast name -8342 | frogs & toads | frogs & toads | genbank common name -8416 | Neobatrachia | | scientific name -8426 | Microhyloidea | | scientific name -8427 | Microhylidae | | scientific name -8427 | microhylid toads | | genbank common name -8457 | Sauropsida | | scientific name -8457 | sauropsids | | genbank common name -8492 | Archosauria | | scientific name -8782 | Aves | | scientific name -8782 | avian | | synonym -8782 | birds | birds | blast name -8782 | birds | birds | genbank common name -8825 | Neognathae | | scientific name -8826 | Anseriformes | | scientific name -8826 | ducks, geese & swans | | genbank common name -8827 | Anhimidae | | scientific name -8827 | screamers | | genbank common name -8828 | Chauna | | scientific name -8906 | Charadriiformes | | scientific name -8906 | Turniciformes | | includes -8906 | shorebirds & allies | | genbank common name -8906 | shorebirds and others | | common name -8936 | Coraciadiformes | | synonym -8936 | Coraciiformes | | scientific name -8936 | kingfishers and others | | genbank common name -8940 | Cuculiformes | | scientific name -8940 | cuckoos and others | | genbank common name -8941 | Cuculidae | | scientific name -8941 | cuckoos | | genbank common name -8948 | Falconiformes | | scientific name -8948 | falcons and others | | genbank common name -8949 | Falconidae | | scientific name -8955 | Accipitrinae | | scientific name -9108 | Gruiformes | | scientific name -9108 | cranes, rails & allies | | genbank common name -9108 | terrestrial and marshbirds | | common name -9126 | Passeriformes | | scientific name -9126 | song birds | | genbank common name -9219 | Galbuliformes | | includes -9219 | Piciformes | | scientific name -9219 | jacamars | | common name -9219 | woodpeckers and others | | genbank common name -9223 | Psittaciformes | | scientific name -9223 | parrots and others | | genbank common name -9224 | Psittacidae | | scientific name -9224 | parrot | | common name -9224 | parrots | | genbank common name -9230 | Sphenisciformes | | scientific name -9230 | penguins | penguins | genbank common name -9231 | Spheniscidae | | scientific name -9231 | penguins | penguins | genbank common name -9239 | Spheniscus | | scientific name -9263 | Marsupialia | | synonym -9263 | Metatheria | | scientific name -9263 | marsupials | marsupials | blast name -9263 | marsupials | marsupials | genbank common name -9265 | American opossums | | common name -9265 | Didelphidae | | scientific name -9265 | opossums | | genbank common name -9266 | Didelphis | | scientific name -9347 | Eutheria | | scientific name -9347 | Placentalia | | synonym -9347 | eutherian mammals | | common name -9347 | placental mammals | | common name -9347 | placentals | placentals | blast name -9347 | placentals | placentals | genbank common name -9397 | Chiroptera | | scientific name -9397 | bats | bats | blast name -9397 | bats | bats | genbank common name -9431 | Vespertilionidae | | scientific name -9431 | common bats | | common name -9431 | vesper bats | | genbank common name -9431 | vespertilionid bats | | common name -9434 | Myotis | | scientific name -9655 | Mustelidae | | scientific name -9655 | weasel, mink, badger, martens and others | | genbank common name -9671 | Pteronura | | scientific name -9672 | Pteronura brasiliensis | | scientific name -9672 | Pteronura brasiliensis Zimmermann, 1780 | | authority -9672 | giant otter | | genbank common name -9681 | Felidae | | scientific name -9681 | cat family | | genbank common name -9688 | Leo | | synonym -9688 | Panthera | | scientific name -9688 | Uncia | | synonym -9690 | Panthera onca | | scientific name -9690 | jaguar | | genbank common name -9845 | Ruminantia | | scientific name -9895 | Bovidae | | scientific name -9918 | Bubalus | | scientific name -9975 | Lagomorpha | | scientific name -9975 | Lagomorpha Brandt, 1855 | | authority -9975 | rabbits & hares | | blast name -9979 | Leporidae | | scientific name -9979 | Leporidae Fischer, 1817 | | authority -9979 | rabbits and hares | | genbank common name -9980 | Lepus | | scientific name -9980 | Lepus Linnaeus, 1758 | | authority -9980 | hares | | genbank common name -9989 | Rodentia | | scientific name -9989 | rodent | | common name -9989 | rodents | rodents | blast name -9989 | rodents | rodents | genbank common name -10045 | Gerbillinae | | scientific name -10045 | gerbils | | genbank common name -10066 | Muridae | | scientific name -10239 | Vira | | synonym -10239 | Viridae | | synonym -10239 | Viruses | | scientific name -10239 | viruses | | blast name -10293 | Alphaherpesvirinae | | scientific name -10293 | Alphaherpesviruses | | common name -10294 | Simplexvirus | | scientific name -10319 | Varicellovirus | | scientific name -10357 | Betaherpesvirinae | | scientific name -10357 | Betaherpesviruses | | common name -10358 | Cytomegalovirus | | scientific name -10374 | Gammaherpesvirinae | | scientific name -10374 | Gammaherpesviruses | | common name -10374 | lymphoproliferative virus group | | genbank common name -10404 | Hepadnaviridae | | scientific name -10404 | hepatitis B-type viruses | | genbank common name -10405 | Orthohepadnavirus | | scientific name -10405 | mammalian hepatitis B-type viruses | | genbank common name -10442 | Baculoviridae | | scientific name -10566 | Human Papilloma Virus | | equivalent name -10566 | Human papillomavirus | | scientific name -10566 | human papillomavirus HPV | | equivalent name -10567 | Iotapapillomavirus 1 | | scientific name -10567 | Mastomys natalensis papillomavirus | | equivalent name -10567 | Multimammate rat papillomavirus | | equivalent name -10567 | Praomys natalensis papillomavirus | | equivalent name -10639 | Caulimovirus | | scientific name -10652 | Badnavirus | | scientific name -10652 | Commelina yellow mottle virus group | | equivalent name -10780 | Parvoviridae | | scientific name -10803 | Dependoparvovirus | | scientific name -10803 | Dependovirus | | equivalent name -10803 | dependoviruses | | common name -10811 | Geminiviridae | | scientific name -10811 | Geminivirus | | equivalent name -10812 | Geminivirus subgroup I | | equivalent name -10812 | Mastrevirus | | scientific name -10812 | Subgroup I Geminivirus | | equivalent name -10814 | Begomovirus | | scientific name -10814 | Geminivirus subgroup III | | equivalent name -10814 | Subgroup III Geminivirus | | equivalent name -10841 | Microviridae | | scientific name -10841 | bacterial virus | bacterial virus | in-part -10841 | bacterial viruses | bacterial viruses | in-part -10841 | isometric ssDNA phages | | genbank common name -10841 | prokaryotic virus | prokaryotic virus | in-part -10882 | Orthoreovirus | | scientific name -10882 | RAM-1 | | acronym -10882 | Reoviruses | | equivalent name -10892 | Orbiviridae | | equivalent name -10892 | Orbivirus | | scientific name -10892 | Orbiviruses | | equivalent name -10979 | Aquareovirus | | scientific name -10988 | Fijivirus | | scientific name -10988 | plant reovirus 2 | | genbank common name -10989 | MRDV | | acronym -10989 | Maize rough dwarf fijivirus | | equivalent name -10989 | Maize rough dwarf virus | | scientific name -10993 | Birnaviridae | | scientific name -11006 | Totiviridae | | scientific name -11006 | monopartite dsRNA genome mycoviruses | | genbank common name -11007 | Totivirus | | scientific name -11012 | Partitiviridae | | scientific name -11050 | Flaviviridae | | scientific name -11050 | Flavivirus (arbovirus group B) | | equivalent name -11095 | Pestivirus | | scientific name -11102 | Hepacivirus | | scientific name -11102 | Hepatitis C virus group | | equivalent name -11102 | Hepatitis C viruses | | equivalent name -11102 | Hepatitis C-like viruses | | equivalent name -11118 | Coronaviridae | | scientific name -11157 | Mononegavirales | | scientific name -11157 | negative-sense genome single-stranded RNA viruses | | genbank common name -11158 | Paramyxoviridae | | scientific name -11229 | Morbillivirus | | scientific name -11229 | Morbilliviruses | | equivalent name -11240 | Phocine distemper virus | | equivalent name -11240 | Phocine morbillivirus | | scientific name -11240 | phocid distemper virus | | equivalent name -11240 | phocid distemper virus PDV | | equivalent name -11240 | phocine distemper virus PDV | | equivalent name -11270 | Rhabdoviridae | | scientific name -11271 | Vesiculovirus | | scientific name -11308 | Orthomyxoviridae | | scientific name -11318 | Dhori thogotovirus | | equivalent name -11318 | Dhori virus | | equivalent name -11318 | Thogotovirus dhoriense | | scientific name -11318 | Tick-borne virus | | equivalent name -11319 | Dhori virus (strain Indian/1313/61) | | scientific name -11572 | Bunyavirus | | equivalent name -11572 | Bunyaviruses | | equivalent name -11572 | Orthobunyavirus | | scientific name -11582 | Aino virus | | scientific name -11584 | Phlebovirus | | scientific name -11584 | Phleboviruses | | equivalent name -11617 | Arenaviridae | | scientific name -11632 | Retroviridae | | scientific name -11974 | Caliciviridae | | scientific name -12027 | Bacteriophage SP | | equivalent name -12027 | Enterobacteria phage SP | | scientific name -12027 | phage SP | | equivalent name -12030 | Bacteriophage TW19 | | equivalent name -12030 | Enterobacteria phage TW19 | | scientific name -12031 | Bacteriophage TW28 | | equivalent name -12031 | Enterobacteria phage TW28 | | scientific name -12031 | phage TW19 | | equivalent name -12031 | phage TW28 | | equivalent name -12036 | Luteovirus | | scientific name -12036 | Luteovirus subgroup I | | equivalent name -12050 | Maize chlorotic dwarf virus group | | equivalent name -12050 | Waikavirus | | scientific name -12051 | Marafivirus | | scientific name -12058 | Picornaviridae | | scientific name -12058 | Picornavirus | | synonym -12059 | Enterovirus | | scientific name -12059 | Enteroviruses | | equivalent name -12059 | Rhinovirus | | includes -12059 | Rhinoviruses | | includes -12059 | common cold viruses | | includes -12091 | Hepatovirus | | scientific name -12109 | Aphthovirus | | scientific name -12109 | Aphthoviruses | | equivalent name -12137 | Sobemovirus | | scientific name -12137 | Velvet tobacco mottle virus group | | equivalent name -12141 | Tombusvirus | | scientific name -12160 | Closterovirus | | scientific name -12163 | Carlavirus | | scientific name -12174 | Capillovirus | | scientific name -12176 | Potexvirus | | scientific name -12195 | Potyvirus | | scientific name -12234 | Tobamoviridae | | equivalent name -12234 | Tobamovirus | | scientific name -12258 | Comovirus | | scientific name -12270 | Nepovirus | | scientific name -12283 | Nodaviridae | | scientific name -12289 | Enamovirus | | scientific name -12289 | Pea enation mosaic virus group | | equivalent name -12316 | Ilarvirus | | scientific name -12429 | unassigned viruses | | equivalent name -12429 | unclassified virus | | equivalent name -12429 | unclassified viruses | | scientific name -12456 | HAstV-1 | | acronym -12456 | Human astrovirus 1 | | scientific name -12456 | Human astrovirus type 1 | | equivalent name -12456 | human astrovirus serotype 1 | | equivalent name -12471 | Solanum nodiflorum mottle virus | | scientific name -12701 | H-Ast2 | | acronym -12701 | Human astrovirus 2 | | scientific name -12701 | Human astrovirus serotype 2 H-Ast2 | | equivalent name -12701 | Human astrovirus type 2 | | equivalent name -12877 | Satellites | | synonym -12877 | unclassified satellites | | scientific name -12929 | Amazona | | scientific name -13366 | Brettanomyces | | scientific name -13366 | Brettanomyces N.H. Claussen ex Custers, 1940 | | authority -13366 | Dekkera | | synonym -13366 | Eeniella | | synonym -13502 | ATCC 48014 | ATCC 48014 | type material -13502 | Brettanomyces nanus | | scientific name -13502 | Brettanomyces nanus (M.T. Sm., Bat. Vegte & Scheffers) M.T. Sm., Boekhout, Kurtzman & O'Donnell, 1994 | | authority -13502 | CBS 1945 | CBS 1945 | type material -13502 | CCRC 21335 | CCRC 21335 | type material -13502 | CCRC:21335 | CCRC:21335 | type material -13502 | Eeniella nana | | synonym -13502 | Eeniella nana M.T. Sm., Bat. Vegte & Scheffers, 1981 | | authority -13502 | NRRL Y-17527 | NRRL Y-17527 | type material -13502 | specimen-voucher:NRRL:Y:17527 | specimen-voucher:NRRL:Y:17527 | type material -14366 | Cymbidium | | scientific name -14366 | Cymbidium Sw., 1799 | | authority -16360 | Alismatales | | scientific name -16360 | Alismatales R.Br. ex Bercht. & J.Presl, 1820 | | authority -16360 | Alismatiflorae | | in-part -16360 | Arales | | includes -16360 | Arales Lindl.,1833 | | authority -16360 | Ariflorae | | in-part -16360 | Najadales | | includes -16360 | Najadales Dumort., 1929 | | authority -16360 | Spathiflorae | | synonym -16360 | Zosterales | | includes -16360 | Zosterales J.Presl, 1846 | | authority -23461 | Mangifera | | scientific name -23461 | Mangifera L. | | authority -24966 | Dialypetalanthaceae | | includes -24966 | Dialypetalanthaceae Rizzini & Occhioni, 1948 | | authority -24966 | Rubiaceae | | scientific name -24966 | Rubiaceae Juss., 1789 | | authority -24966 | madder family | | common name -25623 | Taxaceae | | scientific name -25623 | Taxaceae Gray, 1822 | | authority -25623 | yew family | | common name -25628 | Taxus | | scientific name -25628 | Taxus L. | | authority -26473 | Buddleia | | synonym -26473 | Buddleja | | scientific name -26473 | Buddleja L., 1753 | | authority -26867 | Bougueria | | synonym -26867 | Plantago | | scientific name -26867 | Plantago L. | | authority -26867 | ribworts | | common name -27319 | Metschnikowiaceae | | scientific name -27319 | Metschnikowiaceae T. Kamienski ex Doweld, 2013 | | authority -27337 | CBS 130341 | CBS 130341 | type material -27337 | NRRL 54785 | NRRL 54785 | type material -27337 | PD322 | PD322 | type material -27337 | UC 1953893 | UC 1953893 | type material -27337 | Verticillium dahliae | | scientific name -27337 | Verticillium dahliae Klebahn, 1913 | | authority -27434 | Dermaptera | | scientific name -27434 | earwigs | earwigs | blast name -27434 | earwigs | earwigs | genbank common name -27483 | Evanioidea | | scientific name -27592 | Bovinae | | scientific name -27668 | Myotis leibii | | scientific name -27668 | Vespertilio leibii | | synonym -27668 | Vespertilio leibii Audubon & Bachman, 1842 | | authority -27668 | eastern small-footed myotis | | genbank common name -27708 | Cyprinus conchonius | | synonym -27708 | Cyprinus conchonius Hamilton, 1822 | | authority -27708 | Pethia conchonius | | scientific name -27708 | Pethia conchonius (Hamilton, 1822) | | authority -27708 | Puntius conchonius | | synonym -27708 | Puntius conchonius (Hamilton, 1822) | | authority -27708 | rosy barb | | genbank common name -27994 | Theileriidae | | scientific name -27994 | Theileriidae du Toit, 1918 | | authority -28267 | Phocine distemper virus-2 | | scientific name -28725 | Corvidae | | scientific name -28843 | Diphyllobothriidae | | scientific name -28843 | Ligulidae | | synonym -28890 | "Euryarchaeota" Woese et al. 1990 | | authority -28890 | "Methanobacteraeota" Oren et al. 2015 | | authority -28890 | "Methanobacteriota" Whitman et al. 2018 | | authority -28890 | Euryarchaeota | | synonym -28890 | Euryarchaeota Garrity and Holt 2002 | | authority -28890 | Methanobacteraeota | | synonym -28890 | Methanobacteriota | | scientific name -28890 | Methanobacteriota Garrity and Holt 2023 | | authority -28890 | euryarchaeotes | euryarchaeotes | blast name -28890 | euryarchaeotes | euryarchaeotes | genbank common name -29961 | Parastacoidea | | scientific name -29962 | Grapsidoidea | | synonym -29962 | Grapsoidea | | scientific name -30092 | Psyllidae | | scientific name -30093 | Trioza | | scientific name -30093 | Trioza Foerster, 1848 | | authority -30102 | Cicadellidae | | scientific name -30102 | Jassidae | | synonym -30102 | leafhoppers | | genbank common name -30367 | Ambystomatoidea | | synonym -30367 | Salamandroidea | | scientific name -30388 | Chaja torquata | | synonym -30388 | Chaja torquata Oken, 1816 | | authority -30388 | Chauna torquata | | scientific name -30388 | southern screamer | | genbank common name -30449 | Procellariiformes | | scientific name -30449 | petrels and albatrosses | | genbank common name -30560 | Microchiroptera | | synonym -30560 | Vespertilioniformes | | synonym -30560 | Yangochiroptera | | scientific name -30725 | Catostomoidea | | synonym -30725 | Cobitoidei | | scientific name -30727 | Cyprinoidea | | synonym -30727 | Cyprinoidei | | scientific name -30806 | Channichthyidae | | scientific name -30806 | crocodile icefishes | | genbank common name -30806 | white-blooded fish | | common name -30871 | Serranidae | | scientific name -30871 | sea basses | | genbank common name -30942 | Pleuronectoidei | | scientific name -30942 | Soleoidei | | synonym -31271 | Plasmodium chabaudi chabaudi | | scientific name -31370 | Batrachospermales | | scientific name -31371 | Batrachospermaceae | | scientific name -31371 | Brachtospermaceae | | synonym -31468 | Gracilariales | | scientific name -31469 | Gracilariaceae | | scientific name -31612 | Adelaide River virus | | scientific name -31870 | CBS 130836 | CBS 130836 | type material -31870 | Colletotrichopsis graminicola | | synonym -31870 | Colletotrichum graminicola | | scientific name -31870 | Colletotrichum graminicola (Ces.) G.W. Wilson, 1914 | | authority -31870 | Dicladium graminicola | | synonym -31870 | Dicladium graminicola Ces., 1852 | | authority -31870 | Dicladium graminicolum | | synonym -31870 | Glomerella graminicola | | synonym -31870 | Glomerella graminicola D.J. Politis, 1975 | | authority -31870 | M1.001 | M1.001 | type material -31870 | Steirochaete graminicola | | synonym -32443 | Teleostei | | scientific name -32443 | teleost fishes | | genbank common name -32519 | Ostariophysi | | scientific name -32523 | Tetrapoda | | scientific name -32523 | tetrapods | | genbank common name -32524 | Amniota | | scientific name -32524 | amniotes | | genbank common name -32525 | Theria | Theria | scientific name -32525 | Theria Parker & Haswell, 1897 | | authority -32561 | Diapsida | | synonym -32561 | Sauria | | scientific name -32561 | diapsids | | genbank common name -32613 | Ephemerovirus | | scientific name -32620 | Iris severe mosaic virus | | scientific name -33090 | Chlorobionta | | synonym -33090 | Chlorobionta Jeffrey, 1982 | | authority -33090 | Chlorophyta/Embryophyta group | | equivalent name -33090 | Chloroplastida | | synonym -33090 | Chloroplastida Adl et al. 2005 | | authority -33090 | Viridiplantae | | scientific name -33090 | Viridiplantae Cavalier-Smith, 1981 | | authority -33090 | chlorophyte/embryophyte group | | equivalent name -33090 | green plants | green plants | blast name -33090 | green plants | green plants | common name -33154 | Fungi/Metazoa group | | synonym -33154 | Opisthokonta | | scientific name -33154 | Opisthokonta Cavalier-Smith 1987 | | authority -33154 | opisthokonts | | synonym -33183 | Arachnomycetales | | synonym -33183 | Arachnomycetales Gibas, Sigler & Currah, 2002 | | authority -33183 | Ascosphaerales | | synonym -33183 | Gymnoascales | | synonym -33183 | Onygenales | | scientific name -33183 | Onygenales Cif. ex Benny & Kimbr., 1980 | | authority -33184 | Amauroascaceae | | synonym -33184 | Amauroascaceae Arx, 1987 | | authority -33184 | Onygenaceae | | scientific name -33184 | Onygenaceae E. Fisch., 1898 | | authority -33208 | Animalia | | synonym -33208 | Metazoa | | scientific name -33208 | animals | animals | blast name -33208 | animals | animals | genbank common name -33208 | metazoans | | common name -33208 | multicellular animals | | common name -33213 | Bilateria | | scientific name -33256 | Ascaridoidea | | scientific name -33317 | Protostomia | | scientific name -33339 | Palaeoptera | | scientific name -33340 | Neoptera | | scientific name -33341 | Orthopteroidea | | synonym -33341 | Polyneoptera | | scientific name -33342 | Hemipteroidea | | synonym -33342 | Paraneoptera | | scientific name -33342 | hemipteroid assemblage | | includes -33365 | Cicadomorpha | | scientific name -33365 | Clypeorrhyncha | | synonym -33368 | Cicadelloidea | | synonym -33368 | Membracoidea | | scientific name -33372 | Deltocephalinae | | scientific name -33372 | Deltocephalinae Dallas, 1870 | | authority -33373 | Sternorrhyncha | | scientific name -33375 | Psylliformes | | synonym -33375 | Psylloidea | | scientific name -33375 | Psyllomorpha | | synonym -33375 | jumping plant lice | | common name -33375 | psyllids | psyllids | blast name -33375 | psyllids | psyllids | genbank common name -33392 | Endopterygota | | scientific name -33392 | Holometabola | | synonym -33415 | Nymphalidae | | scientific name -33415 | Satyridae | | includes -33415 | brush-footed butterflies | | common name -33415 | brushfoots | | genbank common name -33511 | Deuterostomia | | scientific name -33511 | deuterostomes | | common name -33554 | Carnivora | | scientific name -33554 | carnivores | carnivores | blast name -33554 | carnivores | carnivores | genbank common name -33599 | Coccyzidae | | scientific name -33600 | Piaya | | scientific name -33601 | Cuculus cayanus | | synonym -33601 | Cuculus cayanus Linnaeus, 1766 | | authority -33601 | Piaya cayana | | scientific name -33601 | squirrel cuckoo | | genbank common name -33630 | Alveolata | | scientific name -33630 | alveolates | alveolates | blast name -33630 | alveolates | alveolates | genbank common name -33634 | Chromophyta | Chromophyta | in-part -33634 | Heterokonta | | synonym -33634 | Stramenopiles | | scientific name -33634 | Stramenopiles Patterson 1989, emend. Adl et al. 2005 | | authority -33634 | Straminipila | | synonym -33634 | heterokonts | heterokonts | blast name -33634 | heterokonts | heterokonts | genbank common name -34111 | Monoraphidium | | scientific name -34111 | Monoraphidium Komark-Legn., 1969 | | authority -34145 | Closterium | | scientific name -34145 | Closterium Nitzsch ex Ralfs, 1848 | | authority -34384 | Arthrodermataceae | | scientific name -34384 | Arthrodermataceae Locq. ex Currah, 1985 | | authority -34384 | Arthrodermataceae anamorphs | | synonym -34384 | anamorphic Arthrodermataceae | | synonym -34384 | dermatophytes | | genbank common name -34384 | mitosporic Arthrodermataceae | | includes -34392 | Microsporum | | scientific name -34392 | Microsporum Gruby, 1843 | | authority -34397 | Clavicipitaceae | | scientific name -34397 | anamorphic Clavicipitaceae | | includes -34397 | mitosporic Clavicipitaceae | | includes -34448 | Marasmius | | scientific name -34448 | Marasmius Fr., 1835 | | authority -34667 | Cerambycidae | | scientific name -34667 | long-horned beetles | | genbank common name -34735 | Apoidea | | scientific name -35069 | Crinoidea | | scientific name -35069 | crinoids | crinoids | blast name -35069 | crinoids | crinoids | genbank common name -35070 | Articulata | Articulata | scientific name -35249 | unassigned Gammaherpesvirinae | | equivalent name -35249 | unclassified Gammaherpesvirinae | | scientific name -35278 | ssRNA positive-strand viruses | | equivalent name -35278 | ssRNA positive-strand viruses, no DNA stage | | equivalent name -35278 | unclassified ssRNA positive-strand viruses | | scientific name -35278 | unclassified ssRNA positive-strand viruses, no DNA stage | | equivalent name -35300 | HAstV-4 | | acronym -35300 | Human astrovirus 4 | | scientific name -35300 | Human astrovirus type 4 | | equivalent name -35303 | unassigned Rhabdoviridae | | synonym -35303 | unclassified Dimarhabdovirus supergroup | | includes -35303 | unclassified Rhabdoviridae | | scientific name -35323 | Thogoto-like viruses | | equivalent name -35323 | Thogotovirus | | scientific name -35325 | dsRNA nonenveloped viruses | | equivalent name -35325 | dsRNA viruses | | scientific name -35342 | ssDNA nonenveloped viruses | | equivalent name -35342 | ssDNA viruses | | equivalent name -35342 | unclassified ssDNA nonenveloped viruses | | equivalent name -35342 | unclassified ssDNA viruses | | scientific name -35466 | Selenastraceae | | scientific name -35466 | Selenastraceae Blackman & Tansley, 1903 | | authority -35491 | DO clade | | synonym -35491 | Sphaeropleales | | scientific name -35491 | Sphaeropleales Luerssen, 1877 | | authority -35493 | Streptophyta | | scientific name -35493 | Streptophyta Bremer, 1985 | | authority -35500 | Pecora | | scientific name -35627 | Stylosanthes | | scientific name -35627 | Stylosanthes Sw., 1788 | | authority -35634 | Ischnocera | | scientific name -35634 | Ischnocera Kellogg, 1896 | | authority -35634 | Mallophaga | Mallophaga | in-part -35634 | chewing lice | chewing lice | genbank common name -35709 | Chusquea | | scientific name -35709 | Chusquea Kunth, 1816 | | authority -35718 | Chaetomiaceae | | scientific name -35718 | Chaetomiaceae G. Winter, 1885 | | authority -35740 | HAstV-3 | | acronym -35740 | Human astrovirus 3 | | scientific name -35740 | Human astrovirus type 3 | | equivalent name -35741 | HAstV-5 | | acronym -35741 | Human astrovirus 5 | | scientific name -35741 | Human astrovirus type 5 | | equivalent name -35869 | Zygnema circumcarinatum | | scientific name -35869 | Zygnema circumcarinatum Czurda | | authority -35869 | Zygnemopsis circumcarinata | | synonym -36050 | Fusarium poae | | scientific name -36050 | Fusarium poae (Peck) Wollenw., 1913 | | authority -36050 | NRRL 26941 | NRRL 26941 | type material -36050 | Sporotrichum poae | | synonym -36050 | Sporotrichum poae Peck, 1904 | | authority -36291 | Muscicapidae | | scientific name -36291 | Old World flycatchers | | genbank common name -37130 | HAstV-6 | | acronym -37130 | Human astrovirus 6 | | scientific name -37130 | Human astrovirus type 6 | | equivalent name -37567 | Ditrysia | | scientific name -37569 | Bombycoidea | | scientific name -37569 | Sphingoidea | | synonym -37569 | hawk-moths | | genbank common name -37570 | Noctuoidea | | scientific name -37572 | Papilionoidea | | scientific name -37572 | butterflies | butterflies | blast name -37572 | butterflies | butterflies | genbank common name -37573 | Pyraloidea | | scientific name -37660 | Caribbean stylo | | genbank common name -37660 | Hedysarum hamatum | | synonym -37660 | Hedysarum hamatum L., 1759 | | authority -37660 | Stylosanthes hamata | | scientific name -37660 | Stylosanthes hamata (L.) Taub., 1890 | | authority -37660 | cheesytoes | | common name -37754 | Human papillomavirus unidentified type (ICPX1) | | scientific name -37755 | Human papillomavirus unidentified type (RTRX1) | | scientific name -37756 | Human papillomavirus unidentified type (RTRX2) | | scientific name -37757 | Human papillomavirus unidentified type (RTRX3) | | scientific name -37758 | Human papillomavirus unidentified type (RTRX4) | | scientific name -37759 | Human papillomavirus unidentified type (RTRX5) | | scientific name -37760 | Human papillomavirus unidentified type (RTRX6) | | scientific name -37844 | Monopisthocotylea | | scientific name -37850 | Parastacidae | | scientific name -37945 | Monogenea | | scientific name -37960 | unassigned Partitiviridae | | equivalent name -37960 | unclassified Alphacryptovirus | | equivalent name -37960 | unclassified Partitiviridae | | scientific name -37960 | unclassified Partitivirus | | equivalent name -38033 | CBS 160.62 | CBS 160.62 | type material -38033 | Chaetomium globosum | | scientific name -38033 | Chaetomium globosum Kunze ex Fr. 1829 | | authority -38033 | Chaetomium globosum Kunze ex Fries, 1829 | | authority -38033 | Chaetomium rectum | | synonym -38033 | Chaetomium rectum Sergeeva 1961 | | authority -38033 | Chaetomium sp. MUT 4942 | | includes -38124 | Triozidae | | scientific name -38144 | unclassified Flaviviridae | | scientific name -38605 | Didelphimorphia | | scientific name -38820 | Cyperales | | includes -38820 | Poales | | scientific name -38820 | Typhales | | includes -38950 | HAstV-7 | | acronym -38950 | Human astrovirus 7 | | scientific name -38950 | Human astrovirus type 7 | | equivalent name -39249 | Scrophularia | | scientific name -39249 | Scrophularia L., 1753 | | authority -39249 | figworts | | genbank common name -39724 | Circoviridae | | scientific name -39725 | Circovirus | | scientific name -39729 | Potyviridae | | scientific name -39731 | Bymovirus | | scientific name -39733 | Astroviridae | | scientific name -39734 | Umbravirus | | scientific name -39738 | Tombusviridae | | scientific name -39740 | Bromoviridae | | scientific name -39750 | Aquabirnavirus | | scientific name -39756 | unclassified Totiviridae | | scientific name -39760 | Idaeovirus | | scientific name -39780 | unclassified dsRNA viruses | | scientific name -39804 | Allolevivirus subgroup IV | | equivalent name -39804 | Bacteriophage FI | | equivalent name -39804 | Enterobacteria phage FI | | equivalent name -39804 | Enterobacteria phage isolate FI | | equivalent name -39804 | Escherichia virus FI | | equivalent name -39804 | Qubevirus faecium | | scientific name -39804 | phage FI | | equivalent name -39804 | serumgroup IV | | equivalent name -39829 | Ocypodoidea | | scientific name -39831 | "Bacterium rhinoscleromatis" (Trevisan 1887) Migula 1900 | | authority -39831 | ATCC 13884 | ATCC 13884 | type material -39831 | Bacterium rhinoscleromatis | | synonym -39831 | CCUG 417 | CCUG 417 | type material -39831 | CIP 52.210 | CIP 52.210 | type material -39831 | DSM 16231 | DSM 16231 | type material -39831 | JCM 1664 | JCM 1664 | type material -39831 | Klebsiella pneumoniae subsp. rhinoscleromatis | | scientific name -39831 | Klebsiella pneumoniae subsp. rhinoscleromatis (Trevisan 1887) Orskov 1984 | | authority -39831 | Klebsiella rhinoscleromatis | | synonym -39831 | Klebsiella rhinoscleromatis Trevisan 1887 (Approved Lists 1980) | | authority -39831 | LMG 3184 | LMG 3184 | type material -39831 | LMG:3184 | LMG:3184 | type material -39831 | NCTC 5046 | NCTC 5046 | type material -40065 | Chenuda complex | | equivalent name -40065 | Chenuda virus | | scientific name -40067 | Wad Medani complex | | equivalent name -40067 | Wad Medani virus | | scientific name -40068 | unclassified Orbivirus | | scientific name -40092 | Hesperioidea | | scientific name -40093 | Hesperiidae | | scientific name -40093 | skippers | | genbank common name -40119 | Parvovirinae | | scientific name -40120 | Densovirinae | | scientific name -40122 | Iteradensovirus | | scientific name -40122 | Iteravirus | | equivalent name -40272 | Roseolovirus | | scientific name -40562 | Strophariaceae | | scientific name -40562 | Strophariaceae Singer & A.H. Sm., 1946 | | authority -40588 | Dipterocarpaceae | | scientific name -40588 | Dipterocarpaceae Blume, 1825 | | authority -40588 | meranti family | | common name -40674 | Mammalia | | scientific name -40674 | mammals | mammals | blast name -40674 | mammals | mammals | genbank common name -40948 | Angelica | | scientific name -40948 | Angelica L., 1753 | | authority -41071 | Adephaga | | scientific name -41073 | Carabidae | | scientific name -41073 | ground beetles | | genbank common name -41084 | Polyphaga | Polyphaga | scientific name -41088 | Chrysomeliformia | Chrysomeliformia | includes -41088 | Cucujiformia | | scientific name -41154 | Prioninae | | scientific name -41155 | Lepturinae | | scientific name -41191 | Glossata | | scientific name -41196 | Neolepidoptera | | scientific name -41197 | Heteroneura | | scientific name -41479 | Aster | | scientific name -41479 | Aster L., 1753 | | authority -41549 | Cirsium | | scientific name -41549 | Cirsium Mill., 1754 | | authority -41665 | Neopterygi | | synonym -41665 | Neopterygii | | scientific name -41666 | Batrachia | | scientific name -41705 | Protacanthopterygii | | scientific name -41768 | Berberidales | | includes -41768 | Berberidineae | | includes -41768 | Ranunculales | | scientific name -41768 | Ranunculineae | | includes -41773 | Berberidaceae | | scientific name -41773 | Berberidaceae Juss., 1789 | | authority -41773 | Podophyllaceae | | includes -41773 | barberry family | | common name -41827 | Culicoidea | | scientific name -41937 | Rutanae | | in-part -41937 | Sapindales | | scientific name -41938 | Malvales | | scientific name -41938 | Malvanae | | in-part -43358 | HAstV-8 | | acronym -43358 | Human astrovirus 8 | | scientific name -43358 | Human astrovirus type 8 | | equivalent name -43464 | Circaetus | | scientific name -43786 | Culicomorpha | | scientific name -43817 | Culicinae | | scientific name -43951 | Zygnema | | scientific name -43951 | Zygnema C.Agardh, 1817 | | authority -44560 | AYVV | | acronym -44560 | Ageratum yellow vein virus | | scientific name -45234 | Cordyceps | | scientific name -45234 | Cordyceps Fr., 1833 | | authority -45234 | Parahevansia | | synonym -45234 | Parahevansia Mongkolsamrit & Noisripoom, 2022 | | authority -45357 | ATCC 22991 | ATCC 22991 | type material -45357 | CBS 5149 | CBS 5149 | type material -45357 | Candida haemuli (Uden & Kolip.) S.A. Mey. & Yarrow 1978 | | synonym -45357 | Candida haemulonii | | synonym -45357 | Candida haemulonii type II | | includes -45357 | Candida haemulonis | | synonym -45357 | Candidozyma haemuli | | scientific name -45357 | Candidozyma haemuli (Uden & Kolip.) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai, 2024 | | authority -45357 | DBVPG 6958 | DBVPG 6958 | type material -45357 | IFO 10001 | IFO 10001 | type material -45357 | IGC 3025 | IGC 3025 | type material -45357 | JCM 3762 | JCM 3762 | type material -45357 | NRRL Y-6693 | NRRL Y-6693 | type material -45357 | Torulopsis haemuli Uden & Kolip., 1962 | | synonym -45357 | Torulopsis haemuloni | | synonym -45357 | specimen-voucher:NRRL:Y:6693 | specimen-voucher:NRRL:Y:6693 | type material -45607 | AJ 4995 | AJ 4995 | type material -45607 | ATCC 60130 | ATCC 60130 | type material -45607 | CBS 6739 | CBS 6739 | type material -45607 | CCRC 22618 | CCRC 22618 | type material -45607 | CCRC:22618 | CCRC:22618 | type material -45607 | Candida sorbophila | | synonym -45607 | IFO 1583 | IFO 1583 | type material -45607 | JCM 1514 | JCM 1514 | type material -45607 | NRRL Y-7921 | NRRL Y-7921 | type material -45607 | Torulopsis sorbophila | | synonym -45607 | Torulopsis sorbophila Nakase, 1975 | | authority -45607 | Wickerhamiella sorbophila | | scientific name -45607 | Wickerhamiella sorbophila (Nakase) C. Vega & Lachance, 2017 | | authority -45607 | specimen-voucher:NRRL:Y:7921 | specimen-voucher:NRRL:Y:7921 | type material -45787 | Wickerhamiella | | scientific name -45787 | Wickerhamiella Van der Walt & Liebenberg, 1973 | | authority -45950 | Dreissenidae | | scientific name -45951 | Dreissena | | scientific name -46108 | Suaeda | | scientific name -46108 | Suaeda Forssk. ex J.F.Gmel., 1776 | | authority -46108 | sea-blites | | common name -46108 | seepweeds | | genbank common name -46366 | Bupleurum | | scientific name -46366 | Bupleurum L. | | authority -46569 | Termitidae | | scientific name -46569 | desert termites | | genbank common name -46569 | higher termites | | common name -46619 | Sweet potato G virus | | equivalent name -46619 | Sweet potato virus G | | scientific name -47455 | Pariana | | scientific name -47455 | Pariana Aubl., 1775 | | authority -47456 | Pariana radiciflora | | scientific name -47456 | Pariana radiciflora Sagot ex Doell., 1877 | | authority -47520 | Palaeoheterodonta | | scientific name -47521 | Unionida | | scientific name -47521 | Unionoida | | synonym -47522 | Unionacea | | synonym -47522 | Unionoidea | | scientific name -47523 | Ambleminae | | scientific name -47523 | Pleurobeminae | | includes -47523 | Quadrulinae | | includes -47524 | Amblema | | scientific name -47526 | Unionidae | | scientific name -47567 | Contracaecum | | scientific name -49188 | Aconitum | | scientific name -49188 | Aconitum Finet & Gagnep., 1904 | | authority -49669 | Paris | | scientific name -49669 | Paris L., 1753 | | authority -49817 | Erythrina crista-galli | | scientific name -49817 | Erythrina crista-galli L., 1767 | | authority -49817 | ceibo | | common name -49817 | cockspur coraltree | | genbank common name -49817 | cry-baby tree | | common name -50292 | African green monkey cytomegalovirus | | equivalent name -50292 | CeHV-5 | | acronym -50292 | Cercopithecine betaherpesvirus 5 | | scientific name -50292 | Cercopithecine herpesvirus 5 | | equivalent name -50292 | Simian cytomegalovirus (strain Colburn) | | equivalent name -50362 | Melanthiaceae | | scientific name -50362 | Melanthiaceae Batsch ex Borkh., 1797 | | authority -50362 | Trilliaceae | | synonym -50362 | trillium family | | common name -50435 | Hemerobiidae | | scientific name -50435 | brown lacewings | | genbank common name -50435 | trashbugs | | common name -50488 | Zygoptera | | scientific name -50488 | damselflies | damselflies | blast name -50488 | damselflies | damselflies | genbank common name -50489 | Calopterygidae | | scientific name -50489 | broad-winged damselflies | | genbank common name -50515 | Dytiscidae | | scientific name -50515 | predacious diving beetles | | genbank common name -50557 | Insecta | | scientific name -50557 | insects | insects | blast name -50557 | insects | insects | genbank common name -50557 | true insects | | common name -50713 | Cocal virus | | scientific name -51909 | Pyrrhura | | scientific name -52123 | Oceanodroma | | scientific name -52360 | Amblema perplicata | | scientific name -52360 | Amblema plicata | | synonym -52360 | Unio plicata | | synonym -52360 | Unio plicata Say, 1817 | | authority -52974 | Bartramiaceae | | scientific name -52974 | Bartramiaceae Schwaegr., 1830 | | authority -52975 | Bartramia | Bartramia | scientific name -52975 | Bartramia Hedw., 1801 | | authority -52976 | Bartramia pomiformis | | scientific name -52976 | Bartramia pomiformis Hedw., 1801 | | authority -53017 | Batken virus | | scientific name -53058 | Chiloschista | | scientific name -53058 | Chiloschista Lindl., 1832 | | authority -53124 | Phragmipedilum | | synonym -53124 | Phragmipedium | | scientific name -53124 | Phragmipedium Rolfe, 1896 | | authority -53300 | Macrophthalmus | | scientific name -53541 | Stegomyia | | scientific name -54049 | Stercorariidae | | scientific name -54057 | Catharacta | | synonym -54057 | Stercorarius | | scientific name -54057 | Stercorarius Brisson, 1760 | | authority -54059 | Larus parasiticus | | synonym -54059 | Larus parasiticus Linnaeus, 1758 | | authority -54059 | Stercorarius parasiticus | | scientific name -54354 | Aramidae | | scientific name -54354 | limpkins | | genbank common name -54355 | Aramus | | scientific name -54356 | Aramus guarauna | | scientific name -54356 | Aramus guarauna (Linnaeus, 1766) | | authority -54356 | Scolopax guarauna | | synonym -54356 | Scolopax guarauna Linnaeus, 1766 | | authority -54356 | limpkin | | genbank common name -54357 | Psophiidae | | scientific name -54357 | trumpeters | | genbank common name -54358 | Psophia | | scientific name -54359 | Psophia crepitans | | scientific name -54359 | Psophia crepitans Linnaeus, 1758 | | authority -54359 | common trumpeter | | genbank common name -54757 | Plasmodium vinckei subsp. vinckei | | synonym -54757 | Plasmodium vinckei vinckei | | scientific name -55136 | Myliobatinae | | scientific name -55136 | eagle rays | | genbank common name -55193 | Malassezia | | scientific name -55193 | Malassezia Baill., 1889 | | authority -55267 | Maricola | | scientific name -55867 | Scolytidae | | synonym -55867 | Scolytinae | | scientific name -55867 | ambrosia beetles | ambrosia beetles | common name -55867 | bark beetles | | genbank common name -56259 | Accipitridae | | scientific name -56301 | Musophagiformes | | scientific name -56301 | turacos | | genbank common name -56302 | Musophagidae | | scientific name -56308 | Trogoniformes | | scientific name -56308 | trogons and quetzals | | genbank common name -56309 | Trogonidae | | scientific name -56310 | Trogon | | scientific name -56311 | Trogon melanurus | | scientific name -56311 | Trogon melanurus Swainson, 1838 | | authority -56311 | black-tailed trogon | | genbank common name -56342 | Herpetotheres | | scientific name -56343 | Falco cachinnans | | synonym -56343 | Falco cachinnans Linnaeus, 1758 | | authority -56343 | Herpetotheres cachinnans | | scientific name -56646 | CBS 458.93 | CBS 458.93 | type material -56646 | Fusarium venenatum | | scientific name -56646 | Fusarium venenatum Nirenberg, 1995 | | authority -56646 | Fusarium venetum | | synonym -56646 | ICMP:20649 | ICMP:20649 | type material -56785 | Nucifraga | | scientific name -56866 | Cucumis acutangulus | | synonym -56866 | Cucumis acutangulus L., 1753 | | authority -56866 | Cucurbita acutangula | | synonym -56866 | Cucurbita acutangula (L.) Blume, 1826 | | authority -56866 | Luffa acutangula | | scientific name -56866 | Luffa acutangula (L.) Roxb., 1832 | | authority -56866 | angled luffa | | genbank common name -56866 | ribbed gourd | | common name -56866 | ribbed luffa | | common name -56866 | ridged gourd | | common name -56866 | silky gourd | | common name -56866 | singkwa towel gourd | | common name -57379 | Bucerotiformes | | scientific name -57379 | Upupiformes | | includes -57379 | hoopoes and others | | common name -57379 | hornbills | | genbank common name -57382 | Centropidae | | scientific name -57383 | Cerylidae | | scientific name -57401 | Centropus | | scientific name -57405 | Chloroceryle | | scientific name -58019 | Coniferophyta | | equivalent name -58019 | Coniferopsida | | synonym -58019 | Pinopsida | | scientific name -58019 | conifers | | common name -58023 | Tracheophyta | | scientific name -58023 | Tracheophyta Sinnott ex Cavalier-Smith, 1998 | | authority -58023 | vascular plants | vascular plants | blast name -58023 | vascular plants | vascular plants | common name -58024 | Spermatophyta | | scientific name -58024 | seed plants | seed plants | blast name -58024 | seed plants | seed plants | common name -58627 | ATCC 20278 | ATCC 20278 | type material -58627 | BCRC 21710 | BCRC 21710 | type material -58627 | CBS 789 | CBS 789 | type material -58627 | CECT 11370 | CECT 11370 | type material -58627 | CECT 11370T | CECT 11370T | type material -58627 | Debaryomyces fabryi | | scientific name -58627 | Debaryomyces fabryi M. Ota, 1924 | | authority -58627 | Debaryomyces fabryi M.Ota, 1924 | | authority -58627 | Debaryomyces hansenii var. fabryi | | synonym -58627 | Debaryomyces hansenii var. fabryi (M.Ota) Nakase & M. Suzuki 1985 | | authority -58627 | IFO 0015 | IFO 0015 | type material -58627 | JCM 2104 | JCM 2104 | type material -58627 | KCTC 7603 | KCTC 7603 | type material -58627 | NBRC 0015 | NBRC 0015 | type material -58627 | NRRL Y-17914 | NRRL Y-17914 | type material -58627 | Y-17914 | Y-17914 | type material -58627 | type strain: CBS 789 | type strain: CBS 789 | type material -59171 | Patrinia | | scientific name -59171 | Patrinia Juss., 1807 | | authority -59172 | Patrinia rupestris | | scientific name -59172 | Patrinia rupestris Dufr., 1811 | | authority -59500 | Rice necrosis mosaic virus | | scientific name -60456 | Iris yellow spot virus | | scientific name -60807 | Scaritini | | scientific name -60808 | Scarites | | scientific name -60809 | Scarites subterraneus | | scientific name -60809 | Scarites subterraneus Fabricius, 1775 | | authority -62020 | Mnais | | scientific name -62020 | Mnais Selys, 1853 | | authority -62110 | Dahlstedtia | | scientific name -62110 | Dahlstedtia Malme, 1905 | | authority -62784 | Tettigoniidae | | scientific name -62784 | bush-crickets | | common name -62784 | bushcrickets | | common name -62784 | katydids | | genbank common name -62784 | long-horned grasshoppers | | common name -63225 | Lepus townsendii | | scientific name -63225 | Lepus townsendii Bachman, 1839 | | authority -63225 | white-tailed jackrabbit | | genbank common name -63405 | Arthroderma otae | | synonym -63405 | Arthroderma otae (A. Haseg. & Usui) McGinnis, Weitzman, A.A. Padhye & Ajello, 1986 | | synonym -63405 | CBS 496.86 | CBS 496.86 | type material -63405 | Microsporum canis | | scientific name -63405 | Microsporum canis E. Bodin ex Gueg., 1902 | | authority -63405 | Nannizzia otae | | synonym -63405 | Nannizzia otae A. Haseg. & Usui 1974 | | authority -64021 | Cherry small circular viroid-like RNA | | scientific name -64579 | Vatica | | scientific name -64579 | Vatica L. | | authority -65009 | Dipterocarpoideae | | scientific name -65068 | PRMV | | acronym -65068 | Peach rosette mosaic virus | | scientific name -65068 | peach rosette mosaic Nepovirus | | equivalent name -65386 | Anomalodesmata | | scientific name -65386 | Pholadomyoida | | synonym -66236 | Philopteridae | | scientific name -66236 | bird lice | | genbank common name -67753 | Crinivirus | | scientific name -67762 | TbLCV | | acronym -67762 | Tobacco leaf curl virus | | scientific name -67762 | tobacco leaf curl geminivirus | | equivalent name -67762 | tobacco leafcurl virus | | equivalent name -68416 | Woolly monkey hepatitis B virus | | scientific name -69720 | Zantedeschia | | scientific name -69720 | Zantedeschia Spreng., 1826 | | authority -69721 | Calla aethiopica | | synonym -69721 | Calla aethiopica L., 1753 | | authority -69721 | Zantedeschia aethiopica | | scientific name -69721 | Zantedeschia aethiopica (L.) Spreng., 1826 | | authority -69721 | arum-lily | | common name -69721 | calla lily | | genbank common name -69721 | pig-lily | | common name -69973 | Closteroviridae | | scientific name -70085 | Sicyopterus | | scientific name -70170 | Green turtle herpesvirus | | scientific name -70439 | Chaenodraco | | scientific name -70440 | Chaenodraco wilsoni | | scientific name -70440 | Chaenodraco wilsoni Regan, 1914 | | authority -70440 | spiny icefish | | common name -70564 | Hawaiian green turtle herpesvirus | | scientific name -70778 | Acropora nasuta | | scientific name -70778 | Madrepora nasuta | | synonym -70778 | Madrepora nasuta Dana, 1846 | | authority -70893 | Calopterygoidea | | scientific name -70905 | Tettigonioidea | | scientific name -70987 | Apinae | | scientific name -70987 | honey bees | | genbank common name -71112 | Lontra | | scientific name -71112 | Lontra Gray, 1843 | | authority -71239 | Cucurbitales | | scientific name -71239 | Cucurbitales Juss. ex Bercht. & J.Presl, 1820 | | authority -71240 | Dicotyledoneae | | in-part -71240 | dicots | | in-part -71240 | dicotyledons | | in-part -71240 | eudicots | eudicots | blast name -71240 | eudicots | eudicots | common name -71240 | eudicotyledons | | scientific name -71274 | Asteridae | | equivalent name -71274 | asterids | | scientific name -71275 | Rosidae | | in-part -71275 | rosids | | scientific name -71528 | Chrysomeliformia | Chrysomeliformia | in-part -71528 | Chrysomeloidea | | scientific name -71528 | Phytophaga | | in-part -71529 | Chrysomeliformia | Chrysomeliformia | in-part -71529 | Curculionoidea | | scientific name -71529 | Phytophyaga | | in-part -71950 | Psilocybe | | scientific name -71950 | Psilocybe (Fr.) P. Kumm., 1871 | | authority -72018 | Sphaeroforma | | scientific name -72019 | Sphaeroforma arctica | | scientific name -72019 | Sphaerosoma arcticum | | synonym -72019 | Sphaerosoma arcticus | | synonym -72025 | Fabales | | scientific name -72041 | Eumalacostraca | | scientific name -72407 | ATCC 13883 | ATCC 13883 | type material -72407 | CCUG 225 | CCUG 225 | type material -72407 | CDC 298-53 | CDC 298-53 | type material -72407 | CIP 82.91 | CIP 82.91 | type material -72407 | Citrobacter sp. 43UCKPC_BLUE2PLATE | | includes -72407 | Citrobacter sp. 43UCKPC_BLUE4LB | | includes -72407 | DSM 30104 | DSM 30104 | type material -72407 | Enterobacteriaceae bacterium 291_EBAC | | includes -72407 | HAMBI 450 | HAMBI 450 | type material -72407 | IAM 14200 | IAM 14200 | type material -72407 | IFO 14940 | IFO 14940 | type material -72407 | JCM 1662 | JCM 1662 | type material -72407 | Klebsiella pneumoniae subsp. pneumoniae | | scientific name -72407 | Klebsiella pneumoniae subsp. pneumoniae (Schroeter 1886) Trevisan 1887 | | authority -72407 | Klebsiella sp. CCUG 225 | | includes -72407 | Klebsiella sp. NCTC 8172 | | includes -72407 | Klebsiella sp. VTT E-95647 | | includes -72407 | Klebsiella sp. VTT E-96687 | | includes -72407 | LMG 2095 | LMG 2095 | type material -72407 | LMG:2095 | LMG:2095 | type material -72407 | NBRC 14940 | NBRC 14940 | type material -72407 | NCTC 9633 | NCTC 9633 | type material -72876 | Varunidae | | scientific name -73275 | Helianthus argophyllus | | scientific name -73275 | Helianthus argophyllus Torr. & A.Gray, 1842 | | authority -73496 | Asparagales | | scientific name -73496 | Asparagales Link, 1829 | | authority -73496 | Liliales/Asparagales group | Liliales/Asparagales group | in-part -73496 | Liliiflorae | Liliiflorae | in-part -73501 | Clavaria militaris | | synonym -73501 | Clavaria militaris L., 1753 | | authority -73501 | Cordyceps militaris | | scientific name -73501 | Cordyceps militaris (L.) Fr., 1818 | | authority -74132 | Symphysodon | Symphysodon | scientific name -74133 | Symphysodon aequifasciata | | scientific name -74133 | Symphysodon aequifasciata Pellegrin, 1904 | | authority -74133 | Symphysodon aequifasciatus | | synonym -74133 | blue discus | | genbank common name -74133 | green discus | | common name -74320 | BusuNPV | | acronym -74320 | Buzura suppressaria NPV | | equivalent name -74320 | Buzura suppressaria nuclear polyhedrosis virus | | synonym -74320 | Buzura suppressaria nucleocapsid nuclear polyhedrosis virus | | equivalent name -74320 | Buzura suppressaria nucleopolyhedrosisvirus | | equivalent name -74320 | Buzura suppressaria nucleopolyhedrovirus | | scientific name -74320 | Buzura suppressaria single nucleocapsid nuclear polyhedrosis virus | | equivalent name -74649 | China rose | | common name -74649 | Rosa chinensis | | scientific name -74649 | Rosa chinensis Jacq., 1768 | | authority -74649 | Rosa indica auct., non L. | | synonym -74694 | Veronicastrum | | scientific name -74694 | Veronicastrum Heist. ex Fabr., 1759 | | authority -75725 | Enterobacteria phage NL95 | | scientific name -75725 | bacteriophage NL95 | | equivalent name -75739 | Eucoccidiida | | synonym -75739 | Eucoccidiorida | | scientific name -75747 | FUPO-1 | | acronym -75747 | Fusarium poae virus 1 | | scientific name -76717 | Lontra canadensis | | scientific name -76717 | Lontra canadensis Schreber, 1777 | | authority -76717 | Lutra canadensis | | synonym -76717 | Northern American river otter | | genbank common name -76717 | river otter | | common name -76775 | ATCC 96801 | ATCC 96801 | type material -76775 | CBS 7877 | CBS 7877 | type material -76775 | Malassezia restricta | | scientific name -76775 | Malassezia restricta E. Gueho, J. Guillot & Midgley, 1996 | | authority -76803 | Arteriviridae | | scientific name -76804 | Nidovirales | | scientific name -77519 | Plasmodium gonderi | | scientific name -78060 | Alectoriaceae | | synonym -78060 | Anziaceae | | synonym -78060 | Parmeliaceae | | scientific name -78536 | Euphyllophyta | | scientific name -78536 | euphyllophytes | | equivalent name -79078 | Stylosanthes scabra | | scientific name -79078 | Stylosanthes scabra Vogel, 1838 | | authority -79078 | shrubby stylo | | common name -79236 | Cotton yellow mosaic geminivirus | | equivalent name -79236 | Cotton yellow mosaic virus | | scientific name -79514 | Lamiinae | | scientific name -79514 | Laminae | | synonym -79633 | Hydrobates tethys | | synonym -79633 | Hydrobates tethys (Bonaparte, 1852) | | authority -79633 | Oceanodroma tethys | | scientific name -79633 | Oceanodroma tethys (Bonaparte, 1852) | | authority -79633 | Wedge-rumped storm-petrel | | genbank common name -79652 | Oceanites | | scientific name -79653 | Oceanites oceanicus | | scientific name -79653 | Oceanites oceanicus (Kuhl, 1820) | | authority -79653 | Procellaria oceanica | | synonym -79653 | Procellaria oceanica Kuhl, 1820 | | authority -79653 | Wilson's storm-petrel | | genbank common name -82582 | Apaturinae | | scientific name -82582 | emperor butterflies | | genbank common name -82582 | emperors | emperors | common name -82676 | Omikronpapillomavirus 1 | | scientific name -82676 | Phocoena spinipinnis papillomavirus | | equivalent name -83312 | Apis nigrocincta | | scientific name -83312 | Apis nigrocincta Smith, 1860 | | authority -83321 | Apini | | scientific name -83871 | Chrysanthemum stem necrosis virus | | scientific name -85103 | Burhinidae | | scientific name -85104 | Burhinus | | scientific name -85512 | Dicondylia | | scientific name -85545 | Hydrobatidae | | scientific name -85545 | Hydrobatinae | | synonym -85545 | Oceanitidae | | synonym -85545 | storm petrels | | common name -85604 | Amphiesmenoptera | | scientific name -85817 | Neuroptera group | | includes -85817 | Neuroptera-Megaloptera-Raphidoptera group | | includes -85817 | Neuropterida | | scientific name -85819 | Phthiraptera | | scientific name -85819 | Phthiraptera Haeckel, 1896 | | authority -85819 | lice | lice | blast name -85819 | lice | lice | genbank common name -85823 | Blattaria | | synonym -85823 | Blattodea | | scientific name -85823 | Blattoptera | | synonym -85823 | cockroaches & termites | cockroaches & termites | blast name -85823 | cockroaches & termites | cockroaches & termites | genbank common name -86721 | Kmeria duperreana | | synonym -86721 | Kmeria duperreana (Pierre) Dandy, 1927 | | authority -86721 | Magnolia duperreana | | scientific name -86721 | Magnolia duperreana Pierre, 1880 | | authority -86989 | Emmenopterys | | scientific name -86989 | Emmenopterys Oliv., 1889 | | authority -86990 | Emmenopterys henryi | | scientific name -86990 | Emmenopterys henryi Oliv., 1889 | | authority -87139 | Aetobatus | | scientific name -88159 | Alaria praelonga | | scientific name -88159 | Alaria praelonga Kjellman, 1889 | | authority -88770 | Panarthropoda | | scientific name -89593 | Craniata | Craniata | scientific name -90010 | unclassified Enterovirus | | scientific name -90010 | unclassified Enteroviruses | | equivalent name -91347 | Enterobacterales | | scientific name -91347 | Enterobacterales Adeolu et al. 2016 | | authority -91347 | Enterobacteriaceae and related endosymbionts | | synonym -91347 | Enterobacteriaceae group | | synonym -91347 | Enterobacteriales | | synonym -91347 | gamma-3 proteobacteria | gamma-3 proteobacteria | in-part -91561 | Artiodactyla | | scientific name -91561 | Cetartiodactyla | | synonym -91561 | even-toed ungulates & whales | even-toed ungulates & whales | blast name -91561 | even-toed ungulates & whales | even-toed ungulates & whales | genbank common name -91771 | Megalaimidae | | scientific name -91776 | Psilopogon | | scientific name -91827 | Gunneridae | | scientific name -91827 | Gunneridae D.E.Soltis, P.S.Soltis & W.S.Judd, 2007 | | authority -91827 | core eudicots | | equivalent name -91827 | core eudicotyledons | | equivalent name -91835 | eurosids I | | synonym -91835 | fabids | | scientific name -91836 | eurosids II | | includes -91836 | malvids | | scientific name -91882 | Asteranae | | includes -91882 | campanulids | | scientific name -91882 | euasterids II | | synonym -91888 | Gentiananae | | includes -91888 | euasterids I | | synonym -91888 | lamiids | | scientific name -92738 | Termitinae | | scientific name -92738 | snapping termites | | genbank common name -93386 | Columbid alphaherpesvirus 1 | | scientific name -93386 | Columbid herpesvirus 1 | | equivalent name -93386 | Columbid herpesvirus type 1 | | equivalent name -93386 | Pigeon herpesvirus | | equivalent name -94231 | Epinephelus | | scientific name -94231 | Promicrops | | synonym -94243 | Stromateidae | | scientific name -94243 | butterfishes | | genbank common name -94642 | Besnoitia | | scientific name -94643 | Besnoitia besnoiti | | scientific name -94844 | Ligula | | scientific name -94845 | Fasciola intestinalis | | synonym -94845 | Fasciola intestinalis Linnaeus, 1758 | | authority -94845 | Ligula intestinalis | | scientific name -95179 | Agrotinae | | synonym -95179 | Noctuinae | | scientific name -95337 | Vesivirus | | scientific name -95341 | Sapovirus | | scientific name -95341 | Sapporo-like viruses | | equivalent name -98220 | Alaria crassifolia | | scientific name -98220 | Alaria crassifolia Kjellman, 1885 | | authority -98221 | Alaria marginata | | scientific name -98221 | Alaria marginata Postels & Ruprecht, 1840 | | authority -99756 | Engaeus | | scientific name -100182 | Granada hare | | genbank common name -100182 | Lepus granatensis | | scientific name -100182 | Lepus granatensis Rosenhauer, 1856 | | authority -100750 | Limenitidinae | | scientific name -101203 | Saprolegnia parasitica | | scientific name -102804 | Asteroideae | | scientific name -102804 | Asteroideae Lindl., 1829 | | authority -102805 | Barnadesioideae | | scientific name -102805 | Barnadesioideae (D.Don) Bremer & Jansen, 1992 | | authority -102809 | Astereae | | scientific name -102809 | Astereae Cass., 1819 | | authority -102814 | Heliantheae | | scientific name -102814 | Heliantheae Cass., 1819 | | authority -102818 | Cardueae | | scientific name -102818 | Cardueae Cass., 1819 | | authority -103490 | Cyclobalanopsis gilva | | synonym -103490 | Cyclobalanopsis gilva (Blume) Oerst. | | authority -103490 | Quercus gilva | | scientific name -103490 | Quercus gilva Blume, 1851 | | authority -103723 | Grapevine Red Globe virus | | scientific name -103955 | Corythaixoides | | scientific name -103956 | Corythaix concolor | | synonym -103956 | Corythaix concolor Smith, 1833 | | authority -103956 | Corythaixoides concolor | | scientific name -103956 | Corythaixoides concolor (Smith, A, 1833) | | authority -103956 | Crinifer concolor | | synonym -103956 | Crinifer concolor (Smith, 1833) | | authority -103956 | grey go-away-bird | | genbank common name -104430 | Apoditrysia | | scientific name -104431 | Obtectomera | | scientific name -104435 | Zygaenoidea | | scientific name -104766 | Nanovirus | | scientific name -105711 | Dreissenoidea | | scientific name -106324 | Ascaris osculata | | synonym -106324 | Ascaris osculata Rudolphi, 1802 | | authority -106324 | Contracaecum osculatum | | scientific name -106324 | Contracaecum osculatum (Rudolphi, 1802) | | authority -106324 | Contracaecum osculatum C | | includes -106325 | Contracaecum osculatum baicalensis | | scientific name -106742 | Cyclograpsus | | scientific name -107843 | Hydroporinae | | scientific name -107924 | Porhydrus | | scientific name -110618 | Nectriaceae | | scientific name -110618 | Nectriaceae Tul. & C. Tul., 1865 | | authority -110618 | mitosporic Nectriaceae | | includes -111067 | Pagurus longicarpus | | scientific name -111067 | Pagurus longicarpus Say, 1817 | | authority -111067 | long-clawed hermit crab | | genbank common name -111670 | Cladonia rangiferina | | scientific name -111670 | Cladonia rangiferina (L.) Weber, 1780 | | authority -111670 | Lichen rangiferinus | | synonym -111670 | Lichen rangiferinus L., 1753 | | authority -112415 | Letharia | | scientific name -112415 | Letharia (Th. Fr.) Zahlbr., 1892 | | authority -113113 | Rhinopomastidae | | scientific name -113114 | Rhinopomastus | | scientific name -113115 | Falcinellus cyanomelas | | synonym -113115 | Falcinellus cyanomelas Vieillot, 1819 | | authority -113115 | Rhinopomastus cyanomelas | | scientific name -113115 | common scimitar-bill | | genbank common name -114658 | Bryidae | | scientific name -114658 | Bryidae Engl., 1892 | | authority -115354 | Zygaenidae | | scientific name -115354 | burnets | | genbank common name -115354 | smoky moths | | common name -116704 | Eubrachyura | | scientific name -116707 | Brachyrhyncha | Brachyrhyncha | in-part -116707 | Thoracotremata | | scientific name -117010 | Agaricus constrictus | | synonym -117010 | Agaricus constrictus Fr., 1821 | | authority -117010 | Calocybe constricta | | synonym -117010 | Calocybe constricta (Fr.) Kuhner ex Singer, 1962 | | authority -117010 | Tricholomella constricta | | scientific name -117010 | Tricholomella constricta (Fr.) Zerova ex Kalamees, 1992 | | authority -117570 | Teleostomi | | scientific name -117571 | Euteleostomi | | scientific name -117571 | bony vertebrates | | genbank common name -117574 | unclassified Microviridae | | scientific name -117677 | Phaneropteridae | | synonym -117677 | Phaneropterinae | | scientific name -117677 | broad-winged katydids | | common name -117677 | false katydids | | common name -117677 | leaf katydids | | genbank common name -117678 | Poecilimon | | scientific name -117776 | Acropora divaricata | | scientific name -117776 | Acropora divaricata (Dana, 1846) | | authority -117776 | Acropora stoddarti | | synonym -117776 | Madrepora divaricata | | synonym -117776 | Madrepora divaricata Dana, 1846 | | authority -117778 | Acropora yongei | | scientific name -117778 | Acropora yongei Veron & Wallace, 1984 | | authority -117851 | Myliobatiformes | | scientific name -117893 | Batoidea | | scientific name -117893 | rays | | genbank common name -119089 | Adenophorea | | synonym -119089 | Chromadorea | | scientific name -119164 | Betaluteovirus | | equivalent name -119164 | Polerovirus | | scientific name -119164 | Potleavirus | | equivalent name -119164 | luteovirus subgroup II | | equivalent name -119257 | Endromidae | | scientific name -119257 | Mirinidae | | synonym -119257 | Oberthueriinae | | synonym -119257 | Oberthuerinae | | synonym -119257 | Prismostictinae | | synonym -119257 | glory moths | | genbank common name -120864 | Zeleinae | | scientific name -120865 | Zele | | scientific name -121422 | Phoenicurus | | scientific name -121822 | Calophyidae | | scientific name -121823 | Calophya | | scientific name -121826 | Trioza urticae | | scientific name -122260 | Digramma | | scientific name -122261 | Digramma interrupta | | scientific name -123365 | Neoteleostei | | scientific name -123366 | Eurypterygia | | scientific name -123366 | Eurypterygii | | synonym -123367 | Ctenosquamata | | scientific name -123368 | Acanthomorpha | | synonym -123368 | Acanthomorphata | | scientific name -123369 | Euacanthomorpha | | synonym -123369 | Euacanthomorphacea | | scientific name -123757 | Astrocoeniina | | scientific name -124006 | Cyclorhipidion | | scientific name -124426 | Ustilaginoidea | | scientific name -124426 | Ustilaginoidea Bref., 1895 | | authority -124426 | Villosiclava | | synonym -124426 | Villosiclava E. Tanaka & C. Tanaka, 2009 | | authority -124960 | Iodes | | scientific name -124960 | Iodes Blume, 1825 | | authority -126287 | Didelphinae | | scientific name -127916 | DRIP clade | | synonym -127916 | Ichthyosporea | | scientific name -127916 | Ichthyosporea Cavalier-Smith, 1998 | | authority -127916 | Mesomycetozoa | | synonym -127916 | Mesomycetozoea | | synonym -127916 | Mesomycetozoea Mendoza et al., 2002 | | authority -128790 | BRMV | | acronym -128790 | Bean rugose mosaic virus | | scientific name -128818 | Chinese yam necrotic mosaic virus | | scientific name -129017 | Microhyla | | scientific name -129725 | Foveavirus | | scientific name -130990 | Entransia | | scientific name -130990 | Entransia E.O.Hughes, 1948 | | authority -130991 | Entransia fimbriata | | scientific name -130991 | Entransia fimbriata E.O.Hughes | | authority -131209 | Conjugatophyceae | | synonym -131209 | Gamophyceae | | synonym -131209 | Gamophyta | | synonym -131209 | Zygnematophyceae | | scientific name -131209 | Zygnematophyceae van den Hoek et al., 1995 | | authority -131209 | Zygnemophyceae | | synonym -131209 | conjugating green algae | | common name -131210 | Desmidiales | | scientific name -131210 | Desmidiales Bessey, 1907 | | authority -131210 | desmids | | common name -131211 | Closteriaceae | | scientific name -131211 | Closteriaceae Bessey, 1907 | | authority -131220 | Klebsormidiophyceae | | scientific name -131220 | Klebsormidiophyceae van den Hoek et al., 1995 | | authority -131220 | algae | algae | in-part -131221 | Charophyta/Embryophyta group | | synonym -131221 | Streptophytina | | scientific name -131221 | charophyte/embryophyte group | | equivalent name -131567 | biota | | synonym -131567 | cellular organisms | | scientific name -133550 | Crinozoa | | includes -133550 | Pelmatozoa | | scientific name -135166 | Bucconidae | | scientific name -135167 | Bucco | | scientific name -135168 | Bucco capensis | | scientific name -135168 | Bucco capensis Linnaeus, 1766 | | authority -135168 | collared puffbird | | genbank common name -135425 | Nectariniidae | | scientific name -135426 | Dicaeum | | scientific name -137443 | MHV-1 | | acronym -137443 | Macropodid alphaherpesvirus 1 | | scientific name -137443 | Macropodid herpesvirus 1 | | equivalent name -137443 | Macropodid herpesvirus type 1 | | equivalent name -137443 | Parma wallaby herpesvirus | | synonym -137443 | wallaby herpesvirus | | equivalent name -137757 | Ipomovirus | | scientific name -138977 | Myotis horsfieldii | | scientific name -138977 | Vespertilio horsfieldii | | synonym -138977 | Vespertilio horsfieldii Temminck, 1840 | | authority -140052 | Betaretrovirus | | scientific name -140052 | Type D Retrovirus group | | includes -144051 | Cricket paralysis-like viruses | | equivalent name -144051 | Cripavirus | | scientific name -145388 | Monoraphidium neglectum | | scientific name -145388 | Monoraphidium neglectum Heynig & Krienitz | | authority -145388 | SAG 48.87 | SAG 48.87 | type material -147100 | Rhabditophora | | scientific name -147271 | Paspalum | | scientific name -147271 | Paspalum L., 1759 | | authority -147271 | crowngrass | | common name -147366 | Bambusoideae | | scientific name -147366 | Bambusoideae Luerss., 1893 | | authority -147368 | Pooideae | | scientific name -147368 | Pooideae Benth., 1861 | | authority -147369 | Centothecoideae | | synonym -147369 | Panicoideae | | scientific name -147369 | Panicoideae Link, 1827 | | authority -147370 | PACC clade | | includes -147370 | PACCAD clade | | includes -147370 | PACMAD clade | | scientific name -147376 | Bambuseae | | scientific name -147376 | Bambuseae Kunth ex Dumort., 1829 | | authority -147376 | bamboo | | genbank common name -147377 | Olyreae | | scientific name -147377 | Olyreae Kunth ex Spenn., 1825 | | authority -147387 | Poeae | | scientific name -147387 | Poeae R. Br., 1814 | | authority -147428 | Paniceae | | scientific name -147428 | Paniceae R.Br., 1814 | | authority -147537 | Saccharomycotina | | scientific name -147537 | budding yeasts & allies | budding yeasts & allies | blast name -147537 | budding yeasts & allies | budding yeasts & allies | genbank common name -147537 | true yeasts | | common name -147538 | Euascomycota | | synonym -147538 | Pezizomycotina | | scientific name -147538 | Pezizomycotina O.E. Erikss. & Winka, 1997 | | authority -147538 | filamentous ascomycetes | | genbank common name -147545 | Chaetothyriomycetes | | includes -147545 | Eurotiomycetes | | scientific name -147545 | Eurotiomycetes O.E. Erikss. & Winka, 1997 | | authority -147545 | Loculoascomycetes | Loculoascomycetes | in-part -147545 | Plectomycetes | Plectomycetes | in-part -147545 | bitunicate ascomycetes | bitunicate ascomycetes | in-part -147547 | Lecanoromycetes | | scientific name -147547 | Lecanoromycetes O.E. Erikss. & Winka, 1997 | | authority -147547 | common lichens | | common name -147550 | Pyrenomycetes | Pyrenomycetes | in-part -147550 | Sordariomycetes | | scientific name -147550 | Sordariomycetes O.E. Erikss. & Winka, 1997 | | authority -150311 | Oligolepis | | scientific name -151340 | Papillomaviridae | | scientific name -151340 | Papillomavirus | | equivalent name -151341 | Polyomaviridae | | scientific name -153135 | Gammaretrovirus | | scientific name -153135 | MLV-related viruses | | equivalent name -153135 | Mammalian type C retrovirus group | | equivalent name -153135 | Mammalian type C retroviruses | | equivalent name -153135 | mammalian type C oncoviruses | | equivalent name -153135 | type C oncoviruses | | equivalent name -153286 | Myotis nigricans | | scientific name -153286 | Vespertilio nigricans | | synonym -153286 | Vespertilio nigricans Schinz, 1821 | | authority -153287 | Myotis thysanodes | | scientific name -153287 | Myotis thysanodes Miller, 1897 | | authority -155616 | Heterobasidiomycetes | | synonym -155616 | Tremellomycetes | | scientific name -155616 | Tremellomycetes Doweld, 2001 | | authority -155616 | Tremellomycetidae | | equivalent name -155619 | Agaricomycetes | | scientific name -155619 | Agaricomycetes Doweld, 2001 | | authority -155619 | Agaricomycetidae sensu Kirk et al. 2001 | | includes -155619 | Homobasidiomycetes | | includes -155619 | Hymenomycetidae | | includes -155768 | Pandoroidea | | scientific name -156152 | Antirrhinaceae | | includes -156152 | Callitrichaceae | | includes -156152 | Globulariaceae | | includes -156152 | Gratiolaceae | | includes -156152 | Hippuridaceae | | includes -156152 | Plantaginaceae | | scientific name -156152 | Plantaginaceae Juss., 1789 | | authority -156152 | Scrophulariaceae | Scrophulariaceae | in-part -156152 | Veronicaceae | | includes -156152 | speedwell family | | common name -156208 | Macluravirus | | scientific name -156505 | Cyclograpsus intermedius | | scientific name -156505 | Cyclograpsus intermedius Ortmann, 1894 | | authority -156511 | Macrophthalminae | | scientific name -156760 | Galapagos penguin | | genbank common name -156760 | Spheniscus mendiculus | | scientific name -156760 | Spheniscus mendiculus Sundevall, 1871 | | authority -157270 | Gooseberry vein banding associated virus | | scientific name -157270 | Gooseberry vein banding virus | | equivalent name -157317 | Anastrangalia | | scientific name -157777 | PeSV | | acronym -157777 | Pea streak virus | | scientific name -157822 | Lecanorineae | | scientific name -158330 | Cypripedioideae | | scientific name -158330 | Cypripedioideae Lindl. ex Endl., 1837 | | authority -158332 | Epidendroideae | | scientific name -158332 | Epidendroideae Lindl. ex Endl., 1837 | | authority -158391 | Cymbidieae | | scientific name -158391 | Cymbidieae Pfitzer, 1887 | | authority -158397 | Vandeae | | scientific name -158397 | Vandeae Lindl., 1826 | | authority -158424 | Aeridinae | | scientific name -158424 | Aeridinae Pfitzer, 1887 | | authority -158424 | Saccolabiinae | | includes -159141 | Sathuperi orthobunyavirus | | equivalent name -159141 | Sathuperi virus | | scientific name -159150 | Shamonda orthobunyavirus | | equivalent name -159150 | Shamonda virus | | scientific name -159322 | Myotis albescens | | scientific name -159322 | Vespertilio albescens | | synonym -159322 | Vespertilio albescens Geoffroy Saint-Hilaire, 1806 | | authority -159325 | Myotis dominicensis | | scientific name -159325 | Myotis dominicensis Miller, 1902 | | authority -159332 | Myotis oxyotus | | scientific name -159332 | Vespertilio oxyotus | | synonym -159332 | Vespertilio oxyotus Peters, 1867 | | authority -159333 | Myotis ruber | | scientific name -159333 | Vespertilio ruber | | synonym -159333 | Vespertilio ruber Geoffroy Saint-Hilaire, 1806 | | authority -159335 | Myotis volans | | scientific name -159335 | Vespertilio volans | | synonym -159335 | Vespertilio volans Allen, 1866 | | authority -159337 | Myotis yumanensis | | scientific name -159337 | Vespertilio yumanensis | | synonym -159337 | Vespertilio yumanensis Allen, 1864 | | authority -160079 | Anatoecus | | scientific name -160148 | Troctomorpha | | scientific name -160148 | Troctomorpha Roesler, 1940 | | authority -160394 | Barbatula | | scientific name -162474 | Malasseziales | | scientific name -162474 | Malasseziales R.T. Moore, 1980 | | authority -163125 | Pampus | | scientific name -163611 | Alticorpus | | scientific name -163725 | Dalbergieae | | scientific name -163725 | Dalbergieae Bronn ex DC., 1825 | | authority -163733 | Millettieae | | scientific name -163733 | Millettieae Miq., 1855 | | authority -163735 | Phaseoleae | | scientific name -163735 | Phaseoleae DC., 1925 | | authority -163739 | Euchresteae | | synonym -163739 | Euchresteae H.Ohashi, 1973 | | authority -163739 | Sophoreae | | scientific name -163739 | Sophoreae Spreng. ex DC., 1825 | | authority -163739 | Thermopsideae | | synonym -163739 | Thermopsideae Yakovlev, 1972 | | authority -165250 | Alfalfa latent carlavirus | | equivalent name -165250 | Alfalfa latent virus | | scientific name -165440 | Dioszegia | | scientific name -165440 | Dioszegia Zsolt, 1957 | | authority -165826 | Melon chlorotic leaf curl virus | | scientific name -166052 | Microhylinae | | scientific name -166126 | Seriata | | scientific name -166236 | Bdellouroidea | | scientific name -166243 | Uteriporidae | | scientific name -166244 | Ectoplaninae | | scientific name -166586 | Aedes flavopictus | | scientific name -166586 | Aedes flavopictus Yamada, 1921 | | authority -166784 | Odontobutidae | | scientific name -166784 | freshwater sleepers | | genbank common name -167449 | Gobius lagocephalus | | synonym -167449 | Gobius lagocephalus Pallas, 1770 | | authority -167449 | Sicydium taeniurum | | synonym -167449 | Sicydium taeniurum Guenther, 1877 | | authority -167449 | Sicyopterus lagocephalus | | scientific name -167449 | Sicyopterus lagocephalus (Pallas, 1770) | | authority -167449 | Sicyopterus taeniurus | | synonym -167449 | Sicyopterus taeniurus (Guenther, 1877) | | authority -168496 | Buddleja albiflora var. hemsleyana | | scientific name -168496 | Buddleja albiflora var. hemsleyana (Koehne) C.K.Schneid., 1912 | | authority -168496 | Buddleja hemsleyana | | synonym -168496 | Buddleja hemsleyana Koehne, 1903 | | authority -168834 | Jeffersonia dubia | | synonym -168834 | Jeffersonia dubia (Maxim.) Benth. & Hook. f. ex Baker & Moore | | authority -168834 | Plagiorhegma dubium | | scientific name -168834 | Plagiorhegma dubium Maxim., 1859 | | authority -169417 | Lutrinae | | scientific name -169618 | Ixoroideae | | scientific name -169626 | Condamineeae | | scientific name -170325 | CaHV-1 | | acronym -170325 | Canid alphaherpesvirus 1 | | scientific name -170325 | Canid alphaherpesvirus type 1 | | equivalent name -170325 | Canid herpesvirus 1 | | equivalent name -170325 | Canine herpesvirus | | equivalent name -170325 | Canine herpesvirus 1 | | equivalent name -170325 | canine herpesvirus CHV | | equivalent name -171627 | Fusarium fujikuroi species complex | | scientific name -171627 | Gibberella fujikuroi complex | | synonym -171638 | Rosoideae | | scientific name -171788 | Fulcaldea | | scientific name -171788 | Fulcaldea Poir. | | authority -171944 | Mangifera sylvatica | | scientific name -171944 | Mangifera sylvatica Roxb., 1824 | | authority -171944 | Nepal mango | | common name -172915 | Saurogobio | | scientific name -172976 | Ceramium longissimum | | synonym -172976 | Fucus longissimus | | synonym -172976 | Fucus longissimus S.G.Gmelin, 1768 | | authority -172976 | Gracilaria verrucosa | | synonym -172976 | Gracilaria verrucosa (Hudson) Papenfuss 1950 | | authority -172976 | Gracilariopsis longissima | | scientific name -172976 | Gracilariopsis longissima (S.G.Gmelin) M.Steentoft, L.M.Irvine & W.F.Farnham 1995 | | authority -173087 | Human papillomavirus types | | scientific name -175121 | Passeroidea | | scientific name -175529 | Amazona guildingii | | scientific name -175529 | Psittacus guildingii | | synonym -175529 | Psittacus guildingii Vigors, 1837 | | authority -176938 | Alcedo aenea | | synonym -176938 | Alcedo aenea Pallas, 1764 | | authority -176938 | American pygmy kingfisher | | genbank common name -176938 | Chloroceryle aenea | | scientific name -178830 | Bornaviridae | | scientific name -178941 | Arytainilla | | scientific name -178941 | Arytainilla Loginova, 1972 | | authority -178948 | Arytaina spartii | | synonym -178948 | Arytaina spartii Guerin-Meneville, 1842 | | authority -178948 | Arytainilla spartiophila | | scientific name -178948 | Arytainilla spartiophila (Foerster, 1848) | | authority -178948 | broom psyllid | | genbank common name -180252 | Mardivirus | | scientific name -180252 | Marek's disease-like viruses | | equivalent name -180950 | Tricholomella | | scientific name -180950 | Tricholomella Zerova ex Kalamees, 1992 | | authority -181089 | Aethopyga | | scientific name -181124 | Agaricus oreades | | synonym -181124 | Agaricus oreades Bolton, 1791 | | authority -181124 | Marasmius oreades | | scientific name -181124 | Marasmius oreades (Bolton) Fr., 1836 | | authority -181124 | Scotch bonnet mushroom | | common name -181124 | fairy-ring Marasmius | | genbank common name -181762 | Psilocybe cubensis | | scientific name -181762 | Psilocybe cubensis (Earle) Singer, 1948 | | authority -181762 | Stropharia cubensis | | synonym -181762 | Stropharia cubensis Earle, 1906 | | authority -181762 | magic mushroom | | common name -182093 | unclassified Vesivirus | | scientific name -182724 | Laternulidae | | scientific name -182725 | Laternula | | scientific name -183385 | Hydroporini | | scientific name -183963 | "Halomebacteria" Cavalier-Smith 1986 | "Halomebacteria" Cavalier-Smith 1986 | authority -183963 | Halobacteria | | scientific name -183963 | Halobacteria Grant et al. 2002 | | synonym -183963 | Halobacteria Grant et al. 2002 emend. Gupta et al. 2015 | | authority -183963 | Halomebacteria | Halomebacteria | in-part -183963 | Halomebacteria Cavalier-Smith, 2002 | Halomebacteria Cavalier-Smith, 2002 | authority -184751 | Vitivirus | | scientific name -185002 | Plantago ovata | | scientific name -185002 | Plantago ovata Forssk., 1775 | | authority -185002 | blond plantain | | genbank common name -185002 | blond psyllium | | common name -185002 | desert Indianwheat | | common name -185002 | desert plantain | | common name -185002 | ispaghul | | common name -185751 | Pospiviroidae | | scientific name -185751 | Viroids | Viroids | in-part -185752 | Avsunviroidae | | scientific name -185752 | Viroids | Viroids | in-part -185753 | Pospiviroid | | scientific name -185756 | Apscaviroid | | scientific name -185759 | Pelamoviroid | | scientific name -185786 | tentative aquareoviruses | | equivalent name -185786 | tentative species in the genus Aquareoviruses | | equivalent name -185786 | unclassified Aquareovirus | | scientific name -186121 | Micromus | | scientific name -186458 | Bornavirus | | equivalent name -186458 | Orthobornavirus | | scientific name -186534 | Caulimoviridae | | scientific name -186623 | Actinopteri | | scientific name -186625 | Clupeocephala | | scientific name -186626 | Otophysa | | synonym -186626 | Otophysi | | scientific name -186627 | Cypriniphysae | | scientific name -186627 | Cypriniphysi | | synonym -186634 | Ostarioclupeomorpha | | synonym -186634 | Otocephala | | synonym -186634 | Otomorpha | | scientific name -186766 | Narnaviridae | | scientific name -186767 | Narnavirus | | scientific name -186886 | Pomovirus | | scientific name -186938 | Respirovirus | | scientific name -187214 | Soybean chlorotic mottle-like viruses | | equivalent name -187214 | Soymovirus | | scientific name -190729 | Begomovirus-associated DNA beta-like sequences | | equivalent name -190729 | Betasatellite | | scientific name -190729 | Betasatellites | | equivalent name -190729 | beta satellites | | equivalent name -190729 | satellite DNA beta | | equivalent name -192204 | Corvoidea | | scientific name -192380 | Monochamini | | scientific name -192381 | Monochamus | | scientific name -192382 | Japanese pine sawyer | | genbank common name -192382 | Japanese pine sawyer beetle | | common name -192382 | Monochamus alternatus | | scientific name -192382 | Monochamus alternatus Hope, 1842 | | authority -193267 | Mnais tenuis | | scientific name -193267 | Mnais tenuis Oguma, 1913 | | authority -194960 | Kobuvirus | | scientific name -195059 | Datura yellow vein nucleorhabdovirus | | scientific name -195059 | Datura yellow vein virus | | equivalent name -195633 | Pleuronichthys | | scientific name -195798 | Cladonia rangiferina subsp. rangiferina | | scientific name -197056 | Cladonia rangiferina subsp. abbayesii | | scientific name -197056 | Cladonia rangiferina subsp. abbayesii (Ahti) Ahti & DePriest, 2001 | | authority -197112 | Pear latent virus | | scientific name -197112 | Pear redleaf-associated virus | | synonym -197562 | Pancrustacea | | scientific name -197563 | Mandibulata | | scientific name -197563 | mandibulates | | common name -197613 | Rosa chinensis f. spontanea | | synonym -197613 | Rosa chinensis f. spontanea Rehder & E.H.Wilson, 1815 | | authority -197613 | Rosa chinensis var. spontanea | | scientific name -197613 | Rosa chinensis var. spontanea (Rehder & E.H.Wilson) T.T.Yu & T.C.Ku, 1985 | | authority -197613 | Rosa odorata var. spontanea | | synonym -198607 | Double stranded RNA satellites | | scientific name -198607 | Double-stranded RNA satellites | | equivalent name -198607 | Double-stranded satellite RNAs | | equivalent name -198625 | Eccrinales | | includes -198625 | Ichthyophonida | | scientific name -201863 | Phocine distemper virus 1 | | scientific name -203261 | Epinephelus bleekeri | | scientific name -203261 | Epinephelus bleekeri (Vaillant, 1878) | | authority -203261 | Serranus bleekeri | | synonym -203261 | Serranus bleekeri Vaillant, 1878 | | authority -203261 | duskytail grouper | | genbank common name -205083 | Dreissena rostriformis | | scientific name -205083 | Mytilus rostriformis | | synonym -205083 | Mytilus rostriformis Deshayes, 1838 | | authority -211557 | Apachyidae | | scientific name -211558 | Apachyus | | scientific name -211567 | Apachyoidea | | scientific name -214437 | Spizaetus | | scientific name -215788 | Limenitidini | | scientific name -216794 | Plantagineae | | scientific name -216795 | Veroniceae | | scientific name -216806 | Buddlejeae | | scientific name -216806 | Buddlejeae Bartl., 1830 | | authority -216812 | Scrophularieae | | scientific name -217160 | Ampelovirus | | scientific name -219103 | Carduoideae | | scientific name -219103 | Carduoideae Cass. ex Sweet, 1826 | | authority -220121 | Macrophthaimus diiatatus | | synonym -220121 | Macrophthalmus (Macrophthalmus) abbreviatus | | synonym -220121 | Macrophthalmus abbreviatus | | scientific name -220121 | Macrophthalmus abbreviatus Manning & Holthuis, 1981 | | authority -220121 | Macrophthalmus dilatatus | | synonym -220121 | Ocypode (Macrophthalmus) dilatata | | synonym -220121 | Ocypode dilatata | | synonym -220121 | Ocypode dilatata De Haan, 1835 | | authority -222078 | Ageratum yellow vein China virus - [Hn2] | | scientific name -222078 | Ageratum yellow vein China virus-[Hn2] | | equivalent name -222543 | Hypocreomycetidae | | scientific name -222543 | mitosporic Hypocreomycetidae | | includes -222544 | Sordariomycetidae | | scientific name -222556 | unclassified Nodaviridae | | scientific name -223251 | Soybean crinkle leaf virus-[Japan] | | scientific name -223286 | Melon chlorotic leaf curl virus-[Guatemala] | | scientific name -223769 | Grapevine Anatolian ringspot virus | | scientific name -224510 | Iberoporus | | scientific name -225962 | Sweet potato virus Y | | scientific name -226102 | Aconitum contortum | | scientific name -226102 | Aconitum contortum Finet & Gagnep., 1904 | | authority -227307 | Gyrovirus | | scientific name -228457 | Anatina elliptica | | synonym -228457 | Anatina elliptica King, 1832 | | authority -228457 | Laternula elliptica | | scientific name -228657 | Echinosophora | | scientific name -228657 | Echinosophora Nakai, 1923 | | authority -228658 | Echinosophora koreensis | | scientific name -228658 | Echinosophora koreensis Nakai, 1923 | | authority -228658 | Sophora koreensis | | synonym -229219 | Blastomyces | | scientific name -229219 | Blastomyces Gilchrist & W.R. Stokes, 1898 | | authority -229219 | Emmonsia | | synonym -229219 | Emmonsia Cif. & Montemart., 1959 | | authority -231932 | Peniophora carnosa | | synonym -231932 | Peniophora carnosa Burt, 1926 | | authority -231932 | Phanerochaete carnosa | | scientific name -231932 | Phanerochaete carnosa (Burt) Parmasto, 1967 | | authority -232347 | Magnoliidae | | scientific name -232347 | Magnoliidae Novak ex Takht., 1967 | | authority -232347 | magnoliids | | equivalent name -232795 | Dicistroviridae | | scientific name -232799 | Iflavirus | | scientific name -232799 | Infectious flachery-like viruses | | equivalent name -233784 | Grapevine deformation virus | | scientific name -234792 | Chinese lizard gudgeon | | genbank common name -234792 | Saurogobio dabryi | | scientific name -234792 | Saurogobio dabryi Bleeker, 1871 | | authority -240201 | Burhinus bistriatus | | scientific name -240201 | Charadrius bistriatus | | synonym -240201 | Charadrius bistriatus Wagler, 1829 | | authority -240201 | Hesperoburhinus bistriatus | | synonym -240201 | Hesperoburhinus bistriatus (Wagler, 1829) | | authority -241749 | Arremon | | scientific name -241750 | Arremon aurantiirostris | | scientific name -241750 | Arremon aurantiirostris Lafresnaye, 1847 | | authority -241750 | orange-billed sparrow | | genbank common name -241751 | Arremon aurantiirostris rufidorsalis | | scientific name -241751 | Arremon rufidorsalis | | synonym -241751 | Arremon rufidorsalis Cassin, 1865 | | authority -241778 | Apioideae | | scientific name -241778 | Apioideae Seem., 1866 | | authority -241780 | apioid superclade | | scientific name -241785 | Bupleureae | | scientific name -241785 | Bupleureae Spreng., 1820 | | authority -241792 | Angelica + Arracacia clade | | equivalent name -241792 | Selineae | | scientific name -241792 | Selineae Spreng., 1820 | | authority -241932 | Trophis | | scientific name -241932 | Trophis P. Browne | | authority -246410 | Coccidioides immitis RS | | scientific name -249184 | Tymoviridae | | scientific name -249185 | Maculavirus | | scientific name -249310 | Chrysoviridae | | scientific name -249588 | Mamastrovirus | | scientific name -251095 | Nanoviridae | | scientific name -252798 | Falco tyrannus | | synonym -252798 | Falco tyrannus Wied-Neuwied, 1820 | | authority -252798 | Spizaetus tyrannus | | scientific name -252798 | black hawk-eagle | | genbank common name -255330 | Ipomoea vein mosaic virus | | scientific name -257883 | Myotis evotis | | scientific name -257883 | Vespertilio evotis | | synonym -257883 | Vespertilio evotis Allen, 1864 | | authority -257883 | long-eared Myotis | | genbank common name -260377 | Tomato yellow leaf curl Mali virus | | scientific name -263002 | Ageratum yellow vein virus-[Tomato] | | scientific name -265123 | Quarantine #1146 potyvirus | | scientific name -265963 | Viroids | Viroids | in-part -265963 | unclassified viroids | | scientific name -268499 | Crambidae | | scientific name -268499 | Crambiidae | | synonym -268499 | grass moths | | genbank common name -270256 | Eggplant mottled crinkle virus | | scientific name -272620 | Klebsiella pneumoniae MCG 78578 | | equivalent name -272620 | Klebsiella pneumoniae str. MCG 78578 | | equivalent name -272620 | Klebsiella pneumoniae subsp. pneumoniae ATCC 700721 | | synonym -272620 | Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | | scientific name -272620 | Klebsiella pneumoniae subsp. pneumoniae str. MGH 78578 | | equivalent name -272620 | Klebsiella pneumoniae subsp. pneumoniae strain MGH 78578 | | equivalent name -274794 | Epinephelinae | | scientific name -278169 | Cobitinae | | scientific name -278171 | Nemacheilidae | | scientific name -278171 | Nemacheilinae | | synonym -278205 | Myida | | scientific name -278205 | Myoida | | synonym -283494 | Begomovirus-associated DNA 1-like sequences | | equivalent name -283494 | Begomovirus-associated alphasatellites | | equivalent name -283494 | Geminialphasatellitinae | | scientific name -287184 | Chalcosiinae | | scientific name -287195 | Salvelinus leucomaenis japonicus | | scientific name -290090 | Sida yellow mosaic China virus - [Hainan 8] | | scientific name -290090 | Sida yellow mosaic virus-[China] | | equivalent name -290849 | Human astrovirus GGH-2004 | | scientific name -291027 | unclassified Begomovirus | | scientific name -291027 | unclassified begomoviruses | | equivalent name -291286 | Euphorbia ringspot virus | | scientific name -292474 | Ageratum yellow vein virus-[Tomato2] | | scientific name -292479 | Ageratum yellow vein virus-[Indonesia] | | scientific name -293500 | Zantedeschieae | | scientific name -294824 | Lepturini | | scientific name -299071 | Ajellomycetaceae | | scientific name -299071 | Ajellomycetaceae Unter., J.A. Scott & Sigler, 2004 | | authority -299368 | Evergestinae | | scientific name -301920 | Popenaias | | scientific name -301921 | Popenaias popeii | | scientific name -301921 | Texas hornshell mussel | | common name -301921 | Unio popeii | | synonym -301921 | Unio popeii Lea, 1857 | | authority -306901 | Chaetomium globosum CBS 148.51 | | scientific name -307635 | Spizaetus tyrannus serus | | scientific name -307635 | Spizaetus tyrannus serus Friedmann, 1950 | | authority -310684 | Cheravirus | | scientific name -311227 | Mycoreovirus | | scientific name -311900 | Conurus rupicola | | synonym -311900 | Conurus rupicola Tschudi, 1844 | | authority -311900 | Pyrrhura rupicola | | scientific name -311900 | Pyrrhura rupicola (Tschudi, 1844) | | authority -311900 | black-capped parakeet | | genbank common name -314145 | Laurasiatheria | | scientific name -314146 | Euarchontoglires | | scientific name -314147 | Glires | | scientific name -314147 | Rodents and rabbits | | genbank common name -315357 | Ageratum yellow vein virus-[Tomato3] | | scientific name -315838 | Aulacidae | | scientific name -315840 | Pristaulacus | | scientific name -318529 | Heroini | | scientific name -318546 | Pseudocrenilabrinae | | scientific name -318559 | Cichlasomatinae | | scientific name -319056 | New World cichlids | | scientific name -319058 | Haplochromini | | scientific name -319095 | African cichlids | | scientific name -320454 | Symphysodon aequifasciata aequifasciata | | scientific name -320454 | Symphysodon aequifasciata aequifasciata Pellegrin, 1904 | | authority -320454 | Symphysodon aequifasciatus aequifasciatus | | synonym -320455 | Symphysodon aequifasciata axelrodi | | scientific name -320455 | Symphysodon aequifasciata axelrodi Schultz, 1960 | | authority -320455 | Symphysodon aequifasciatus axelrodi | | synonym -321084 | Circaetus gallicus pectoralis | | synonym -321084 | Circaetus pectoralis | | scientific name -321084 | Circaetus pectoralis Smith, 1829 | | authority -321084 | Circaetus pectoralis Smith,A, 1829 | | authority -321084 | black-chested snake-eagle | | genbank common name -321263 | Myotis auriculus | | scientific name -321263 | Myotis auriculus Baker & Stains, 1955 | | authority -321263 | Myotis evotis auriculus | | synonym -321263 | Myotis evotis auriculus Baker & Stains, 1955 | | authority -321263 | Southwestern Myotis | | genbank common name -323096 | Bambusa ventricosa | | scientific name -323096 | Bambusa ventricosa McClure, 1938 | | authority -323096 | Buddha bamboo | | common name -323096 | Buddha belly bamboo | | genbank common name -323096 | tu tu chu | | common name -323895 | Chusquea culeou | | scientific name -323895 | Chusquea culeou E.Desv., 1854 | | authority -324901 | Marnaviridae | | scientific name -325454 | Deltapapillomavirus | | scientific name -325455 | Gammapapillomavirus | | scientific name -325456 | Iotapapillomavirus | | scientific name -325459 | Epsilonpapillomavirus | | scientific name -325461 | Omikronpapillomavirus | | scientific name -327045 | Orthoretrovirinae | | scientific name -327107 | unclassified Maculavirus | | scientific name -327375 | unclassified Carlavirus | | scientific name -327387 | Tropical soda apple mosaic virus | | scientific name -327770 | Epinephelus tukula | | scientific name -327770 | Epinephelus tukula Morgans, 1959 | | authority -327770 | potato grouper | | genbank common name -328429 | unclassified Polerovirus | | scientific name -328527 | Gnathopogon | | scientific name -329860 | Coliphage ID2 | | equivalent name -329860 | Enterobacteria phage ID2 | | scientific name -330383 | unassigned Tymoviridae | | equivalent name -330383 | unclassified Tymoviridae | | scientific name -333774 | unclassified Papillomaviridae | | scientific name -333921 | Xipapillomavirus | | scientific name -333938 | non-primate mammal papillomaviruses | | scientific name -334425 | Lisianthus necrosis virus | | scientific name -334873 | Chinese silver pomfret | | genbank common name -334873 | Pampus chinensis | | scientific name -334873 | Pampus chinensis (Euphrasen, 1788) | | authority -334873 | Stromateus chinensis | | synonym -334873 | Stromateus chinensis Euphrasen, 1788 | | authority -336476 | unclassified Iflavirus | | scientific name -336633 | unclassified Cripavirus | | scientific name -336635 | unassigned Dicistroviridae | | equivalent name -336635 | unclassified Dicistroviridae | | scientific name -336987 | Tobacco leaf curl Cuba virus | | scientific name -337052 | Deltapapillomavirus 4 | | scientific name -337687 | Muroidea | | scientific name -338153 | Pantherinae | | scientific name -339076 | Chiloschista parishii | | scientific name -339076 | Chiloschista parishii Seidenf., 1988 | | authority -341117 | Misgurnus bipartitus | | scientific name -341117 | Misgurnus bipartitus (Sauvage & Dabry de Thiersant, 1874) | | authority -341117 | Nemacheilus bipartitus | | synonym -341117 | Nemacheilus bipartitus Sauvage & Dabry de Thiersant, 1874 | | authority -341128 | Barbatula barbatula nuda | | synonym -341128 | Barbatula nuda | | scientific name -341128 | Barbatula nuda (Bleeker, 1864) | | authority -341128 | Nemacheilus nudus | | synonym -341128 | Nemacheilus nudus Bleeker, 1864 | | authority -341128 | Orthrias nudus | | synonym -344417 | unclassified Aquabirnavirus | | scientific name -345249 | unclassified Circovirus | | scientific name -346391 | Ageratum yellow vein virus-Pakistan | | scientific name -347957 | unclassified Betaretrovirus | | scientific name -351425 | unclassified Foveavirus | | scientific name -351426 | Asian prunus virus 2 | | scientific name -351428 | Asian prunus virus 3 | | scientific name -352235 | unclassified Thogotovirus | | scientific name -352926 | unclassified Astroviridae | | scientific name -352927 | unclassified Crinivirus | | scientific name -353154 | Theileria annulata Ankara clone C9 | | synonym -353154 | Theileria annulata strain Ankara | | scientific name -353769 | unclassified Gammaretrovirus | | scientific name -354837 | Celaenorrhinus | | scientific name -354837 | Celaenorrhinus Hubner, 1819 | | authority -355688 | Agaricomycetes incertae sedis | | scientific name -355688 | Homobasidiomycetes incertae sedis | | includes -357852 | Angelica likiangensis | | scientific name -357852 | Angelica likiangensis H.Wolff, 1930 | | authority -358814 | Daurian redstart | | genbank common name -358814 | Motacilla aurorea | | synonym -358814 | Motacilla aurorea Pallas, 1776 | | authority -358814 | Phoenicurus auroreus | | scientific name -358814 | Phoenicurus auroreus (Pallas, 1776) | | authority -359160 | BEP clade | | equivalent name -359160 | BOP clade | | scientific name -359505 | Bupleurum angustissimum | | scientific name -359505 | Bupleurum angustissimum (Franch.) Kitag., 1947 | | authority -359505 | Bupleurum falcatum var. angustissimum | | synonym -359505 | Bupleurum falcatum var. angustissimum Franch., 1884 | | authority -361688 | Single stranded DNA satellites | | scientific name -361688 | ssDNA satellites | | equivalent name -361688 | unclassified Single stranded DNA satellites | | equivalent name -361688 | unclassified ssDNA satellites | | equivalent name -364270 | Apiineae | | scientific name -364270 | Apiineae Plunkett & Lowry, 2004 | | authority -367188 | Haladaptatus | | scientific name -367188 | Haladaptatus Savage et al. 2007 | | authority -367188 | Haladaptatus Savage et al. 2007 emend. Cui et al. 2010 | | authority -367188 | Haladaptatus Savage et al. 2007 emend. Roh et al. 2010 | | authority -367682 | Narcissus symptomless virus | | scientific name -368620 | Cherry small circular viroid-like RNA 1 | | scientific name -368620 | cscRNA1 | | equivalent name -369752 | Catharanthus mosaic virus | | scientific name -371833 | unclassified Sapovirus | | scientific name -371917 | Corvus columbianus | | synonym -371917 | Corvus columbianus Wilson, 1811 | | authority -371917 | Nucifraga columbiana | | scientific name -375141 | Camallanidae | | scientific name -375142 | Camallanus | | scientific name -375143 | Camallanus cotti | | scientific name -375143 | Camallanus cotti Fujita, 1927 | | authority -376274 | Homotomidae | | synonym -376274 | Homotominae | | scientific name -376275 | Carsidaridae | | scientific name -377833 | Cubitermes group | | scientific name -377833 | Cubitermitinae | | synonym -379583 | Feliformia | | scientific name -379584 | Caniformia | | scientific name -384633 | Atacama myotis | | genbank common name -384633 | Myotis atacamensis | | scientific name -384633 | Vespertilio atacamensis | | synonym -384633 | Vespertilio atacamensis Lataste, 1892 | | authority -388435 | Lecanoromycetidae | | scientific name -391337 | Tomato yellow leaf curl Mali virus-[Ethiopia] | | scientific name -396331 | Bjerkanderaceae | | synonym -396331 | Hapalopilaceae | | synonym -396331 | Phanerochaetaceae | | scientific name -396331 | Phanerochaetaceae Julich, 1982 | | authority -397273 | Suaeda malacosperma | | scientific name -397273 | Suaeda malacosperma H.Hara, 1942 | | authority -398816 | Tobacco leaf curl Cuba virus - [Jamaica] | | scientific name -399178 | Panthera onca mesembrina | | scientific name -399178 | Patagonian panther | | genbank common name -399254 | Aacanthocnema | | scientific name -399254 | Aacanthocnema Tuthill & Taylor, 1955 | | authority -399255 | Aacanthocnema dobsoni | | scientific name -399255 | Trioza dobsoni | | synonym -399255 | Trioza dobsoni Froggatt, 1903 | | authority -404260 | Bryophytina | | scientific name -404260 | Moss Superclass V | | includes -404297 | Bryanae | | scientific name -404297 | Bryanae (Engl.) Goffinet & W.R.Buck | | authority -405558 | Arracacha mottle virus | | scientific name -410297 | Gerbilliscus | | scientific name -410302 | Bushveld gerbil | | genbank common name -410302 | Gerbilliscus leucogaster | | scientific name -410302 | Tatera leucogaster | | synonym -410302 | bushveld gerbil | | common name -410830 | Trichomonascaceae | | scientific name -410830 | Trichomonascaceae Kurtzman & Robnett, 2007 | | authority -413970 | Anulavirus | | scientific name -416867 | Notospermus | | scientific name -416868 | Lineus geniculatus | | synonym -416868 | Notospermus geniculatus | | scientific name -416868 | Notospermus geniculatus (Delle Chiaje, 1822) | | authority -416868 | Polia geniculata | | synonym -416868 | Polia geniculata Delle Chiaje, 1822 | | authority -418101 | Plasmodium (Vinckeia) | | scientific name -418101 | Vinckeia | | synonym -418103 | Plasmodium | Plasmodium | synonym -418103 | Plasmodium (Plasmodium) | | scientific name -420948 | Aetobatus flagellum | | scientific name -420948 | Aetobatus flagellum (Bloch & Schneider, 1801) | | authority -420948 | Raja flagellum | | synonym -420948 | Raja flagellum Bloch & Schneider, 1801 | | authority -420948 | longheaded eagle ray | | genbank common name -421010 | HiMV | | acronym -421010 | Hippeastrum mosaic virus | | scientific name -421921 | Philodendroideae | | scientific name -421921 | Philodendroideae Engl., 1876 | | authority -422676 | Aconoidasida | | scientific name -422676 | Aconoidasida Mehlhorn et al. 1980 | | authority -422676 | Hematozoa Vivier 1982 | | synonym -423054 | Eimeriorina | | scientific name -423369 | NHMW:91214 | NHMW:91214 | type material -423369 | NMW:91214 | NMW:91214 | type material -423369 | NMW:91214 | NMW:91214 | type material -423369 | Salmo leucomaenis leucomaenis | | synonym -423369 | Salmo leucomaenis leucomaenis Pallas, 1814 | | authority -423369 | Salvelinus leucomaenis leucomaenis | | scientific name -423369 | ZMB:23552 | ZMB:23552 | type material -423369 | ZMB:23563 | ZMB:23563 | type material -423370 | Salvelinus leucomaenis imbrius | | scientific name -423370 | Salvelinus leucomaenis imbrius Jordan & McGregor, 1925 | | authority -425264 | Malassezia restricta CBS 7877 | | scientific name -427924 | Dreissena bugensis | | synonym -427924 | Dreissena bugensis var. profunda | | synonym -427924 | Dreissena rostriformis bugensis | | scientific name -427924 | Dreissena rostriformis bugensis Andrusov, 1897 | | authority -427924 | Dreissena rostriformis bugensis var. profunda | | synonym -427924 | guagga mussel | | common name -427924 | quagga mussel | | genbank common name -431037 | unclassified Roseolovirus | | scientific name -433372 | Spizaetus tyrannus tyrannus | | scientific name -435738 | Camallanoidea | | scientific name -436486 | Dinosauria | | scientific name -436486 | dinosaurs | | common name -436489 | Saurischia | | scientific name -436491 | Theropoda | | scientific name -436492 | Coelurosauria | | scientific name -437064 | Ageratum yellow vein virus- [Taiwan:Taoyuan3:2000] | | equivalent name -437064 | Ageratum yellow vein virus-[Taiwan:Taoyuan3:2000] | | scientific name -437489 | Striacosta | | scientific name -437490 | Richia albicosta | | synonym -437490 | Striacosta albicosta | | scientific name -437490 | Striacosta albicosta (Smith, 1888) | | authority -437490 | western bean cutworm | western bean cutworm | genbank common name -439490 | unassigned ssRNA viruses | | equivalent name -439490 | unclassified ssRNA viruses | | scientific name -441227 | Isophya | | scientific name -441892 | Alaria crispa | | scientific name -441892 | Alaria crispa Kjellman, 1889 | | authority -442243 | Lelecella | | scientific name -442302 | Porcine picobirnavirus | | scientific name -442316 | Herona | | scientific name -445316 | Pseudohelice | | scientific name -446318 | Ageratum yellow vein virus-Ishigaki | | scientific name -447093 | Ajellomyces capsulatus G186AR | | synonym -447093 | Histoplasma capsulatum G186AR | | scientific name -450882 | Taxus fuana | | scientific name -450882 | Taxus fuana Nan Li & R.R.Mill, 1997 | | authority -451864 | Dikarya | | scientific name -451871 | Eurotiomycetidae | | scientific name -452284 | Ustilaginomycotina | | scientific name -452284 | Ustilaginomycotina Doweld, 2001 | | authority -452284 | smut fungi & allies | smut fungi & allies | blast name -452284 | smut fungi & allies | smut fungi & allies | common name -452333 | Agaricomycetidae | | scientific name -453050 | Sweet potato virus 2 | | scientific name -456398 | Chasmagnathus subquadratus | | synonym -456398 | Chasmagnathus subquadratus Dana, 1851 | | authority -456398 | Pseudohelice subquadrata | | scientific name -456398 | Pseudohelice subquadrata (Dana, 1851) | | authority -461132 | Lelecella limenitoides | | scientific name -461132 | Lelecella limenitoides (Oberthur, 1890) | | authority -461132 | Vanessa limenitoides | | synonym -461132 | Vanessa limenitoides Oberthur, 1890 | | authority -464095 | Picornavirales | | scientific name -464925 | environmental samples | environmental samples | scientific name -469369 | Ocinara | | scientific name -473626 | Barbitistini | | scientific name -473674 | Poecilimon birandi | | synonym -473674 | Poecilimon birandi Karabag, 1950 | | authority -473674 | Poecilimon luschani birandi | | scientific name -473674 | Poecilimon luschani birandi Karabag, 1950 | | authority -473713 | Poecilimon luschani | | scientific name -473713 | Poecilimon luschani Ramme, 1933 | | authority -473783 | unclassified Umbravirus | | scientific name -473784 | Opium poppies mosaic virus | | equivalent name -473784 | Opium poppy mosaic umbravirus | | equivalent name -473784 | Opium poppy mosaic virus | | scientific name -474943 | Cordycipitaceae | | scientific name -474943 | Cordycipitaceae Kreisel ex G.H. Sung, J.M. Sung, Hywel-Jones & Spatafora, 2007 | | authority -474943 | mitosporic Cordycipitaceae | | includes -475272 | Ernolatia | | scientific name -475273 | Ernolatia moorei | | scientific name -475273 | Ernolatia moorei (Hutton, 1865) | | authority -475273 | Ocinara moorei | | synonym -475273 | Ocinara moorei Hutton, 1865 | | authority -475327 | Bombycinae | | scientific name -475347 | Prismosticta | | scientific name -475348 | Prismosticta fenestrata | | scientific name -475348 | Prismosticta fenestrata Butler, 1880 | | authority -478825 | unclassified Picornaviridae | | scientific name -481315 | Leporid alphaherpesvirus 4 | | scientific name -481315 | Leporid herpesvirus 4 | | equivalent name -484021 | Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 | | scientific name -484021 | Klebsiella pneumoniae subsp. pneumoniae str. NTUH-K2044 | | equivalent name -484021 | Klebsiella pneumoniae subsp. pneumoniae strain NTUH-K2044 | | equivalent name -485724 | Melon severe mosaic tospovirus | | equivalent name -485724 | melon severe mosaic virus | | scientific name -490134 | Hepatitis B virus Woolly monkey/Louisville | | scientific name -490134 | Woolly monkey hepatitis B virus (isolate Louisville) | | equivalent name -493796 | Human astrovirus Hu/CMH053/01/2001/THA | | scientific name -493797 | Human astrovirus Hu/CMH074/01/2001/THA | | scientific name -493798 | Human astrovirus Hu/CMH259/01/2001/THA | | scientific name -493799 | Human astrovirus Hu/CMH265/00/2000/THA | | scientific name -493800 | Human astrovirus Hu/CMH350/02/2002/THA | | scientific name -493801 | Human astrovirus Hu/CMH352/02/2002/THA | | scientific name -493802 | Human astrovirus Hu/CMH362/01/2001/THA | | scientific name -494651 | Bovine hokovirus | | equivalent name -494651 | Bovine hokovirus 1 | | scientific name -497220 | Gobionellinae | | scientific name -497679 | Sicydiinae | | scientific name -498257 | Verticillium dahliae VdLs.17 | | scientific name -501251 | Ageratum yellow vein virus - [G129] | | scientific name -501252 | Ageratum yellow vein virus - [G130] | | scientific name -504568 | Salmoninae | | scientific name -504568 | trouts, salmons & chars | | genbank common name -516546 | Cirsium japonicum | | scientific name -516546 | Cirsium japonicum DC., 1838 | | authority -526119 | unclassified Mamastrovirus | | scientific name -535378 | Dytiscoidea | | scientific name -535382 | Caraboidea | | scientific name -535600 | unclassified Parvoviridae | | scientific name -538002 | Cordyceps militaris cf. var. sphaerocephala MRCIF64 | | scientific name -547124 | unclassified Mycoreovirus | | scientific name -547455 | Paspalum virgatum | | scientific name -547455 | Paspalum virgatum L., 1759 | | authority -548681 | Herpesvirales | | scientific name -548688 | Percavirus | | scientific name -552816 | Engaeus lengana | | scientific name -552816 | Engaeus lengana Horwitz, 1990 | | authority -554155 | Arthroderma otae CBS 113480 | | synonym -554155 | Microsporum canis CBS 113480 | | scientific name -554155 | Microsporum canis CBS113480 | | synonym -558016 | Alphabaculovirus | | scientific name -558016 | Nucleopolyhedrovirus | Nucleopolyhedrovirus | in-part -558017 | Betabaculovirus | | scientific name -558017 | GV | | acronym -558017 | Granulosis viruses | | equivalent name -558017 | Granulovirus | | equivalent name -558690 | Cucurbit chlorotic yellows virus | | scientific name -559297 | Ajellomyces dermatitidis ER-3 | | synonym -559297 | Blastomyces dermatitidis ER-3 | | scientific name -559298 | Ajellomyces dermatitidis SLH#14081 | | equivalent name -559298 | Ajellomyces dermatitidis SLH14081 | | equivalent name -559298 | Blastomyces dermatitidis SLH14081 | | equivalent name -559298 | Blastomyces gilchristii SLH14081 | | scientific name -559305 | Trichophyton rubrum CBS 118892 | | scientific name -560253 | Letharia lupina | | scientific name -560253 | Letharia lupina Altermann, Goward & Leavitt, 2016 | | authority -560253 | Letharia sp. Altermann EP3a | | includes -560253 | Letharia sp. SA-2008b | | includes -560253 | UC 2049992 | UC 2049992 | type material -564644 | Endornaviridae | | scientific name -569360 | Fusarium graminearum species complex | | includes -569360 | Fusarium sambucinum species complex | | scientific name -569578 | PX clade | | scientific name -569578 | algae | algae | in-part -570949 | Carrot mottle mimic virus satellite RNA | | scientific name -570950 | Carrot mottle virus satellite RNA | | scientific name -578617 | Porcine kobuvirus swine/2007/CHN | | scientific name -584378 | Aegosomatini | | scientific name -585893 | Picobirnaviridae | | scientific name -590647 | Nariva virus | | scientific name -590745 | Mus musculus mobilized endogenous polytropic provirus | | scientific name -626155 | Human astrovirus 1 Beijing/04/2006/CHN | | scientific name -626156 | Human astrovirus 1 Beijing/102/2005/CHN | | scientific name -626157 | Human astrovirus 1 Beijing/106/2005/CHN | | scientific name -626158 | Human astrovirus 1 Beijing/110/2007/CHN | | scientific name -626159 | Human astrovirus 1 Beijing/113/2005/CHN | | scientific name -626160 | Human astrovirus 1 Beijing/128/2005/CHN | | scientific name -626161 | Human astrovirus 1 Beijing/134/2005/CHN | | scientific name -626162 | Human astrovirus 1 Beijing/139/2005/CHN | | scientific name -626163 | Human astrovirus 1 Beijing/141/2005/CHN | | scientific name -626164 | Human astrovirus 1 Beijing/176/2006/CHN | | scientific name -626165 | Human astrovirus 1 Beijing/180/2005/CHN | | scientific name -626166 | Human astrovirus 1 Beijing/183/2006/CHN | | scientific name -626167 | Human astrovirus 1 Beijing/189/2005/CHN | | scientific name -626168 | Human astrovirus 1 Beijing/189/2007/CHN | | scientific name -626169 | Human astrovirus 1 Beijing/198/2005/CHN | | scientific name -626170 | Human astrovirus 1 Beijing/204/2005/CHN | | scientific name -626171 | Human astrovirus 1 Beijing/210/2006/CHN | | scientific name -626172 | Human astrovirus 1 Beijing/214/2005/CHN | | scientific name -626173 | Human astrovirus 1 Beijing/234/2005/CHN | | scientific name -626174 | Human astrovirus 1 Beijing/234/2006/CHN | | scientific name -626175 | Human astrovirus 1 Beijing/237/2005/CHN | | scientific name -626176 | Human astrovirus 1 Beijing/239/2005/CHN | | scientific name -626177 | Human astrovirus 1 Beijing/249/2005/CHN | | scientific name -626178 | Human astrovirus 1 Beijing/254/2007/CHN | | scientific name -626179 | Human astrovirus 1 Beijing/287/2005/CHN | | scientific name -626180 | Human astrovirus 1 Beijing/291/2007/CHN | | scientific name -626181 | Human astrovirus 1 Beijing/293/2007/CHN | | scientific name -626182 | Human astrovirus 1 Beijing/309/2007/CHN | | scientific name -626183 | Human astrovirus 1 Beijing/317/2007/CHN | | scientific name -626184 | Human astrovirus 1 Beijing/327/2007/CHN | | scientific name -626185 | Human astrovirus 1 Beijing/330/2007/CHN | | scientific name -626186 | Human astrovirus 1 Beijing/335/2007/CHN | | scientific name -626187 | Human astrovirus 1 Beijing/347/2007/CHN | | scientific name -626188 | Human astrovirus 1 Beijing/352/2007/CHN | | scientific name -626189 | Human astrovirus 1 Beijing/362/2007/CHN | | scientific name -626190 | Human astrovirus 1 Beijing/375/2007/CHN | | scientific name -626191 | Human astrovirus 1 Beijing/377/2007/CHN | | scientific name -626192 | Human astrovirus 1 Beijing/41/2005/CHN | | scientific name -626193 | Human astrovirus 1 Beijing/46/2005/CHN | | scientific name -626194 | Human astrovirus 1 Beijing/60/2007/CHN | | scientific name -626195 | Human astrovirus 1 Beijing/69/2007/CHN | | scientific name -626196 | Human astrovirus 1 Beijing/79/2006/CHN | | scientific name -626197 | Human astrovirus 1 Beijing/82/2007/CHN | | scientific name -626198 | Human astrovirus 6 Beijing/192/2007/CHN | | scientific name -632743 | Human astrovirus 1d | | scientific name -640623 | Aveninae | | scientific name -640623 | Aveninae J.Presl, 1830 | | authority -642248 | unclassified Circoviridae | | scientific name -642994 | Herona marathus | | scientific name -642994 | Herona marathus Doubleday, 1848 | | authority -644269 | Kumanoa | | scientific name -644269 | Kumanoa Entwisle, M.L.Vis, W.B.Chiasson, Necchi & A.R.Sherwood, 2009 | | authority -645133 | Colletotrichum graminicola M1.001 | | scientific name -645133 | Glomerella graminicola M1.001 | | equivalent name -649996 | Tomato yellow leaf distortion virus | | scientific name -650164 | Phanerochaete carnosa HHB-10118-sp | | scientific name -652723 | Porcine kobuvirus THA/2001-2003 | | scientific name -652811 | Human astrovirus 1 Beijing/01/2005/CHN | | scientific name -652812 | Human astrovirus 1 Beijing/06/2006/CHN | | scientific name -652813 | Human astrovirus 1 Beijing/129/2005/CHN | | scientific name -652814 | Human astrovirus 1 Beijing/131/2007/CHN | | scientific name -652815 | Human astrovirus 1 Beijing/228/2005/CHN | | scientific name -652816 | Human astrovirus 1 Beijing/265/2005/CHN | | scientific name -652817 | Human astrovirus 1 Beijing/33/2005/CHN | | scientific name -652818 | Human astrovirus 1 Beijing/333/2007/CHN | | scientific name -652819 | Human astrovirus 1 Beijing/75/2005/CHN | | scientific name -652820 | Human astrovirus 3 Beijing/124/2007/CHN | | scientific name -654128 | Marasmiaceae | | scientific name -654128 | Marasmiaceae Roze ex Kuhner, 1980 | | authority -654128 | mitosporic Marasmiaceae | | includes -667127 | Klebsiella pneumoniae subsp. rhinoscleromatis ATCC 13884 | | scientific name -667127 | Klebsiella pneumoniae subsp. rhinoscleromatis str. ATCC 13884 | | equivalent name -667127 | Klebsiella pneumoniae subsp. rhinoscleromatis strain ATCC 13884 | | equivalent name -667151 | Dicaeum concolor | | scientific name -667151 | Dicaeum concolor Jerdon, 1840 | | authority -667167 | Dicaeidae | | scientific name -667516 | Nakiwogo virus | | scientific name -667725 | Sphaeroforma arctica JP610 | | scientific name -674952 | Trichomonasvirus | | scientific name -674953 | Trichomonas vaginalis virus 1 | | scientific name -674981 | Victorivirus | | scientific name -674996 | Cotton leaf curl Shadadpur virus | | includes -674996 | Cotton leaf curl Shahdadpur virus | | scientific name -675063 | Tymovirales | | scientific name -675064 | Alphaflexiviridae | | scientific name -675064 | Flexiviridae | Flexiviridae | in-part -675068 | Betaflexiviridae | | scientific name -675068 | Flexiviridae | Flexiviridae | in-part -675071 | Virgaviridae | | scientific name -675072 | Comoviridae | | includes -675072 | Secoviridae | | scientific name -675072 | Sequiviridae | | includes -675073 | Torradovirus | | scientific name -675074 | unassigned Picornavirales | | equivalent name -675074 | unclassified Picornavirales | | scientific name -675075 | Comovirinae | | scientific name -675845 | Emaravirus | | scientific name -676044 | Malvastrum yellow vein Honghe virus | | scientific name -676058 | Acropora nobilis | | synonym -676058 | Acropora nobilis (Dana, 1846) | | authority -676058 | Acropora robusta | | scientific name -676058 | Acropora robusta (Dana, 1846) | | authority -676058 | Madrepora robusta | | synonym -676058 | Madrepora robusta Dana, 1846 | | authority -681501 | Olmedia caucana | | synonym -681501 | Olmedia caucana Pittier, 1912 | | authority -681501 | Trophis caucana | | scientific name -681501 | Trophis caucana (Pittier) C.C.Berg, 1988 | | authority -681950 | Glomerellaceae | | scientific name -681950 | Glomerellaceae Locq. ex Seifert & W. Gams, 2007 | | authority -681950 | mitosporic Glomerellaceae | | includes -685445 | Enterobacter aerogenes FGI35 | | synonym -685445 | Enterobacter aerogenes str. FGI35 | | equivalent name -685445 | Enterobacter aerogenes strain FGI35 | | equivalent name -685445 | Enterobacter sp. FGI 35 | | synonym -685445 | Klebsiella aerogenes FGI35 | | scientific name -685899 | Papaya lethal yellowing virus | | scientific name -686565 | Gokushovirinae | | scientific name -686982 | Sapelovirus | | scientific name -687091 | Evergestis | | scientific name -687329 | Anelloviridae | | scientific name -687329 | Anellovirus | | equivalent name -687332 | Betatorquevirus | | scientific name -687339 | Iotatorquevirus | | scientific name -687387 | TTSV1b | | acronym -687387 | Torque teno sus virus 1b | | scientific name -687387 | Torque teno sus virus 2 | | equivalent name -693996 | Alphacoronavirus | | scientific name -693996 | Coronavirus | Coronavirus | in-part -693996 | Coronavirus group 1 | | equivalent name -693996 | Coronavirus group 1b | | includes -693996 | Group 1 species | | equivalent name -693997 | Alphacoronavirus 1 | | scientific name -693997 | Alphacoronavirus-1 | | equivalent name -695850 | Saprolegnia parasitica CBS 223.65 | | scientific name -696855 | Nebovirus | | scientific name -699189 | Iflaviridae | | scientific name -702736 | Chelonid alphaherpesvirus 5 | | scientific name -702736 | Chelonid herpesvirus 5 | | equivalent name -703582 | Porcine kobuvirus swine/K-30-HUN/2008/HUN | | scientific name -706525 | Phocoena phocoena papillomavirus 1 | | scientific name -706526 | Phocoena phocoena papillomavirus 2 | | scientific name -706527 | Phocoena phocoena papillomavirus 4 | | scientific name -706622 | Scaritinae | | scientific name -706663 | Himerometridae | | scientific name -706663 | Zygometridae | | synonym -707741 | Zygometra | | scientific name -715989 | sordariomyceta | | scientific name -716545 | saccharomyceta | | scientific name -716546 | leotiomyceta | | scientific name -735337 | Euheterodonta | | scientific name -735504 | unclassified Gammapapillomavirus | | scientific name -742010 | Carduinae | | scientific name -742010 | Carduinae Dumort., 1827 | | authority -742845 | Malasseziaceae | | scientific name -742845 | Malasseziaceae Denchev & R.T. Moore, 2009 | | authority -742914 | Cyclovirus | | scientific name -742914 | suggested genus Cyclovirus | | equivalent name -748365 | Aspiorhynchus | | scientific name -748366 | Aspiorhynchus laticeps | | scientific name -748366 | Aspiorhynchus laticeps (Day, 1877) | | authority -748366 | Ptychobarbus laticeps | | synonym -748366 | Ptychobarbus laticeps Day, 1877 | | authority -748366 | big-head schizothoracin | | genbank common name -753343 | Histia | | scientific name -759124 | Bhendi yellow vein mosaic alphasatellite | | scientific name -759124 | Bhendi yellow vein mosaic virus alphasatellite | | equivalent name -759804 | Porcine kobuvirus Japan/2009 | | scientific name -763898 | Anastrangalia reyi sequensi | | synonym -763898 | Anastrangalia sequensi | | scientific name -763898 | Anastrangalia sequensi (Reitter, 1898) | | authority -763898 | Anoplodera sequensi | | synonym -763898 | Anoplodera sequensi Li, Chen & Lin, 1981 | | authority -766764 | Debaryomycetaceae | | scientific name -766764 | Debaryomycetaceae Kurtzman & M. Suzuki, 2010 | | authority -766764 | Debaryomycetaceae Kurtzman et M. Suzuki 2010 | | authority -796900 | Kobuvirus pig/Ch-kobu/2008/CHN | | scientific name -796901 | Kobuvirus pig/Ch1/2008/CHN | | scientific name -796902 | Kobuvirus pig/Ch13/2008/CHN | | scientific name -796903 | Kobuvirus pig/Ch14/2008/CHN | | scientific name -796904 | Kobuvirus pig/Ch16/2008/CHN | | scientific name -796905 | Kobuvirus pig/Ch39/2008/CHN | | scientific name -796906 | Kobuvirus pig/Ch4/2008/CHN | | scientific name -796907 | Kobuvirus pig/Ch40/2008/CHN | | scientific name -796908 | Kobuvirus pig/Ch41/2008/CHN | | scientific name -796909 | Kobuvirus pig/Ch5/2008/CHN | | scientific name -796910 | Kobuvirus pig/Ch6/2008/CHN | | scientific name -797075 | Nerine latent virus | | scientific name -861365 | Klebsiella pneumoniae subsp. rhinoscleromatis SB3432 | | scientific name -861365 | Klebsiella pneumoniae subsp. rhinoscleromatis str. SB3432 | | equivalent name -861365 | Klebsiella pneumoniae subsp. rhinoscleromatis strain SB3432 | | equivalent name -861561 | Cyrtanthus elatus virus A | | scientific name -861561 | Vallota speciosa virus - Narcissus/AUS/2008 | | equivalent name -871765 | Porcine TTV 2 | | equivalent name -871765 | Porcine torque teno virus 2 | | scientific name -885375 | Kobuvirus swine/MF8045/2009/KOR | | scientific name -885376 | Kobuvirus swine/MF8047/2009/KOR | | scientific name -886583 | Australasian lineages | | scientific name -906906 | Human astrovirus 1 Tianjin/114/2008/CHN | | scientific name -906907 | Human astrovirus 1 Tianjin/124/2008/CHN | | scientific name -906908 | Human astrovirus 1 Tianjin/133/2008/CHN | | scientific name -906909 | Human astrovirus 1 Tianjin/217/2008/CHN | | scientific name -906910 | Human astrovirus 1 Tianjin/242/2008/CHN | | scientific name -906911 | Human astrovirus 1 Tianjin/499/2008/CHN | | scientific name -906912 | Human astrovirus 1 Tianjin/508/2008/CHN | | scientific name -906913 | Human astrovirus 1 Tianjin/565/2008/CHN | | scientific name -908833 | unclassified Narnavirus | | scientific name -908834 | Grapevine associated narnavirus-1 | | scientific name -911341 | Heliantheae alliance | | scientific name -930979 | Lyophyllaceae | | scientific name -930979 | Lyophyllaceae Julich, 1982 | | authority -935296 | Enterobacter aerogenes EA1509E | | synonym -935296 | Enterobacter aerogenes str. EA1509E | | equivalent name -935296 | Enterobacter aerogenes strain EA1509E | | equivalent name -935296 | Klebsiella aerogenes EA1509E | | scientific name -935650 | Psipapillomavirus | | scientific name -936057 | Rhopapillomavirus | | scientific name -936058 | Upsilonpapillomavirus | | scientific name -938257 | Kobuvirus swine/South Korea/2010 | | scientific name -939922 | unclassified Victorivirus | | scientific name -940834 | Equine papillomavirus 3 | | equivalent name -940834 | Equus caballus papillomavirus 3 | | scientific name -941259 | Klebsiella pneumoniae U-0608239 | | scientific name -941259 | Klebsiella pneumoniae str. U-0608239 | | equivalent name -941259 | Klebsiella pneumoniae strain U-0608239 | | equivalent name -943329 | Angelica longicaudata | | scientific name -943329 | Angelica longicaudata C.Q.Yuan & R.H.Shan, 1985 | | authority -944994 | Hollyhock yellow vein mosaic virus | | scientific name -977912 | Orsay nodavirus | | equivalent name -977912 | Orsay virus | | scientific name -983644 | Cordyceps militaris CM01 | | scientific name -988644 | ssRNA negative-strand viruses | | equivalent name -988644 | unassigned ssRNA negative-strand viruses | | equivalent name -988644 | unclassified ssRNA negative-strand viruses | | scientific name -990925 | Klebsiella pneumoniae subsp. pneumoniae KPX | | scientific name -990925 | Klebsiella pneumoniae subsp. pneumoniae str. KPX | | equivalent name -990925 | Klebsiella pneumoniae subsp. pneumoniae strain KPX | | equivalent name -992212 | Phlebovirus HB29/China/2010 | | equivalent name -992212 | SFTS virus HB29 | | scientific name -992212 | SFTSV HB29 | | equivalent name -994805 | Andean white-eared opossum | | genbank common name -994805 | Didelphis pernigra | | scientific name -994805 | Didelphis pernigra (Allen, 1900) | | authority -994805 | Didelphis pernigra J. A. Allen, 1900 | | authority -997078 | Tomato leaf curl Comoros virus | | scientific name -1003875 | Sicyoeae | | scientific name -1003875 | Sicyoeae Schrad., 1838 | | authority -1005902 | Porcine kobuvirus THA/2006 | | scientific name -1005903 | Porcine kobuvirus THA/2007 | | scientific name -1005904 | Porcine kobuvirus THA/2008 | | scientific name -1006621 | Cymbidiinae | | scientific name -1006621 | Cymbidiinae Benth., 1881 | | authority -1028307 | Enterobacter aerogenes KCTC 2190 | | synonym -1028307 | Enterobacter aerogenes str. KCTC 2190 | | equivalent name -1028307 | Enterobacter aerogenes strain KCTC 2190 | | equivalent name -1028307 | Klebsiella aerogenes KCTC 2190 | | scientific name -1028384 | Glomerellales | | scientific name -1028384 | Glomerellales Chadef. ex Reblova, W. Gams & Seifert, 2011 | | authority -1032459 | Megalaima haemacephala cebuensis | | synonym -1032459 | Megalaima haemacephala cebuensis Dziadosz & Parkes, 1984 | | authority -1032459 | Psilopogon haemacephalus cebuensis | | scientific name -1032460 | Megalaema haemacephala celestinoi | | synonym -1032460 | Megalaema haemacephala celestinoi Gilliard, 1949 | | authority -1032460 | Megalaima haemacephala celestinoi | | synonym -1032460 | Megalaima haemacephala celestinoi Gilliard, 1949 | | authority -1032460 | Psilopogon haemacephalus celestinoi | | scientific name -1032461 | Megalaema haemacephala delica | | synonym -1032461 | Megalaema haemacephala delica Parrot, 1907 | | authority -1032461 | Megalaima haemacephala delica | | synonym -1032461 | Megalaima haemacephala delica Parrot, 1907 | | authority -1032461 | Psilopogon haemacephalus delicus | | scientific name -1032462 | Bucco haemacephalus haemacephalus | | synonym -1032462 | Bucco haemacephalus haemacephalus Muller, 1776 | | authority -1032462 | Megalaima haemacephala haemacephala | | synonym -1032462 | Megalaima haemacephala haemacephala (Statius Mller, 1776) | | authority -1032462 | Psilopogon haemacephalus haemacephalus | | scientific name -1032463 | Bucco indicus | | synonym -1032463 | Bucco indicus Latham, 1790 | | authority -1032463 | Megalaima haemacephala indica | | synonym -1032463 | Megalaima haemacephala indica (Latham, 1790) | | authority -1032463 | Psilopogon haemacephalus indicus | | scientific name -1032464 | Megalaima haemacephala intermedia | | synonym -1032464 | Megalaima haemacephala intermedia (Shelley, 1891) | | authority -1032464 | Psilopogon haemacephalus intermedius | | scientific name -1032464 | Xantholaema intermedia | | synonym -1032464 | Xantholaema intermedia Shelley, 1891 | | authority -1032465 | Megalaima haemacephala mindanensis | | synonym -1032465 | Megalaima haemacephala mindanensis Rand, 1948 | | authority -1032465 | Psilopogon haemacephalus mindanensis | | scientific name -1032466 | Bucco roseus | | synonym -1032466 | Bucco roseus Dumont, 1805 | | authority -1032466 | Megalaima haemacephala rosea | | synonym -1032466 | Megalaima haemacephala rosea (Dumont, 1816) | | authority -1032466 | Psilopogon haemacephalus roseus | | scientific name -1033976 | Bean necrotic mosaic virus | | scientific name -1033978 | Plectosphaerellaceae | | scientific name -1033978 | Plectosphaerellaceae W.Gams, Summerbell & Zare 2007 | | authority -1033978 | mitosporic Plectosphaerellaceae | | includes -1034061 | Bartramiales | | scientific name -1034061 | Bartramiales M.Menzel, 1992 | | authority -1035782 | Chinese rice frog | | common name -1035782 | Microhyla mixtura | | scientific name -1035782 | Microhyla mixtura Liu and Hu, 1966 | | authority -1036719 | Verticillium | | scientific name -1036719 | Verticillium Nees, 1816 | | authority -1037890 | Klebsiella pneumoniae JH1 | | scientific name -1037890 | Klebsiella pneumoniae str. JH1 | | equivalent name -1037890 | Klebsiella pneumoniae strain JH1 | | equivalent name -1037908 | Klebsiella pneumoniae 1162281 | | scientific name -1037908 | Klebsiella pneumoniae str. 1162281 | | equivalent name -1037908 | Klebsiella pneumoniae strain 1162281 | | equivalent name -1046402 | Potato virus H | | scientific name -1048227 | Porcine kobuvirus/BRA10/2009/Brazil | | scientific name -1048228 | Porcine kobuvirus/BRA24/2009/Brazil | | scientific name -1048229 | Porcine kobuvirus/BRA36/2009/Brazil | | scientific name -1048230 | Porcine kobuvirus/BRA74/2009/Brazil | | scientific name -1048231 | Porcine kobuvirus/BRA788-3/2009/Brazil | | scientific name -1048232 | Porcine kobuvirus/NLD45/2008/Netherlands | | scientific name -1048233 | Porcine kobuvirus/NLD47/2008/Netherlands | | scientific name -1048436 | Human astrovirus VA2 | | scientific name -1048668 | Cotton leaf curl Multan alphasatellite | | scientific name -1048668 | Cotton leaf curl Multan virus alphasatellite | | equivalent name -1048854 | Munguba virus | | scientific name -1049565 | Klebsiella pneumoniae KCTC 2242 | | scientific name -1049565 | Klebsiella pneumoniae str. KCTC 2242 | | equivalent name -1049565 | Klebsiella pneumoniae strain KCTC 2242 | | equivalent name -1049657 | Blattoidea | | scientific name -1050903 | Pepper cryptic virus 2 | | scientific name -1054649 | Beauveria bassiana RNA virus 1 | | scientific name -1054649 | Beauveria bassiana virus 1 | | equivalent name -1056880 | Neurachne muelleri | | scientific name -1056880 | Neurachne muelleri Hack., 1895 | | authority -1056880 | Paraneurachne muelleri | | synonym -1056880 | Paraneurachne muelleri (Hack.) S.T.Blake, 1972 | | authority -1056966 | Aedini | | scientific name -1070324 | Bos taurus papillomavirus 12 | | scientific name -1070324 | Bovine papillomavirus 12 | | equivalent name -1070324 | Bovine papillomavirus type 12 | | equivalent name -1070408 | Human papillomavirus 135 | | scientific name -1070408 | Human papillomavirus type 135 | | equivalent name -1070409 | Human papillomavirus 136 | | scientific name -1070409 | Human papillomavirus type 136 | | equivalent name -1070410 | human papillomavirus 137 | | scientific name -1070413 | Human papillomavirus 140 | | scientific name -1070413 | Human papillomavirus type 140 | | equivalent name -1070417 | Human papillomavirus 144 | | scientific name -1070417 | Human papillomavirus type 144 | | equivalent name -1071164 | Kobuvirus swine/China/2010 | | scientific name -1073966 | unclassified Sapelovirus | | scientific name -1074486 | Klebsiella pneumoniae 1191100241 | | scientific name -1074486 | Klebsiella pneumoniae str. 1191100241 | | equivalent name -1074486 | Klebsiella pneumoniae strain 1191100241 | | equivalent name -1075431 | Alticorpus geoffreyi | | scientific name -1075431 | Alticorpus geoffreyi Snoeks & Walapa, 2004 | | authority -1077831 | unclassified Narnaviridae | | scientific name -1077832 | Phytophthora infestans RNA virus 4 | | scientific name -1080004 | Fulcaldea stuessyi | | scientific name -1080004 | Fulcaldea stuessyi Roque & V.A.Funk, 2011 | | authority -1080924 | Bracon chlorophthalmus | | synonym -1080924 | Bracon chlorophthalmus Spinola, 1808 | | authority -1080924 | Zele chlorophthalmus | | scientific name -1080924 | Zele chlorophthalmus (Spinola, 1808) | | authority -1087440 | Klebsiella pneumoniae subsp. pneumoniae KPNIH1 | | scientific name -1087441 | Klebsiella pneumoniae subsp. pneumoniae KPNIH2 | | scientific name -1087442 | Klebsiella pneumoniae subsp. pneumoniae KPNIH3 | | scientific name -1087443 | Klebsiella pneumoniae subsp. pneumoniae KPNIH4 | | scientific name -1087444 | Klebsiella pneumoniae subsp. pneumoniae KPNIH5 | | scientific name -1087445 | Klebsiella pneumoniae subsp. pneumoniae KPNIH6 | | scientific name -1087446 | Klebsiella pneumoniae FCF1305 | | scientific name -1087447 | Klebsiella pneumoniae FCF3SP | | scientific name -1094167 | Klebsiella pneumoniae subsp. pneumoniae KPNIH7 | | scientific name -1094168 | Klebsiella pneumoniae subsp. pneumoniae KPNIH8 | | scientific name -1094169 | Klebsiella pneumoniae subsp. pneumoniae KPNIH9 | | scientific name -1094170 | Klebsiella pneumoniae subsp. pneumoniae KPNIH10 | | scientific name -1094171 | Klebsiella pneumoniae subsp. pneumoniae KPNIH11 | | scientific name -1096141 | Bovine hokovirus 2 | | scientific name -1111709 | unclassified Iflaviridae | | scientific name -1112098 | Oceanites oceanicus exasperatus | | scientific name -1112098 | Oceanites oceanicus exasperatus Mathews, 1912 | | authority -1114942 | Pig stool associated circular ssDNA virus GER2011 | | scientific name -1115383 | Cycas szechuanensis | | scientific name -1115383 | Cycas szechuanensis W.C.Cheng & L.K.Fu, 1975 | | authority -1115692 | Cannabis cryptic virus | | scientific name -1123862 | Klebsiella pneumoniae subsp. pneumoniae Kp13 | | scientific name -1123862 | Klebsiella pneumoniae subsp. pneumoniae str. Kp13 | | equivalent name -1123862 | Klebsiella pneumoniae subsp. pneumoniae strain Kp13 | | equivalent name -1124990 | Klebsiella pneumoniae cifa_HP1 | | scientific name -1124990 | Klebsiella pneumoniae str. cifa_HP1 | | equivalent name -1124990 | Klebsiella pneumoniae strain cifa_HP1 | | equivalent name -1125630 | Klebsiella pneumoniae subsp. pneumoniae HS11286 | | scientific name -1125630 | Klebsiella pneumoniae subsp. pneumoniae str. HS11286 | | equivalent name -1125630 | Klebsiella pneumoniae subsp. pneumoniae strain HS11286 | | equivalent name -1128946 | Klebsiella pneumoniae subsp. pneumoniae KPNIH12 | | scientific name -1128947 | Klebsiella pneumoniae subsp. pneumoniae KPNIH13 | | scientific name -1128948 | Klebsiella pneumoniae subsp. pneumoniae KPNIH14 | | scientific name -1128949 | Klebsiella pneumoniae subsp. pneumoniae KPNIH15 | | scientific name -1128950 | Klebsiella pneumoniae subsp. pneumoniae KPNIH16 | | scientific name -1128951 | Klebsiella pneumoniae subsp. pneumoniae KPNIH17 | | scientific name -1128952 | Klebsiella pneumoniae subsp. pneumoniae KPNIH18 | | scientific name -1128953 | Klebsiella pneumoniae subsp. pneumoniae KPNIH19 | | scientific name -1128954 | Klebsiella pneumoniae subsp. pneumoniae KPNIH20 | | scientific name -1132022 | Kobuvirus swine/South Korea/2011 | | scientific name -1133751 | Artemisia sobemovirus A | | equivalent name -1133751 | Artemisia virus A | | scientific name -1136133 | Porcine kobuvirus SH-W-CHN/2010/China | | scientific name -1136150 | Scrophularia cephalantha | | scientific name -1136150 | Scrophularia cephalantha Nakai, 1938 | | authority -1156497 | Pichiaceae | | scientific name -1156497 | Pichiaceae M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority -1156497 | Pichiaceae Zender, 1925 | | authority -1156769 | Pig Kobuvirus isolates | | equivalent name -1156769 | Porcine kobuvirus | | scientific name -1158979 | Myliobatidae | | scientific name -1159556 | Claviceps virens | | synonym -1159556 | Claviceps virens M. Sakurai ex Nakata 1934 | | authority -1159556 | MAFF 240994 | MAFF 240994 | type material -1159556 | MAFF 240995 | MAFF 240995 | type material -1159556 | TNS:F-18423 | TNS:F-18423 | type material -1159556 | Ustilaginoidea virens | | scientific name -1159556 | Ustilaginoidea virens (Cooke) Takah., 1896 | | authority -1159556 | Ustilago virens | | synonym -1159556 | Ustilago virens Cooke, 1878 | | authority -1159556 | Villosiclava virens | | synonym -1159556 | Villosiclava virens (Y. Sakurai ex Nakata) E. Tanaka & C. Tanaka 2009 | | authority -1159556 | rice false smut | | common name -1159795 | Dreissena rostriformis compressa | | scientific name -1159795 | Dreissena rostriformis compressa Logvinenko & Starobogatov, 1966 | | authority -1159796 | Dreissena rostriformis distincta | | scientific name -1159796 | Dreissena rostriformis distincta Andrusov, 1897 | | authority -1159796 | Dreissena rostriformis var. distincta | | synonym -1159798 | Dreissena grimmi | | synonym -1159798 | Dreissena rostriformis grimmi | | scientific name -1159798 | Dreissena rostriformis grimmi Andrusov, 1890 | | authority -1162296 | Klebsiella pneumoniae subsp. pneumoniae DSM 30104 | | includes -1162296 | Klebsiella pneumoniae subsp. pneumoniae DSM 30104 = JCM 1662 = NBRC 14940 | | scientific name -1162296 | Klebsiella pneumoniae subsp. pneumoniae JCM 1662 | | includes -1162296 | Klebsiella pneumoniae subsp. pneumoniae NBRC 14940 | | includes -1162296 | Klebsiella pneumoniae subsp. pneumoniae str. DSM 30104 | | equivalent name -1162296 | Klebsiella pneumoniae subsp. pneumoniae strain DSM 30104 | | equivalent name -1162297 | Klebsiella pneumoniae subsp. pneumoniae LCT-KP214 | | scientific name -1162297 | Klebsiella pneumoniae subsp. pneumoniae str. LCT-KP214 | | equivalent name -1162297 | Klebsiella pneumoniae subsp. pneumoniae strain LCT-KP214 | | equivalent name -1168062 | Klebsiella pneumoniae subsp. pneumoniae KPNIH21 | | scientific name -1168062 | Klebsiella pneumoniae subsp. pneumoniae str. KPNIH21 | | equivalent name -1168062 | Klebsiella pneumoniae subsp. pneumoniae strain KPNIH21 | | equivalent name -1168063 | Klebsiella pneumoniae subsp. pneumoniae KPNIH22 | | scientific name -1168063 | Klebsiella pneumoniae subsp. pneumoniae str. KPNIH22 | | equivalent name -1168063 | Klebsiella pneumoniae subsp. pneumoniae strain KPNIH22 | | equivalent name -1168064 | Klebsiella pneumoniae subsp. pneumoniae KPNIH23 | | scientific name -1168064 | Klebsiella pneumoniae subsp. pneumoniae str. KPNIH23 | | equivalent name -1168064 | Klebsiella pneumoniae subsp. pneumoniae strain KPNIH23 | | equivalent name -1170422 | Loreto virus | | scientific name -1170424 | Negev virus | | scientific name -1170425 | Piura virus | | scientific name -1170656 | Vinca leaf curl virus | | scientific name -1172985 | Jingmen tick virus | | scientific name -1172985 | Mogiana tick virus | | equivalent name -1173713 | CGMCC 5.2175 | CGMCC 5.2175 | type material -1173713 | Ganoderma sichuanense | | scientific name -1173713 | Ganoderma sichuanense J. D. Zhao & X. Q. Zhang, 1983 | | authority -1173713 | HMAS 252081 | HMAS 252081 | type material -1173763 | Klebsiella pneumoniae NES 14 | | scientific name -1173763 | Klebsiella pneumoniae str. NES 14 | | equivalent name -1173763 | Klebsiella pneumoniae strain NES 14 | | equivalent name -1176516 | Rosoideae incertae sedis | | scientific name -1177045 | Human astrovirus 1a | | scientific name -1177046 | Human astrovirus 2c | | scientific name -1177047 | Human astrovirus 4a | | scientific name -1177153 | Klebsiella pneumoniae subsp. pneumoniae LZ | | scientific name -1177153 | Klebsiella pneumoniae subsp. pneumoniae str. LZ | | equivalent name -1177153 | Klebsiella pneumoniae subsp. pneumoniae strain LZ | | equivalent name -1182518 | Maize streak Reunion virus | | scientific name -1183241 | Persimmon cryptic virus | | scientific name -1185359 | Bat sapovirus TLC58/HK | | scientific name -1185418 | Klebsiella pneumoniae subsp. pneumoniae ST512-K30BO | | scientific name -1185418 | Klebsiella pneumoniae subsp. pneumoniae str. ST512-K30BO | | equivalent name -1185418 | Klebsiella pneumoniae subsp. pneumoniae strain ST512-K30BO | | equivalent name -1185419 | Klebsiella pneumoniae subsp. pneumoniae ST258-K26BO | | scientific name -1185419 | Klebsiella pneumoniae subsp. pneumoniae str. ST258-K26BO | | equivalent name -1185419 | Klebsiella pneumoniae subsp. pneumoniae strain ST258-K26BO | | equivalent name -1185420 | Klebsiella pneumoniae subsp. pneumoniae ST258-K28BO | | scientific name -1185420 | Klebsiella pneumoniae subsp. pneumoniae str. ST258-K28BO | | equivalent name -1185420 | Klebsiella pneumoniae subsp. pneumoniae strain ST258-K28BO | | equivalent name -1187973 | California sea lion picobirnavirus | | equivalent name -1187973 | Otarine picobirnavirus | | scientific name -1188990 | Vallota speciosa virus | | scientific name -1193292 | Klebsiella pneumoniae subsp. pneumoniae 1084 | | scientific name -1193292 | Klebsiella pneumoniae subsp. pneumoniae str. 1084 | | equivalent name -1193292 | Klebsiella pneumoniae subsp. pneumoniae strain 1084 | | equivalent name -1195163 | Amazon lily mild mottle virus | | equivalent name -1195163 | Anulavirus ALMMV | | scientific name -1195641 | Sida yellow mosaic China virus | | scientific name -1195776 | Pleuronichthys japonicus | | scientific name -1195776 | Pleuronichthys japonicus Suzuki, Kawashima & Nakabo, 2009 | | authority -1196387 | Batrachospermum mahlacense | | synonym -1196387 | Batrachospermum mahlacense Kumano & W.A.Bowden-Kerby, 1986 | | authority -1196387 | Kumanoa mahlacensis | | scientific name -1196387 | Kumanoa mahlacensis (Kumano et W. A. Bowden-Kerby) M. L. Vis, Necchi, W. B. Chiasson et Entwisle 2012 | | authority -1196474 | Aster falcifolius | | scientific name -1196474 | Aster falcifolius Hand.-Mazz., 1937 | | authority -1196494 | Aster pycnophyllus | | scientific name -1196494 | Aster pycnophyllus Franch. ex Diels, 1912 | | authority -1199150 | Klebsiella pneumoniae subsp. pneumoniae KP5-1 | | scientific name -1200970 | French bean leaf curl virus - [India:Kanpur:2011] | | scientific name -1200970 | French bean leaf curl virus-Kanpur | | equivalent name -1200971 | French bean leaf curl betasatellite-Kanpur | | scientific name -1202142 | Citrus chlorotic dwarf associated virus | | scientific name -1202142 | Citrus chlorotic dwarf-associated virus | | equivalent name -1203539 | MW polyomavirus | | scientific name -1203539 | MWPyV strain MA095 | | equivalent name -1203544 | Klebsiella pneumoniae WGLW1 | | synonym -1203544 | Klebsiella pneumoniae subsp. pneumoniae WGLW1 | | scientific name -1203545 | Klebsiella pneumoniae WGLW2 | | synonym -1203545 | Klebsiella pneumoniae subsp. pneumoniae WGLW2 | | scientific name -1203546 | Klebsiella pneumoniae WGLW3 | | synonym -1203546 | Klebsiella pneumoniae subsp. pneumoniae WGLW3 | | scientific name -1203547 | Klebsiella pneumoniae WGLW5 | | synonym -1203547 | Klebsiella pneumoniae subsp. pneumoniae WGLW5 | | scientific name -1205678 | Klebsiella pneumoniae subsp. pneumoniae B5055 | | equivalent name -1205678 | Klebsiella pneumoniae subsp. pneumoniae CIP 52.145 | | equivalent name -1205678 | Klebsiella pneumoniae subsp. pneumoniae CIP 52.145 = B5055 | | scientific name -1206794 | Ecdysozoa | | scientific name -1206795 | Lophotrochozoa | | scientific name -1208309 | Deltapolyomavirus decihominis | | scientific name -1208309 | Human polyomavirus 10 | | equivalent name -1209932 | BBA 70349 | BBA 70349 | type material -1209932 | CBS 126529 | CBS 126529 | type material -1209932 | Colletotrichum scovillei | | scientific name -1209932 | Colletotrichum scovillei Damm, P.F. Cannon & Crous, 2012 | | authority -1209932 | Colletotrichum sp. UD-2012t | | includes -1212766 | Klebsiella pneumoniae subsp. pneumoniae ST258-490 | | scientific name -1212766 | Klebsiella pneumoniae subsp. pneumoniae str. ST258-490 | | equivalent name -1212766 | Klebsiella pneumoniae subsp. pneumoniae strain ST258-490 | | equivalent name -1213620 | Bhanja virus | | scientific name -1214274 | Aedes flavopictus downsi | | scientific name -1214274 | Aedes flavopictus downsi Bohart & Ingram, 1946 | | authority -1214275 | Aedes flavopictus miyarai | | scientific name -1214275 | Aedes flavopictus miyarai Tanaka, Mizusawa & Saugstad, 1979 | | authority -1214955 | GyV4 | GyV4 | acronym -1214955 | Gyrovirus 4 | | scientific name -1216472 | Bat hepatitis E virus | | scientific name -1216472 | Bat hepevirus | | equivalent name -1217821 | Sibine fusca densovirus | | scientific name -1218098 | Klebsiella pneumoniae subsp. ozaenae NBRC 105683 | | scientific name -1219210 | Cordyceps militaris CM-whu | | scientific name -1221206 | Soybean chlorotic spot virus | | scientific name -1221208 | Papilio polyxenes densovirus | | scientific name -1221437 | Grapevine virus F | | scientific name -1221521 | Klebsiella pneumoniae HCNHY1 | | scientific name -1223561 | CAS virus | | scientific name -1223562 | Golden Gate virus | | scientific name -1224679 | Diphyllobothriidea | | scientific name -1225181 | Klebsiella pneumoniae subsp. pneumoniae KPNIH24 | | scientific name -1225182 | Klebsiella pneumoniae subsp. pneumoniae KPNIH25 | | scientific name -1225183 | Klebsiella pneumoniae subsp. pneumoniae KPNIH26 | | scientific name -1226115 | Klebsiella pneumoniae subsp. pneumoniae KpQ3 | | scientific name -1226115 | Klebsiella pneumoniae subsp. pneumoniae str. KpQ3 | | equivalent name -1226115 | Klebsiella pneumoniae subsp. pneumoniae strain KpQ3 | | equivalent name -1226680 | Klebsiella pneumoniae subsp. pneumoniae Ecl8 | | scientific name -1228988 | Klebsiella pneumoniae subsp. pneumoniae KpMDU1 | | scientific name -1230847 | Micromus angulatus | | scientific name -1230847 | Micromus angulatus (Stephens, 1836) | | authority -1231296 | unclassified Begomovirus-associated alphasatellites | | scientific name -1231522 | CBS 7798 | CBS 7798 | type material -1231522 | Candida duobushaemuli Cend.-Bueno, Kolecka, Alastr.-Izq., Gomez-Lopez, Cuenc.-Estr. & Boekhout, 2012 | | synonym -1231522 | Candida duobushaemulonii | | synonym -1231522 | Candidozyma duobushaemuli | | scientific name -1231522 | Candidozyma duobushaemuli (Cend.-Bueno, Kolecka, Alastr.-Izq., Gomez-Lopez, Cuenc.-Estr. & Boekhout, 2012) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai, 2024 | | authority -1231522 | NRRL Y-17802 | NRRL Y-17802 | type material -1231522 | NRRL-Y-17802 | NRRL-Y-17802 | type material -1231522 | NRRL:Y-17802 | NRRL:Y-17802 | type material -1231522 | NRRLY-17802 | NRRLY-17802 | type material -1231523 | CNM CL-7239 | CNM CL-7239 | type material -1231523 | CNM-CL-7239 | CNM-CL-7239 | type material -1231523 | CNM:CL-7239 | CNM:CL-7239 | type material -1231523 | CNMCL-7239 | CNMCL-7239 | type material -1231523 | CNMCL7239 | CNMCL7239 | type material -1231523 | Candida haemuli var. vulneris Cend.-Bueno, Kolecka, Alastr.-Izq., Gomez-Lopez, Cuenc.-Estr. & Boekhout, 2012 | | synonym -1231523 | Candida haemuloni var. vulnera | | synonym -1231523 | Candidozyma haemuli var. vulneris | | scientific name -1231523 | Candidozyma haemuli var. vulneris (Cend.-Bueno, Kolecka, Alastr.-Izq., Gomez-Lopez, Cuenc.-Estr. & Boekhout) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai, 2024 | | authority -1232392 | Klebsiella pneumoniae subsp. pneumoniae KpO3210 | | scientific name -1232637 | Scutavirus | | scientific name -1233522 | unclassified Nebovirus | | scientific name -1236101 | Klebsiella pneumoniae JHCK1 | | scientific name -1236101 | Klebsiella pneumoniae str. JHCK1 | | synonym -1236102 | Klebsiella pneumoniae VA360 | | scientific name -1236102 | Klebsiella pneumoniae str. VA360 | | synonym -1236400 | Pan troglodytes troglodytes polyomavirus 1 | | scientific name -1236676 | Cubitermes ugandensis | | synonym -1236676 | Cubitermes ugandensis (Fuller, 1923) | | authority -1236676 | Cubitermes ugandensis Fuller, 1923 | | authority -1236676 | Isognathotermes ugandensis | | scientific name -1236676 | Isognathotermes ugandensis (Fuller, 1923) | | authority -1238886 | unclassified Torradovirus | | scientific name -1239565 | Mamastrovirus 1 | | scientific name -1239565 | Mamastrovirus-1 | | equivalent name -1241370 | Okra leaf curl Oman virus | | scientific name -1241918 | Le Blanc nodavirus | | scientific name -1244085 | Klebsiella pneumoniae CG43 | | scientific name -1248396 | Human papillomavirus 156 | | scientific name -1248396 | Human papillomavirus type 156 | | equivalent name -1249508 | unclassified Hepacivirus | | scientific name -1250315 | RNA satellites | | scientific name -1250520 | Klebsiella pneumoniae RYC492 | | scientific name -1263871 | Klebsiella pneumoniae ATCC BAA-2146 | | scientific name -1267897 | Klebsiella pneumoniae hvKP1 | | scientific name -1268974 | Klebsiella pneumoniae subsp. pneumoniae Kp001 | | scientific name -1269006 | Klebsiella pneumoniae 909957 | | scientific name -1272960 | Yata virus | | scientific name -1273128 | KLCuB | | acronym -1273128 | Kenaf leaf curl betasatellite | | scientific name -1274605 | Human astrovirus 1/ICMH642Astro/2006/BD | | scientific name -1274606 | Human astrovirus 1/ICMH666Astro/2006/BD | | scientific name -1274607 | Human astrovirus 6/ICMH108Astro/2005/BD | | scientific name -1274608 | Human astrovirus 6/ICMH433Astro/2006/BD | | scientific name -1274609 | Human astrovirus 1/ICMH590Astro/2006/BD | | scientific name -1274610 | Human astrovirus 1/ICMH573Astro/2006/BD | | scientific name -1274611 | Human astrovirus 1/ICMH469Astro/2006/BD | | scientific name -1274613 | Human astrovirus 1/GUP216Astro/2005/TR | | scientific name -1274614 | Human astrovirus 5/GUP125Astro/2005/TR | | scientific name -1274615 | Human astrovirus 1/GUP024Astro/2004/TR | | scientific name -1276652 | Klebsiella pneumoniae ATCC BAA-1705 | | scientific name -1276653 | Klebsiella pneumoniae 700603 | | scientific name -1278288 | Pethia | | scientific name -1279040 | Klebsiella pneumoniae PR04 | | scientific name -1279099 | Sclerotinia sclerotiorum mitovirus 3 | | scientific name -1280412 | Conoidasida | | scientific name -1280412 | Conoidasida Levine 1988 | | authority -1284787 | Klebsiella pneumoniae UHKPC40 | | scientific name -1284788 | Klebsiella pneumoniae UHKPC23 | | scientific name -1284789 | Klebsiella pneumoniae UHKPC28 | | scientific name -1284790 | Klebsiella pneumoniae UHKPC05 | | scientific name -1284791 | Klebsiella pneumoniae UHKPC47 | | scientific name -1284792 | Klebsiella pneumoniae UHKPC67 | | scientific name -1284793 | Klebsiella pneumoniae UHKPC69 | | scientific name -1284794 | Klebsiella pneumoniae UHKPC77 | | scientific name -1284795 | Klebsiella pneumoniae UHKPC96 | | scientific name -1284796 | Klebsiella pneumoniae DMC0526 | | scientific name -1284797 | Klebsiella pneumoniae DMC0799 | | scientific name -1284798 | Klebsiella pneumoniae DMC1097 | | scientific name -1284799 | Klebsiella pneumoniae DMC1316 | | scientific name -1284800 | Klebsiella pneumoniae UHKPC61 | | scientific name -1284801 | Klebsiella pneumoniae UHKPC48 | | scientific name -1284802 | Klebsiella pneumoniae UHKPC33 | | scientific name -1284803 | Klebsiella pneumoniae UHKPC59 | | scientific name -1284804 | Klebsiella pneumoniae UHKPC07 | | scientific name -1284805 | Klebsiella pneumoniae UHKPC17 | | scientific name -1284806 | Klebsiella pneumoniae UHKPC18 | | scientific name -1284807 | Klebsiella pneumoniae UHKPC31 | | scientific name -1284808 | Klebsiella pneumoniae UHKPC06 | | scientific name -1284809 | Klebsiella pneumoniae UHKPC02 | | scientific name -1284810 | Klebsiella pneumoniae UHKPC09 | | scientific name -1284811 | Klebsiella pneumoniae UHKPC01 | | scientific name -1284812 | Klebsiella pneumoniae UHKPC81 | | scientific name -1284813 | Klebsiella pneumoniae UHKPC27 | | scientific name -1284814 | Klebsiella pneumoniae UHKPC 52 | | scientific name -1284815 | Klebsiella pneumoniae UHKPC24 | | scientific name -1284816 | Klebsiella pneumoniae UHKPC26 | | scientific name -1284817 | Klebsiella pneumoniae UHKPC57 | | scientific name -1284818 | Klebsiella pneumoniae UHKPC179 | | scientific name -1284819 | Klebsiella pneumoniae UHKPC45 | | scientific name -1284820 | Klebsiella pneumoniae UHKPC22 | | scientific name -1284821 | Klebsiella pneumoniae UHKPC29 | | scientific name -1284822 | Klebsiella pneumoniae UHKPC32 | | scientific name -1284823 | Klebsiella pneumoniae UHKPC04 | | scientific name -1284824 | Klebsiella pneumoniae VAKPC252 | | scientific name -1284825 | Klebsiella pneumoniae VAKPC254 | | scientific name -1284826 | Klebsiella pneumoniae VAKPC269 | | scientific name -1284827 | Klebsiella pneumoniae VAKPC278 | | scientific name -1284828 | Klebsiella pneumoniae VAKPC280 | | scientific name -1284829 | Klebsiella pneumoniae VAKPC270 | | scientific name -1284830 | Klebsiella pneumoniae VAKPC276 | | scientific name -1284831 | Klebsiella pneumoniae VAKPC297 | | scientific name -1284832 | Klebsiella pneumoniae VAKPC309 | | scientific name -1284833 | Klebsiella pneumoniae KP-7 | | scientific name -1284834 | Klebsiella pneumoniae KP-11 | | scientific name -1285372 | Klebsiella pneumoniae KP_H5500 | | scientific name -1285373 | Klebsiella pneumoniae KPM_nasey | | scientific name -1285596 | Megabirnaviridae | | scientific name -1285597 | Megabirnavirus | | scientific name -1290996 | Klebsiella pneumoniae KP3-S | | scientific name -1292273 | Obrimoposthia | | scientific name -1293059 | Macrophthalmidae | | scientific name -1293356 | Paspaleae | | scientific name -1293356 | Paspaleae J.Presl, 1830 | | authority -1293359 | Paspalinae | | scientific name -1293359 | Paspalinae Griseb., 1846 | | authority -1293364 | Neurachninae | | scientific name -1293364 | Neurachninae Clayton & Renvoize, 1986 | | authority -1294138 | Klebsiella pneumoniae KP5-R | | scientific name -1294139 | Klebsiella pneumoniae KP4-R | | scientific name -1294140 | Klebsiella pneumoniae KP1-I | | scientific name -1294141 | Klebsiella pneumoniae KP2-R | | scientific name -1294269 | Klebsiella pneumoniae HSL4 | | scientific name -1298631 | Turncurtovirus | | scientific name -1298633 | Aichivirus C | | equivalent name -1298633 | Kobuvirus cebes | | scientific name -1299309 | Alphanecrovirus | | scientific name -1300166 | Klebsiella pneumoniae subsp. pneumoniae JCM 20051 | | scientific name -1300981 | Porcine kobuvirus H1/2010/USA | | scientific name -1300982 | Porcine kobuvirus H10/2012/USA | | scientific name -1300983 | Porcine kobuvirus H11/2012/USA | | scientific name -1300984 | Porcine kobuvirus H12/2012/USA | | scientific name -1300985 | Porcine kobuvirus H13/2012/USA | | scientific name -1300986 | Porcine kobuvirus H14/2012/USA | | scientific name -1300987 | Porcine kobuvirus H15/2012/USA | | scientific name -1300988 | Porcine kobuvirus H16/2012/USA | | scientific name -1300989 | Porcine kobuvirus H17/2012/USA | | scientific name -1300990 | Porcine kobuvirus H18/2012/USA | | scientific name -1300991 | Porcine kobuvirus H19/2012/USA | | scientific name -1300992 | Porcine kobuvirus H2/2010/USA | | scientific name -1300993 | Porcine kobuvirus H20/2012/USA | | scientific name -1300994 | Porcine kobuvirus H21/2012/USA | | scientific name -1300995 | Porcine kobuvirus H22/2012/USA | | scientific name -1300996 | Porcine kobuvirus H23/2012/USA | | scientific name -1300997 | Porcine kobuvirus H24/2012/USA | | scientific name -1300998 | Porcine kobuvirus H25/2012/USA | | scientific name -1300999 | Porcine kobuvirus H3/2010/USA | | scientific name -1301000 | Porcine kobuvirus H4/2010/USA | | scientific name -1301001 | Porcine kobuvirus H5/2012/USA | | scientific name -1301002 | Porcine kobuvirus H6/2012/USA | | scientific name -1301003 | Porcine kobuvirus H7/2012/USA | | scientific name -1301004 | Porcine kobuvirus H8/2012/USA | | scientific name -1301005 | Porcine kobuvirus H9/2012/USA | | scientific name -1301006 | Porcine kobuvirus M1/2012/USA | | scientific name -1301007 | Porcine kobuvirus M10/2012/USA | | scientific name -1301008 | Porcine kobuvirus M2/2012/USA | | scientific name -1301009 | Porcine kobuvirus M3/2012/USA | | scientific name -1301010 | Porcine kobuvirus M4/2012/USA | | scientific name -1301011 | Porcine kobuvirus M5/2012/USA | | scientific name -1301012 | Porcine kobuvirus M6/2012/USA | | scientific name -1301013 | Porcine kobuvirus M7/2012/USA | | scientific name -1301014 | Porcine kobuvirus M8/2012/USA | | scientific name -1301015 | Porcine kobuvirus M9/2012/USA | | scientific name -1302145 | Aethopyga gouldiae | | scientific name -1302145 | Aethopyga gouldiae (Vigors, 1831) | | authority -1302145 | Cinnyris gouldiae | | synonym -1302145 | Cinnyris gouldiae Vigors, 1831 | | authority -1302145 | Gould's sunbird | | genbank common name -1303385 | Tomato leaf curl Liwa virus | | scientific name -1304916 | Klebsiella pneumoniae 140_1040 | | scientific name -1304917 | Klebsiella pneumoniae 160_1080 | | scientific name -1304918 | Klebsiella pneumoniae 120_1020 | | scientific name -1304919 | Klebsiella pneumoniae 280_1220 | | scientific name -1304920 | Klebsiella pneumoniae 361_1301 | | scientific name -1304921 | Klebsiella pneumoniae 440_1540 | | scientific name -1304922 | Klebsiella pneumoniae 500_1420 | | scientific name -1304923 | Klebsiella pneumoniae 540_1460 | | scientific name -1304924 | Klebsiella pneumoniae 646_1568 | | scientific name -1306546 | ALCV | | acronym -1306546 | Alfalfa leaf curl virus | | equivalent name -1306546 | Capulavirus medicagonis | | scientific name -1306950 | Klebsiella pneumoniae 12-3578 | | synonym -1306950 | Klebsiella pneumoniae subsp. pneumoniae 12-3578 | | scientific name -1307798 | Negevirus | | scientific name -1307799 | Pegivirus | | scientific name -1307958 | Sweet potato C6 virus | | scientific name -1307958 | Sweet potato virus C-6 | | equivalent name -1308539 | Klebsiella pneumoniae subsp. pneumoniae ATCC 43816 | | scientific name -1308684 | Klebsiella pneumoniae ADL-122 | | scientific name -1308684 | Klebsiella pneumoniae ADL-22 | | equivalent name -1308685 | Klebsiella pneumoniae ADL-201 | | scientific name -1308685 | Klebsiella pneumoniae ADL-25 | | equivalent name -1308686 | Klebsiella pneumoniae ADL-202 | | scientific name -1308686 | Klebsiella pneumoniae ADL-26 | | equivalent name -1308687 | Klebsiella pneumoniae ADL-317 | | scientific name -1308687 | Klebsiella pneumoniae ADL-70 | | equivalent name -1308688 | Klebsiella pneumoniae ADL-322 | | scientific name -1308688 | Klebsiella pneumoniae ADL-75 | | equivalent name -1308731 | Enterobacter aerogenes ADL-323 | | synonym -1308731 | Enterobacter aerogenes ADL-76 | | equivalent name -1308731 | Klebsiella aerogenes ADL-323 | | scientific name -1308858 | Sigmavirus | | scientific name -1309536 | Hydroporus obliquesignatus | | synonym -1309536 | Hydroporus obliquesignatus Bielz, 1852 | | authority -1309536 | Porhydrus obliquesignatus | | scientific name -1309536 | Porhydrus obliquesignatus (Bielz, 1852) | | authority -1310158 | Klebsiella pneumoniae Kb140 | | scientific name -1310159 | Klebsiella pneumoniae Kb677 | | scientific name -1310424 | Verticillium dahliae partitivirus 1 | | scientific name -1315262 | Human papillomavirus type 163 | | equivalent name -1315262 | human papillomavirus 163 | | scientific name -1316582 | Klebsiella pneumoniae ATCC 43816 | | scientific name -1316938 | Klebsiella pneumoniae ATCC 25955 | | scientific name -1316939 | Klebsiella pneumoniae G5-2 | | scientific name -1328324 | Klebsiella pneumoniae subsp. pneumoniae KPNIH27 | | scientific name -1328325 | Klebsiella pneumoniae subsp. pneumoniae KPR0928 | | scientific name -1328337 | Klebsiella pneumoniae BIDMC 31 | | scientific name -1328362 | Klebsiella pneumoniae MGH 17 | | scientific name -1328363 | Klebsiella pneumoniae MGH 18 | | scientific name -1328364 | Klebsiella pneumoniae MGH 19 | | scientific name -1328366 | Klebsiella pneumoniae MGH 21 | | scientific name -1328367 | Klebsiella pneumoniae MGH 29 | | scientific name -1328368 | Klebsiella pneumoniae MGH 30 | | scientific name -1328369 | Klebsiella pneumoniae MGH 31 | | scientific name -1328370 | Klebsiella pneumoniae MGH 32 | | scientific name -1328371 | Klebsiella pneumoniae MGH 35 | | scientific name -1328372 | Klebsiella pneumoniae MGH 36 | | scientific name -1328373 | Klebsiella pneumoniae MGH 39 | | scientific name -1328375 | Klebsiella pneumoniae MGH 43 | | scientific name -1328377 | Klebsiella pneumoniae MGH 45 | | scientific name -1328378 | Klebsiella pneumoniae MGH 46 | | scientific name -1328379 | Klebsiella pneumoniae MGH 47 | | scientific name -1328380 | Klebsiella pneumoniae MGH 48 | | scientific name -1328381 | Klebsiella pneumoniae BWH 2 | | scientific name -1328382 | Klebsiella pneumoniae BWH 15 | | scientific name -1328383 | Klebsiella pneumoniae BWH 22 | | scientific name -1328384 | Klebsiella pneumoniae BWH 28 | | scientific name -1328385 | Klebsiella pneumoniae BWH 30 | | scientific name -1328386 | Klebsiella pneumoniae BWH 36 | | scientific name -1328387 | Klebsiella pneumoniae BWH 41 | | scientific name -1328388 | Klebsiella pneumoniae MGH 78578 | | scientific name -1328389 | Klebsiella pneumoniae UCICRE 1 | | scientific name -1328390 | Klebsiella pneumoniae UCICRE 2 | | scientific name -1328391 | Klebsiella pneumoniae UCICRE 4 | | scientific name -1328392 | Klebsiella pneumoniae UCICRE 6 | | scientific name -1328393 | Klebsiella pneumoniae UCICRE 7 | | scientific name -1328394 | Klebsiella pneumoniae UCICRE 8 | | scientific name -1328396 | Klebsiella pneumoniae UCICRE 13 | | scientific name -1328398 | Klebsiella pneumoniae BIDMC 1 | | scientific name -1328399 | Klebsiella pneumoniae BIDMC 2A | | scientific name -1328400 | Klebsiella pneumoniae BIDMC 4 | | scientific name -1328401 | Klebsiella pneumoniae BIDMC 5 | | scientific name -1328402 | Klebsiella pneumoniae BIDMC 7A | | scientific name -1328403 | Klebsiella pneumoniae BIDMC 7B | | scientific name -1328404 | Klebsiella pneumoniae BIDMC 10 | | scientific name -1328405 | Klebsiella pneumoniae BIDMC 11 | | scientific name -1328406 | Klebsiella pneumoniae BIDMC 12A | | scientific name -1328407 | Klebsiella pneumoniae BIDMC 12B | | scientific name -1328408 | Klebsiella pneumoniae BIDMC 12C | | scientific name -1328409 | Klebsiella pneumoniae BIDMC 13 | | scientific name -1328410 | Klebsiella pneumoniae BIDMC 14 | | scientific name -1328411 | Klebsiella pneumoniae BIDMC 16 | | scientific name -1328412 | Klebsiella pneumoniae BIDMC 18A | | scientific name -1328413 | Klebsiella pneumoniae BIDMC 18B | | scientific name -1328414 | Klebsiella pneumoniae BIDMC 18C | | scientific name -1328415 | Klebsiella pneumoniae BIDMC 18D | | scientific name -1328416 | Klebsiella pneumoniae BIDMC 21 | | scientific name -1328417 | Klebsiella pneumoniae BIDMC 22 | | scientific name -1328418 | Klebsiella pneumoniae BIDMC 23 | | scientific name -1328419 | Klebsiella pneumoniae BIDMC 24 | | scientific name -1328420 | Klebsiella pneumoniae BIDMC 25 | | scientific name -1328421 | Klebsiella pneumoniae BIDMC 32 | | scientific name -1328423 | Klebsiella pneumoniae BIDMC 34 | | scientific name -1328424 | Klebsiella pneumoniae BIDMC 35 | | scientific name -1328425 | Klebsiella pneumoniae BIDMC 36 | | scientific name -1328426 | Klebsiella pneumoniae BIDMC 40 | | scientific name -1328427 | Klebsiella pneumoniae BIDMC 41 | | scientific name -1329649 | Bat bocavirus | | scientific name -1329799 | Archelosauria | | scientific name -1329799 | Archelosauria Crawfort et al. 2014 | | authority -1329799 | Archosauria-Testudines | | synonym -1329799 | Testudines + Archosauria group | | synonym -1329801 | Klebsiella pneumoniae ST272 | | scientific name -1329843 | Klebsiella pneumoniae BIDMC 33B | | scientific name -1331744 | Actinidia virus X | | equivalent name -1331744 | Plantain virus X | | scientific name -1335476 | Eidolon helvum bat papillomavirus 2 | | equivalent name -1335476 | Eidolon helvum bat papillomavirus type 2 | | equivalent name -1335476 | Eidolon helvum papillomavirus 2 | | scientific name -1335476 | Eidolon helvum papillomavirus type 2 | | equivalent name -1335477 | Eidolon helvum bat papillomavirus 3 | | equivalent name -1335477 | Eidolon helvum bat papillomavirus type 3 | | equivalent name -1335477 | Eidolon helvum papillomavirus 3 | | scientific name -1338369 | Dipnotetrapodomorpha | | scientific name -1341693 | Klebsiella pneumoniae subsp. pneumoniae MP14 | | scientific name -1343063 | Klebsiella pneumoniae subsp. pneumoniae UKKV901664 | | scientific name -1343920 | Prunevirus armeniacae | | scientific name -1345628 | Klebsiella pneumoniae SB2390 | | scientific name -1345631 | Klebsiella pneumoniae SB3193 | | scientific name -1348659 | Klebsiella pneumoniae CGMCC 1.1736 | | scientific name -1352932 | Klebsiella pneumoniae LCT-KP182 | | scientific name -1352933 | Klebsiella pneumoniae LCT-KP289 | | scientific name -1357295 | Klebsiella pneumoniae EGD-HP19-C | | scientific name -1365186 | Klebsiella pneumoniae KP-1 | | scientific name -1379687 | Klebsiella pneumoniae BJ1-GA | | synonym -1379687 | Klebsiella pneumoniae subsp. pneumoniae BJ1-GA | | scientific name -1379688 | Klebsiella pneumoniae SA1 | | synonym -1379688 | Klebsiella pneumoniae subsp. pneumoniae SA1 | | scientific name -1379689 | Klebsiella pneumoniae T69 | | synonym -1379689 | Klebsiella pneumoniae subsp. pneumoniae T69 | | scientific name -1380111 | Poecilimon luschani luschani | | scientific name -1380456 | Poecilimon luschani chobanovi | | scientific name -1380456 | Poecilimon luschani chobanovi Boztepe, Kaya & Ciplak, 2013 | | authority -1380456 | Poecilimon luschani ssp. 1 SK-2013 | | includes -1380908 | Klebsiella pneumoniae JM45 | | scientific name -1381121 | Klebsiella pneumoniae 303K | | scientific name -1382995 | Chaetoceros sp. DNA virus 7 | | scientific name -1384549 | Klebsiella pneumoniae subsp. pneumoniae KKBO-1 | | scientific name -1384550 | Klebsiella pneumoniae subsp. pneumoniae KKBO-4 | | scientific name -1385657 | unclassified Gokushovirinae | | scientific name -1387562 | Ophidiomyces | | scientific name -1387562 | Ophidiomyces Sigler, Hambl. & Pare, 2013 | | authority -1387563 | CBS 122913 | CBS 122913 | type material -1387563 | Chrysosporium ophidiicola Guarro, Deanna A. Sutton, Wickes & Rajeev, 2009 | | synonym -1387563 | Chrysosporium sp. R-3923 | | includes -1387563 | Ophidiomyces ophidiicola | | scientific name -1387563 | Ophidiomyces ophidiicola (Guarro, Deanna A. Sutton, Wickes & Rajeev) Sigler, Hambleton & Pare, 2013 | | synonym -1389422 | Klebsiella pneumoniae LAU-KP1 | | scientific name -1392499 | Klebsiella pneumoniae 1158 | | synonym -1392499 | Klebsiella pneumoniae subsp. pneumoniae 1158 | | scientific name -1392500 | Klebsiella pneumoniae HK787 | | scientific name -1393935 | Myotis horsfieldii deignani | | scientific name -1393935 | Myotis horsfieldii deignani Shamel, 1942 | | authority -1393935 | Myotis horsfieldii subsp. deignani | | synonym -1393935 | Myotis horsfieldii subsp. deignani Shamel, 1942 | | authority -1393936 | Myotis horsfieldii horsfieldii | | scientific name -1393936 | Vespertilio horsfieldii horsfieldii | | synonym -1393936 | Vespertilio horsfieldii horsfieldii Temminck, 1840 | | authority -1395574 | Klebsiella pneumoniae subsp. pneumoniae KpQ24 | | scientific name -1395575 | Klebsiella pneumoniae subsp. pneumoniae KpQ15 | | scientific name -1400138 | Enterobacter aerogenes UCI 15 | | synonym -1400138 | Klebsiella aerogenes UCI 15 | | scientific name -1400139 | Enterobacter aerogenes UCI 16 | | synonym -1400139 | Klebsiella aerogenes UCI 16 | | scientific name -1400140 | Enterobacter aerogenes UCI 27 | | synonym -1400140 | Klebsiella aerogenes UCI 27 | | scientific name -1400141 | Enterobacter aerogenes UCI 28 | | synonym -1400141 | Klebsiella aerogenes UCI 28 | | scientific name -1400142 | Enterobacter aerogenes UCI 45 | | synonym -1400142 | Klebsiella aerogenes UCI 45 | | scientific name -1400143 | Enterobacter aerogenes UCI 46 | | synonym -1400143 | Klebsiella aerogenes UCI 46 | | scientific name -1400144 | Enterobacter aerogenes UCI 47 | | synonym -1400144 | Klebsiella aerogenes UCI 47 | | scientific name -1400145 | Enterobacter aerogenes UCI 48 | | synonym -1400145 | Klebsiella aerogenes UCI 48 | | scientific name -1400160 | Klebsiella pneumoniae BIDMC 42a | | scientific name -1400161 | Klebsiella pneumoniae BIDMC 42b | | scientific name -1400162 | Klebsiella pneumoniae BIDMC 45 | | scientific name -1400163 | Klebsiella pneumoniae BIDMC 46a | | scientific name -1400164 | Klebsiella pneumoniae BIDMC 46b | | scientific name -1400165 | Klebsiella pneumoniae BIDMC 47 | | scientific name -1400166 | Klebsiella pneumoniae BIDMC 48 | | scientific name -1400167 | Klebsiella pneumoniae BIDMC 51 | | scientific name -1400168 | Klebsiella pneumoniae BIDMC 52 | | scientific name -1400169 | Klebsiella pneumoniae BIDMC 53 | | scientific name -1400170 | Klebsiella pneumoniae UCI 17 | | scientific name -1400172 | Klebsiella pneumoniae UCI 19 | | scientific name -1400173 | Klebsiella pneumoniae UCI 20 | | scientific name -1400174 | Klebsiella pneumoniae UCI 21 | | scientific name -1400175 | Klebsiella pneumoniae UCI 22 | | scientific name -1400176 | Klebsiella pneumoniae UCI 25 | | scientific name -1400177 | Klebsiella pneumoniae UCI 26 | | scientific name -1400178 | Klebsiella pneumoniae UCI 33 | | scientific name -1400179 | Klebsiella pneumoniae UCI 34 | | scientific name -1400180 | Klebsiella pneumoniae UCI 37 | | scientific name -1400181 | Klebsiella pneumoniae UCI 38 | | scientific name -1400182 | Klebsiella pneumoniae UCI 41 | | scientific name -1400183 | Klebsiella pneumoniae UCI 42 | | scientific name -1400184 | Klebsiella pneumoniae UCI 43 | | scientific name -1400185 | Klebsiella pneumoniae UCI 44 | | scientific name -1401779 | Maiestas | | scientific name -1401779 | Maiestas Distant, 1917 | | authority -1406314 | Klebsiella pneumoniae subsp. pneumoniae PittNDM01 | | scientific name -1409961 | Klebsiella pneumoniae MRSN 1319 | | scientific name -1409962 | Klebsiella pneumoniae MRSN 2404 | | scientific name -1409963 | Klebsiella pneumoniae MRSN 3562 | | scientific name -1409964 | Klebsiella pneumoniae MRSN 3852 | | scientific name -1409965 | Klebsiella pneumoniae MRSN 6902 | | scientific name -1409966 | Klebsiella pneumoniae HE12 | | scientific name -1409966 | Klebsiella pneumoniae MRSN 12230 | | synonym -1411646 | Klebsiella pneumoniae A 860 | | synonym -1411646 | Klebsiella pneumoniae IS10 | | scientific name -1413252 | Klebsiella pneumoniae subsp. pneumoniae KPB-1 | | scientific name -1413253 | Klebsiella pneumoniae subsp. pneumoniae KPB-2 | | scientific name -1414655 | Pepper chlorotic spot virus | | scientific name -1414807 | Pristaulacus compressus | | scientific name -1414807 | Pristaulacus compressus (Spinola, 1808) | | authority -1415246 | Celaenorrhinus maculosa | | scientific name -1415246 | Celaenorrhinus maculosa (Felder & Felder, 1867) | | authority -1415246 | Pterygospidea maculosa | | synonym -1415246 | Pterygospidea maculosa Felder, 1867 | | authority -1416941 | Closterium baillyanum | | scientific name -1416941 | Closterium baillyanum (Brebisson ex Ralfs) Brebisson, 1856 | | authority -1416941 | Closterium didymotocum var. baillyanum | | synonym -1416941 | Closterium didymotocum var. baillyanum Brebisson ex Ralfs, 1848 | | authority -1417983 | Klebsiella pneumoniae subsp. pneumoniae A | | scientific name -1418810 | Mustilizans | | scientific name -1418811 | Mustilia hepatica | | synonym -1418811 | Mustilia hepatica Moore, 1879 | | authority -1418811 | Mustilizans hepatica | | scientific name -1418811 | Mustilizans hepatica Moore, 1879 | | authority -1420012 | Klebsiella pneumoniae 30660/NJST258_1 | | scientific name -1420013 | Klebsiella pneumoniae 30684/NJST258_2 | | scientific name -1424547 | Paspalum pubiflorum | | scientific name -1424547 | Paspalum pubiflorum Rupr. ex E.Fourn., 1886 | | authority -1427476 | Cimodo virus | | scientific name -1427522 | Klebsiella pneumoniae KPM_naseyCln3 | | scientific name -1428763 | TIBOV | | acronym -1428763 | Tibet orbivirus | | scientific name -1431455 | Klebsiella pneumoniae NB60 | | scientific name -1432547 | Klebsiella pneumoniae IS22 | | scientific name -1432550 | Klebsiella pneumoniae IS33 | | scientific name -1432552 | Klebsiella pneumoniae IS43 | | scientific name -1432553 | Klebsiella pneumoniae IS46 | | scientific name -1432554 | Klebsiella pneumoniae IS53 | | scientific name -1432558 | Klebsiella pneumoniae ISC21 | | scientific name -1432561 | Klebsiella pneumoniae IS39 | | scientific name -1432563 | Rottboellia yellow mottle virus | | scientific name -1434070 | Cervus papillomavirus 2 | | scientific name -1434070 | Cervus papillomavirus JSM-2013 | | equivalent name -1434070 | Cervus papillomavirus type 2 | | equivalent name -1435450 | Sclerotinia sclerotiorum umbra-like virus 1 | | scientific name -1436892 | Pea yellow stunt virus | | scientific name -1437010 | Boreoeutheria | | scientific name -1437010 | Boreotheria | | synonym -1437180 | Acrogymnospermae | | scientific name -1437180 | Acrogymnospermae P.D.Cantino & M.J.Donoghue, 2007 | | authority -1437183 | Mesangiospermae | | scientific name -1437183 | Mesangiospermae M.J.Donoghue, J.A.Doyle & P.D.Cantino, 2007 | | authority -1437197 | Petrosaviidae | | scientific name -1437197 | Petrosaviidae S.W.Graham & W.S.Judd, 2007 | | authority -1437201 | Pentapetalae | | scientific name -1437201 | Pentapetalae D.E.Soltis, P.S.Soltis & W.S.Judd, 2007 | | authority -1438697 | Klebsiella pneumoniae BIDMC 54 | | scientific name -1438698 | Klebsiella pneumoniae BIDMC 55 | | scientific name -1438699 | Klebsiella pneumoniae BIDMC 60 | | scientific name -1438701 | Klebsiella pneumoniae BIDMC 68 | | scientific name -1438702 | Klebsiella pneumoniae BIDMC 69 | | scientific name -1438703 | Klebsiella pneumoniae BWH 45 | | scientific name -1438704 | Klebsiella pneumoniae BWH 46 | | scientific name -1438705 | Klebsiella pneumoniae BWH 47 | | scientific name -1438706 | Klebsiella pneumoniae BWH 48 | | scientific name -1438707 | Klebsiella pneumoniae CHS 01 | | scientific name -1438708 | Klebsiella pneumoniae CHS 02 | | scientific name -1438709 | Klebsiella pneumoniae CHS 03 | | scientific name -1438710 | Klebsiella pneumoniae CHS 04 | | scientific name -1438711 | Klebsiella pneumoniae CHS 05 | | scientific name -1438712 | Klebsiella pneumoniae CHS 06 | | scientific name -1438713 | Klebsiella pneumoniae CHS 07 | | scientific name -1438714 | Klebsiella pneumoniae CHS 08 | | scientific name -1438715 | Klebsiella pneumoniae CHS 09 | | scientific name -1438716 | Klebsiella pneumoniae CHS 10 | | scientific name -1438717 | Klebsiella pneumoniae CHS 11 | | scientific name -1438718 | Klebsiella pneumoniae CHS 12 | | scientific name -1438719 | Klebsiella pneumoniae CHS 13 | | scientific name -1438720 | Klebsiella pneumoniae CHS 14 | | scientific name -1438721 | Klebsiella pneumoniae CHS 15 | | scientific name -1438722 | Klebsiella pneumoniae CHS 16 | | scientific name -1438723 | Klebsiella pneumoniae CHS 17 | | scientific name -1438724 | Klebsiella pneumoniae CHS 18 | | scientific name -1438725 | Klebsiella pneumoniae CHS 19 | | scientific name -1438726 | Klebsiella pneumoniae CHS 20 | | scientific name -1438727 | Klebsiella pneumoniae CHS 21 | | scientific name -1438728 | Klebsiella pneumoniae CHS 22 | | scientific name -1438729 | Klebsiella pneumoniae CHS 23 | | scientific name -1438730 | Klebsiella pneumoniae CHS 24 | | scientific name -1438731 | Klebsiella pneumoniae CHS 25 | | scientific name -1438732 | Klebsiella pneumoniae CHS 26 | | scientific name -1438733 | Klebsiella pneumoniae CHS 27 | | scientific name -1438734 | Klebsiella pneumoniae CHS 28 | | scientific name -1438735 | Klebsiella pneumoniae CHS 29 | | scientific name -1438736 | Klebsiella pneumoniae CHS 30 | | scientific name -1438737 | Klebsiella pneumoniae CHS 31 | | scientific name -1438738 | Klebsiella pneumoniae CHS 32 | | scientific name -1438739 | Klebsiella pneumoniae CHS 33 | | scientific name -1438740 | Klebsiella pneumoniae CHS 34 | | scientific name -1438741 | Klebsiella pneumoniae CHS 35 | | scientific name -1438742 | Klebsiella pneumoniae CHS 36 | | scientific name -1438743 | Klebsiella pneumoniae CHS 37 | | scientific name -1438744 | Klebsiella pneumoniae CHS 38 | | scientific name -1438745 | Klebsiella pneumoniae CHS 39 | | scientific name -1438746 | Klebsiella pneumoniae CHS 40 | | scientific name -1438747 | Klebsiella pneumoniae CHS 41 | | scientific name -1438748 | Klebsiella pneumoniae CHS 42 | | scientific name -1438749 | Klebsiella pneumoniae CHS 43 | | scientific name -1438750 | Klebsiella pneumoniae CHS 44 | | scientific name -1438751 | Klebsiella pneumoniae CHS 45 | | scientific name -1438752 | Klebsiella pneumoniae CHS 46 | | scientific name -1438753 | Klebsiella pneumoniae CHS 47 | | scientific name -1438754 | Klebsiella pneumoniae CHS 48 | | scientific name -1438755 | Klebsiella pneumoniae CHS 49 | | scientific name -1438756 | Klebsiella pneumoniae CHS 50 | | scientific name -1438757 | Klebsiella pneumoniae CHS 51 | | scientific name -1438758 | Klebsiella pneumoniae CHS 52 | | scientific name -1438759 | Klebsiella pneumoniae CHS 53 | | scientific name -1438760 | Klebsiella pneumoniae CHS 54 | | scientific name -1438761 | Klebsiella pneumoniae CHS 55 | | scientific name -1438762 | Klebsiella pneumoniae CHS 56 | | scientific name -1438763 | Klebsiella pneumoniae CHS 57 | | scientific name -1438764 | Klebsiella pneumoniae CHS 58 | | scientific name -1438765 | Klebsiella pneumoniae CHS 59 | | scientific name -1438766 | Klebsiella pneumoniae CHS 60 | | scientific name -1438767 | Klebsiella pneumoniae CHS 61 | | scientific name -1438768 | Klebsiella pneumoniae CHS 62 | | scientific name -1438769 | Klebsiella pneumoniae CHS 63 | | scientific name -1438770 | Klebsiella pneumoniae CHS 64 | | scientific name -1438771 | Klebsiella pneumoniae CHS 65 | | scientific name -1438772 | Klebsiella pneumoniae CHS 66 | | scientific name -1438773 | Klebsiella pneumoniae CHS 67 | | scientific name -1438774 | Klebsiella pneumoniae CHS 70 | | scientific name -1438775 | Klebsiella pneumoniae CHS 71 | | scientific name -1438776 | Klebsiella pneumoniae CHS 72 | | scientific name -1438777 | Klebsiella pneumoniae CHS 73 | | scientific name -1438778 | Klebsiella pneumoniae CHS 74 | | scientific name -1438779 | Klebsiella pneumoniae CHS 75 | | scientific name -1438780 | Klebsiella pneumoniae CHS 76 | | scientific name -1438781 | Klebsiella pneumoniae CHS 80 | | scientific name -1438782 | Klebsiella pneumoniae MGH 51 | | scientific name -1438783 | Klebsiella pneumoniae MGH 52 | | scientific name -1438784 | Klebsiella pneumoniae MGH 59 | | scientific name -1438785 | Klebsiella pneumoniae MGH 60 | | scientific name -1438786 | Klebsiella pneumoniae MGH 63 | | scientific name -1438787 | Klebsiella pneumoniae MGH 64 | | scientific name -1438788 | Klebsiella pneumoniae MGH 65 | | scientific name -1438789 | Klebsiella pneumoniae MGH 66 | | scientific name -1438790 | Klebsiella pneumoniae MGH 67 | | scientific name -1438792 | Klebsiella pneumoniae MGH 69 | | scientific name -1438793 | Klebsiella pneumoniae MGH 70 | | scientific name -1438794 | Klebsiella pneumoniae MGH 71 | | scientific name -1438795 | Klebsiella pneumoniae MGH 72 | | scientific name -1438796 | Klebsiella pneumoniae MGH 73 | | scientific name -1438797 | Klebsiella pneumoniae MGH 74 | | scientific name -1438798 | Klebsiella pneumoniae MGH 75 | | scientific name -1438800 | Klebsiella pneumoniae MGH 79 | | scientific name -1438802 | Klebsiella pneumoniae UCI 55 | | scientific name -1438803 | Klebsiella pneumoniae UCI 56 | | scientific name -1438804 | Klebsiella pneumoniae UCI 59 | | scientific name -1438805 | Klebsiella pneumoniae UCI 60 | | scientific name -1438806 | Klebsiella pneumoniae UCI 61 | | scientific name -1438807 | Klebsiella pneumoniae UCI 62 | | scientific name -1438808 | Klebsiella pneumoniae UCI 63 | | scientific name -1438809 | Klebsiella pneumoniae UCI 64 | | scientific name -1438810 | Klebsiella pneumoniae UCI 67 | | scientific name -1438811 | Klebsiella pneumoniae UCI 68 | | scientific name -1439320 | Enterobacter aerogenes MGH 61 | | synonym -1439320 | Klebsiella aerogenes MGH 61 | | scientific name -1439321 | Enterobacter aerogenes MGH 62 | | synonym -1439321 | Klebsiella aerogenes MGH 62 | | scientific name -1439322 | Enterobacter aerogenes MGH 77 | | synonym -1439322 | Klebsiella aerogenes MGH 77 | | scientific name -1439323 | Enterobacter aerogenes MGH 78 | | synonym -1439323 | Klebsiella aerogenes MGH 78 | | scientific name -1442610 | Myotis evotis milleri | | scientific name -1442610 | Myotis evotis milleri Elliot, 1903 | | authority -1442610 | Myotis evotis subsp. milleri | | synonym -1442610 | Myotis evotis subsp. milleri Elliot, 1903 | | authority -1442610 | Myotis milleri | | synonym -1445963 | Cycadidae | | scientific name -1445963 | Cycadidae Pax, 1894 | | authority -1446379 | Cupressales | | scientific name -1446379 | Cupressales Link, 1829 | | authority -1449984 | Klebsiella pneumoniae T2-1-1 | | scientific name -1449985 | Klebsiella pneumoniae T2-1-2 | | scientific name -1451263 | Klebsiella pneumoniae JT4 | | scientific name -1451298 | Anatoecus dentatus | | scientific name -1451298 | Anatoecus dentatus (Scopoli, 1763) | | authority -1451298 | Pediculus dentatus | | synonym -1451298 | Pediculus dentatus Scopoli, 1763 | | authority -1452516 | Caprine kobuvirus | | scientific name -1453155 | Histia flabellicorn | | synonym -1453155 | Histia flabellicornis ultima | | synonym -1453155 | Histia rhodope | | scientific name -1453155 | Histia rhodope (Cramer, 1775) | | authority -1453426 | Klebsiella pneumoniae ST514 | | scientific name -1454021 | Dragonfly larvae associated circular virus-1 | | scientific name -1454022 | Dragonfly larvae associated circular virus-10 | | scientific name -1454022 | Dragonfly larvae associated virus 10 | | equivalent name -1454023 | Dragonfly larvae associated circular virus-2 | | scientific name -1454024 | Dragonfly larvae associated circular virus-3 | | scientific name -1454024 | Dragonfly larvae associated virus 3 | | equivalent name -1454025 | Dragonfly larvae associated circular virus-4 | | scientific name -1454026 | Dragonfly larvae associated circular virus-5 | | scientific name -1454026 | Dragonfly larvae associated virus 5 | | equivalent name -1454027 | Dragonfly larvae associated circular virus-6 | | scientific name -1454027 | Dragonfly larvae associated virus 6 | | equivalent name -1454028 | Dragonfly larvae associated circular virus-7 | | scientific name -1454029 | Dragonfly larvae associated circular virus-8 | | scientific name -1454029 | Dragonfly larvae associated virus 8 | | equivalent name -1454030 | Dragonfly larvae associated circular virus-9 | | scientific name -1454227 | Ageratum yellow vein China alphasatellite | | scientific name -1455602 | Klebsiella pneumoniae 4006 | | scientific name -1455603 | Klebsiella pneumoniae 4541-2 | | scientific name -1455604 | Klebsiella pneumoniae 11227-1 | | scientific name -1455605 | Klebsiella pneumoniae 7699 | | scientific name -1457165 | Wallerfield virus | | scientific name -1457322 | Arrabida virus | | scientific name -1457503 | Dahlstedtia araripensis | | scientific name -1457503 | Dahlstedtia araripensis (Benth.) M.J.Silva & A.M.G.Azevedo, 2012 | | authority -1457503 | Lonchocarpus araripensis | | synonym -1457503 | Lonchocarpus araripensis Benth., 1860 | | authority -1458186 | Alphasatellites | | equivalent name -1458186 | Alphasatellitidae | | scientific name -1460422 | Klebsiella pneumoniae subsp. pneumoniae ST258 | | scientific name -1461176 | Podophylloideae | | scientific name -1461176 | Podophylloideae Eaton, 1836 | | authority -1462681 | Pepo aphid-borne yellows virus | | scientific name -1462682 | Luffa aphid-borne yellows virus | | scientific name -1462708 | Luffa acutangula var. amara | | scientific name -1462708 | Luffa acutangula var. amara (Roxb.) C.B.Clarke, 1879 | | authority -1462708 | Luffa amara | | synonym -1462708 | Luffa amara Roxb., 1832 | | authority -1462709 | Luffa acutangula var. forskalii | | scientific name -1462709 | Luffa acutangula var. forskalii (Schweinf. ex Harms) Heiser & E.E.Schill., 1990 | | authority -1462709 | Luffa forskaolii | | synonym -1462709 | Luffa forskaolii Schweinf. ex Harms, 1923 | | authority -1463138 | Ranunculoideae | | scientific name -1463138 | Ranunculoideae Arn., 1832 | | authority -1463140 | Delphinieae | | scientific name -1463140 | Delphinieae Schroed., 1909 | | authority -1463147 | Anemoneae | | scientific name -1463147 | Anemoneae DC., 1817 | | authority -1463675 | Centropus bengalensis | | scientific name -1463675 | Centropus bengalensis (Gmelin, 1788) | | authority -1463675 | Cuculus bengalensis | | synonym -1463675 | Cuculus bengalensis Gmelin, 1788 | | authority -1463675 | lesser coucal | | genbank common name -1471299 | Grapevine Roditis leaf discoloration-associated virus | | scientific name -1471299 | Grapevine roditis leaf discoloration virus | | equivalent name -1476584 | Currant latent virus | | scientific name -1481465 | Tomato necrotic dwarf virus | | scientific name -1484106 | Anemone japonica var. tomentosa | | synonym -1484106 | Anemone japonica var. tomentosa Maxim., 1889 | | authority -1484106 | Anemone tomentosa | | scientific name -1484106 | Anemone tomentosa (Maxim.) C.Pei, 1933 | | authority -1489341 | Osteoglossocephalai | | scientific name -1489388 | Euteleosteomorpha | | scientific name -1489872 | Percomorpha | | includes -1489872 | Percomorphaceae | | scientific name -1489875 | Gobiaria | | scientific name -1489875 | Gobiomorpharia | | synonym -1489878 | Gobiiformes | | scientific name -1489878 | gobies and sleepers | | genbank common name -1489885 | Pelagiaria | | scientific name -1489885 | Pelagimorpharia | | synonym -1489885 | Stromateoidei | | synonym -1489894 | Scombriformes | | scientific name -1489894 | Scombroidei | | synonym -1489894 | tunas and others | | genbank common name -1489904 | Carangaria | | scientific name -1489904 | Carangimorpha | | synonym -1489904 | Carangimorphariae | | synonym -1489908 | Ovalentaria | | scientific name -1489908 | Stiassnyiformes | | synonym -1489910 | Cichlomorphae | | scientific name -1489911 | Cichliformes | | scientific name -1489911 | Pholidichthyiformes | | in-part -1489911 | cichlids and convict blennies | | genbank common name -1489922 | Eupercaria | | scientific name -1489922 | Percomorpharia | | synonym -1489943 | Serranoidei | | scientific name -1497848 | Papaya meleira virus | | scientific name -1503289 | BtMr-AlphaCoV/SAX2011 | | scientific name -1503291 | BtNv-AlphaCoV/SC2013 | | scientific name -1503292 | BtRf-AlphaCoV/HuB2013 | | scientific name -1503293 | BtRf-AlphaCoV/YN2012 | | scientific name -1503305 | Buddleja albiflora | | scientific name -1503305 | Buddleja albiflora Hemsl., 1889 | | authority -1504569 | Fox fecal rhabdovirus | | scientific name -1504732 | Hollyhock yellow vein mosaic Islamabad virus | | scientific name -1505891 | Epinephelini | | scientific name -1506574 | Parvovirus | | equivalent name -1506574 | Parvoviruses | | equivalent name -1506574 | Protoparvovirus | | scientific name -1507401 | Bocaparvovirus | | scientific name -1507401 | Bocavirus | | equivalent name -1507402 | unclassified Bocaparvovirus | | scientific name -1507402 | unclassified Bocavirus | | equivalent name -1507725 | Chilli leaf curl India alphasatellite | | scientific name -1510155 | FaHV-1 | | acronym -1510155 | Falconid herpesvirus 1 | | scientific name -1511771 | Avisivirus | | scientific name -1511775 | Gallivirus | | scientific name -1511778 | Mischivirus | | scientific name -1511779 | Mischivirus A | | scientific name -1511782 | Pasivirus | | scientific name -1511783 | Pasivirus A | | scientific name -1511784 | Pasivirus A1 | | scientific name -1511784 | Swine parecho sister-clade virus 1 | | equivalent name -1511784 | Swine pasivirus 1 | | equivalent name -1511804 | Rosavirus | | scientific name -1511809 | Betacryptovirus | | equivalent name -1511809 | Betapartitivirus | | scientific name -1511809 | Cryptovirus | | equivalent name -1511809 | Partitivirus | Partitivirus | in-part -1511809 | White clover cryptic virus 2 group | | equivalent name -1511810 | Alphacryptovirus | Alphacryptovirus | in-part -1511810 | Deltapartitivirus | | scientific name -1511860 | Amalgaviridae | | scientific name -1511911 | Tetraparvovirus | | scientific name -1513238 | Dyokappapapillomavirus | | scientific name -1513243 | Dyopipapillomavirus | | scientific name -1513244 | Dyorhopapillomavirus | | scientific name -1513246 | Dyoxipapillomavirus | | scientific name -1513252 | Dyopipapillomavirus 1 | | scientific name -1513253 | Dyorhopapillomavirus 1 | | scientific name -1513256 | Gammapapillomavirus 11 | | scientific name -1513256 | Human papillomavirus 126-like viruses | | equivalent name -1513260 | Gammapapillomavirus 15 | | scientific name -1513261 | Gammapapillomavirus 16 | | scientific name -1513262 | Gammapapillomavirus 17 | | scientific name -1513263 | Gammapapillomavirus 18 | | scientific name -1513265 | Gammapapillomavirus 20 | | scientific name -1513273 | Xipapillomavirus 2 | | scientific name -1513275 | Upsilonpapillomavirus 3 | | scientific name -1513294 | Nyamiviridae | | scientific name -1513308 | Velarivirus | | scientific name -1520881 | OSLEUM clade | | scientific name -1529392 | Caprine parainfluenza virus 3 | | scientific name -1534549 | unclassified Gallivirus | | scientific name -1535266 | Sida yellow vein mosaic alphasatellite | | scientific name -1537102 | Babesia equi WA | | synonym -1537102 | Babesia equi strain WA | | synonym -1537102 | Theileria equi strain WA | | scientific name -1537975 | Kumasi rhabdovirus | | scientific name -1538075 | Malasseziomycetes | | scientific name -1538075 | Malasseziomycetes Denchev & T. Denchev, 2014 | | authority -1542665 | Mesta yellow vein mosaic virus alphasatellite | | scientific name -1542744 | Gemycircularvirus | | scientific name -1542744 | Gemycircularvirus group | | equivalent name -1548713 | Orthobornavirus alphapsittaciforme | | scientific name -1548713 | Psittaciform 1 bornavirus | | equivalent name -1548713 | Psittaciform 1 orthobornavirus | | equivalent name -1548718 | PaBV-4 | | acronym -1548718 | Parrot bornavirus 4 | | scientific name -1548720 | Orthobornavirus serini | | scientific name -1548720 | Passeriform 1 bornavirus | | equivalent name -1548720 | Passeriform 1 orthobornavirus | | equivalent name -1548722 | Orthobornavirus avisaquaticae | | scientific name -1548722 | Waterbird 1 bornavirus | | equivalent name -1548722 | Waterbird 1 orthobornavirus | | equivalent name -1549198 | Conurus rupicola rupicola | | synonym -1549198 | Conurus rupicola rupicola Tschudi, 1844 | | authority -1549198 | Pyrrhura rupicola rupicola | | scientific name -1549198 | Pyrrhura rupicola rupicola (Tschudi, 1844) | | authority -1549675 | Galloanserae | | scientific name -1549675 | Galloanseri | | synonym -1549675 | ducks, geese, chickens, fowl, quail, currasows and allies | | common name -1549864 | TiLV | | acronym -1549864 | Tilapia lake virus | | scientific name -1550518 | Koolpinyah virus | | scientific name -1554466 | Aegosoma | | scientific name -1562068 | Norway rat rosavirus | | scientific name -1563660 | Sucra jujuba nucleopolyhedrovirus | | scientific name -1563660 | Sucra jujube nucleopolyhedrovirus | | equivalent name -1565088 | Colletotrichum higginsianum non-segmented dsRNA virus 1 | | scientific name -1566705 | Aphalaridae | | scientific name -1566718 | Lanthanaphalara | | scientific name -1567544 | CBS 144400 | CBS 144400 | type material -1567544 | CBS-144400 | CBS-144400 | type material -1567544 | CBS144400 | CBS144400 | type material -1567544 | CBS:144400 | CBS:144400 | type material -1567544 | Fusarium sp. ML-2014i | | includes -1567544 | Fusarium tjaetaba | | scientific name -1567544 | Fusarium tjaetaba T.T.H. Vu, J.L. Walsh, M.H. Laurence, L.W. Burgess, E.C.Y. Liew & Summerell, 2016 | | authority -1567544 | NRRL 66243 | NRRL 66243 | type material -1567544 | NRRL-66243 | NRRL-66243 | type material -1567544 | NRRL66243 | NRRL66243 | type material -1567544 | NRRL:66243 | NRRL:66243 | type material -1567544 | RBG 5361 | RBG 5361 | type material -1567544 | RBG-5361 | RBG-5361 | type material -1567544 | RBG5361 | RBG5361 | type material -1567544 | RBG:5361 | RBG:5361 | type material -1569052 | Elderberry carlavirus A | | scientific name -1569053 | Elderberry carlavirus B | | scientific name -1569054 | Elderberry carlavirus C | | scientific name -1569055 | Elderberry carlavirus D | | scientific name -1569056 | Elderberry carlavirus E | | scientific name -1569258 | Walkabout Creek virus | | scientific name -1573459 | Rosellinia necatrix partitivirus 6 | | scientific name -1577137 | Suffolk virus | | scientific name -1585420 | Liviidae | | scientific name -1592764 | Cyclovirus TsCyV-1_JP-NUBS-2014 | | scientific name -1602124 | Cymbidium chlorotic mosaic virus | | scientific name -1603563 | Human astrovirus 3a | | scientific name -1603564 | Human astrovirus 1b | | scientific name -1604871 | Yak enterovirus | | scientific name -1604875 | OraPyV-Pi | | acronym -1604875 | Sumatran orang-utan polyomavirus | | scientific name -1606764 | unclassified Aphthovirus | | scientific name -1606765 | Bovine rhinovirus 1 | | scientific name -1608041 | Bole Tick Virus 2 | | scientific name -1608042 | Bole Tick Virus 3 | | scientific name -1608044 | Changping Tick Virus 2 | | scientific name -1608045 | Changping Tick Virus 3 | | scientific name -1608047 | Huangpi Tick Virus 1 | | scientific name -1608048 | Huangpi Tick Virus 2 | | scientific name -1608049 | Huangpi Tick Virus 3 | | scientific name -1608058 | Lishi Spider Virus 2 | | scientific name -1608060 | Sanxia Water Strider Virus 1 | | scientific name -1608063 | Sanxia water strider virus 4 | | scientific name -1608063 | SxWSV-4 | | acronym -1608064 | Sanxia Water Strider Virus 5 | | scientific name -1608065 | Shayang Fly Virus 1 | | scientific name -1608066 | Shayang Fly Virus 2 | | scientific name -1608067 | Shayang Fly Virus 3 | | scientific name -1608068 | Shayang Spider Virus 1 | | scientific name -1608072 | Shuangao Bedbug Virus 2 | | scientific name -1608075 | Shuangao Insect Virus 1 | | scientific name -1608083 | Tacheng Tick Virus 1 | | scientific name -1608085 | Tacheng Tick Virus 3 | | scientific name -1608086 | Tacheng Tick Virus 4 | | scientific name -1608087 | Tacheng Tick Virus 5 | | scientific name -1608088 | Tacheng Tick Virus 6 | | scientific name -1608088 | TcTV-6 | | acronym -1608089 | Tacheng Tick Virus 7 | | scientific name -1608090 | Taishun Tick Virus | | scientific name -1608091 | Wenzhou Crab Virus 1 | | scientific name -1608093 | Wenzhou Crab Virus 3 | | scientific name -1608094 | Wenzhou Tick Virus | | scientific name -1608095 | Wenzhou Shrimp Virus 1 | | scientific name -1608097 | Wuchang Cockroach Virus 1 | | scientific name -1608100 | Wuhan Ant Virus | | scientific name -1608101 | Wuhan Fly Virus 1 | | scientific name -1608102 | Wuhan Fly Virus 2 | | scientific name -1608104 | Wuhan House Fly Virus 1 | | scientific name -1608105 | Wuhan House Fly Virus 2 | | scientific name -1608107 | Wuhan Insect virus 2 | | scientific name -1608109 | Wuhan Insect virus 4 | | scientific name -1608110 | Wuhan Insect virus 5 | | scientific name -1608111 | Wuhan Insect virus 6 | | scientific name -1608112 | Wuhan Insect virus 7 | | scientific name -1608114 | Wuhan Louse Fly Virus 10 | | scientific name -1608119 | Wuhan Louse Fly Virus 5 | | scientific name -1608123 | Wuhan Louse Fly Virus 9 | | scientific name -1608126 | Wuhan mosquito virus 1 | | scientific name -1608127 | Wuhan Mosquito Virus 2 | | scientific name -1608133 | Wuhan Mosquito Virus 8 | | scientific name -1608134 | Wuhan Mosquito Virus 9 | | scientific name -1608137 | Wuhan Tick Virus 1 | | scientific name -1608138 | Wuhan tick virus 2 | | scientific name -1608139 | Wuhan horsefly Virus | | scientific name -1608141 | Xincheng Mosquito Virus | | scientific name -1608144 | Yichang Insect virus | | scientific name -1608146 | Yongjia Tick Virus 2 | | scientific name -1608533 | Camponotus yamaokai virus | | scientific name -1609290 | Tomato leaf curl Pakistan betasatellite | | scientific name -1609290 | Tomato leaf curl Pakistan virus betasatellite | | equivalent name -1609290 | Tomato leaf curl Pakistan virus satellite DNA beta | | equivalent name -1611877 | Adana virus | | scientific name -1615583 | Vesivirus ferret badger/JX12/China/2012 | | scientific name -1615758 | Tofla virus | | scientific name -1620892 | Inhangapi virus | | scientific name -1622024 | Desmodus rotundus endogenous retrovirus | | scientific name -1628834 | Porcine kobuvirus JS-01-CHN/2013/China | | scientific name -1628834 | Porcine kobuvirus/JS-01-CHN/2013/China | | equivalent name -1629665 | Botrytis cinerea mitovirus 2 | | scientific name -1629666 | Botrytis cinerea mitovirus 3 | | scientific name -1629667 | Botrytis cinerea mitovirus 4 | | scientific name -1629671 | Botrytis cinerea negative-stranded RNA virus 1 | | scientific name -1631554 | Bovine nidovirus TCH5 | | scientific name -1634381 | Sheep polyomavirus 1 | | scientific name -1639119 | Plasmodiidae | | scientific name -1639119 | Plasmodiidae Mesnil, 1903 | | authority -1640277 | Grapevine Cabernet Sauvignon reovirus | | scientific name -1640277 | Grapevine reovirus LV89-15 | | equivalent name -1642018 | Cherax quadricarinatus densovirus | | scientific name -1642515 | Zebra finch circovirus | | scientific name -1646350 | Trichomonas vaginalis virus dsRNA satellite S1 | | scientific name -1647924 | Human papillomavirus KC5 | | scientific name -1648004 | Bambusinae | | scientific name -1648004 | Bambusinae J.Presl, 1830 | | authority -1648008 | Chusqueinae | | scientific name -1648008 | Chusqueinae Soderstr. & R.P.Ellis, 1987 | | authority -1648023 | Parianinae | | scientific name -1648023 | Parianinae Hack., 1887 | | authority -1648033 | Andropogonodae | | scientific name -1648033 | Andropogonodae L.Liu, 1980 | | authority -1648035 | Bambusodae | | scientific name -1648035 | Bambusodae L.Liou, 1980 | | authority -1648036 | Panicodae | | scientific name -1648036 | Panicodae L.Liou, 1980 | | authority -1648037 | Poodae | | scientific name -1648037 | Poodae L.Liu, 1980 | | authority -1648481 | Antarctic picorna-like virus 1 | | scientific name -1648482 | Antarctic picorna-like virus 2 | | scientific name -1648483 | Antarctic picorna-like virus 3 | | scientific name -1648484 | Antarctic picorna-like virus 4 | | scientific name -1652080 | Poeae Chloroplast Group 1 (Aveneae type) | | scientific name -1653394 | Mammarenavirus | | scientific name -1653395 | Reptarenavirus | | scientific name -1654339 | Sclerotinia sclerotiorum botybirnavirus 1 | | scientific name -1654355 | Kilifi Virus | | scientific name -1654357 | La Jolla virus | | scientific name -1654603 | Areca palm velarivirus 1 | | scientific name -1655644 | Parabacteroides distasonis phage YZ-2015a | | equivalent name -1655644 | Parabacteroides phage YZ-2015a | | scientific name -1655645 | Parabacteroides merdae prophage YZ-2015b | | equivalent name -1655645 | Parabacteroides phage YZ-2015b | | scientific name -1655646 | Gokushovirinae Bog1183_53 | | scientific name -1655647 | Microviridae Bog1249_12 | | scientific name -1655648 | Microviridae Bog5275_51 | | scientific name -1655649 | Gokushovirinae Bog5712_52 | | scientific name -1655650 | Gokushovirinae Bog8989_22 | | scientific name -1655651 | Microviridae Bog9017_22 | | scientific name -1655652 | Microviridae Fen2266_11 | | scientific name -1655653 | Microviridae Fen418_41 | | scientific name -1655654 | Microviridae Fen4707_41 | | scientific name -1655655 | Microviridae Fen51_42 | | scientific name -1655656 | Gokushovirinae Fen672_31 | | scientific name -1655657 | Microviridae Fen685_11 | | scientific name -1655658 | Microviridae Fen7786_21 | | scientific name -1655659 | Gokushovirinae Fen7875_21 | | scientific name -1655660 | Microviridae Fen7895_21 | | scientific name -1655661 | Microviridae Fen7918_21 | | scientific name -1655662 | Microviridae Fen7940_21 | | scientific name -1658615 | PBJV | PBJV | acronym -1658615 | Pebjah virus | | scientific name -1659219 | Kobuvirus cattle/Kagoshima-2-24-KoV/2015/JPN | | scientific name -1659220 | Kagovirus 1 | | equivalent name -1659220 | Kobuvirus cattle/Kagoshima-1-22-KoV/2014/JPN | | scientific name -1661062 | Sclerotinia sclerotiorum fusarivirus 1 | | scientific name -1661062 | SsFV1 | | acronym -1661063 | Fusariviridae | | scientific name -1661392 | Victorian trout aquabirnavirus | | scientific name -1661395 | Ampivirus A1 | | scientific name -1661396 | Magnaporthe oryzae virus 3 | | scientific name -1662272 | Dromedary astrovirus | | scientific name -1662272 | Dromedary camel astrovirus | | equivalent name -1662286 | Marbled eel polyomavirus | | scientific name -1662286 | Marbled eel virus | | equivalent name -1662464 | unclassified Megabirnavirus | | scientific name -1663127 | Posavirus 3 | | scientific name -1663197 | Gnathopogon imberbis taeniellus | | synonym -1663197 | Gnathopogon taeniellus | | scientific name -1663197 | Gnathopogon taeniellus (Nichols, 1925) | | authority -1663197 | Leucogobio taeniellus | | synonym -1663197 | Leucogobio taeniellus Nichols, 1925 | | authority -1667384 | PoLVd | | acronym -1667384 | Portulaca latent viroid | | scientific name -1667587 | Papio ursinus cytomegalovirus | | scientific name -1670662 | Bearded dragon parvovirus | | scientific name -1670669 | Lutzomyia reovirus 1 | | scientific name -1670973 | Gyrovirus GyV8 | | scientific name -1670975 | Ustilaginoidea virens unassigned RNA virus HNND-1 | | scientific name -1671382 | Astrovirus Er/SZAL6/HUN/2011 | | scientific name -1675862 | Diatraea saccharalis granulovirus | | scientific name -1675864 | Opsiphanes invirae iflavirus 1 | | scientific name -1675865 | Perigonia lusca single nucleopolyhedrovirus | | scientific name -1675866 | Urbanus proteus nucleopolyhedrovirus | | scientific name -1676181 | Chimpanzee faeces associated microphage 1 | | scientific name -1676183 | Chimpanzee faeces associated microphage 3 | | scientific name -1676267 | Rosellinia necatrix megabirnavirus 2-W8 | | scientific name -1678003 | Chilli leaf curl Ahmedabad virus-India [India/Ahmedabad/2014] | | scientific name -1678042 | Isophya major | | scientific name -1678042 | Isophya major Brunner von Wattenwyl, 1878 | | authority -1678146 | Chirohepevirus eptesici | | scientific name -1678146 | Orthohepevirus D | | equivalent name -1679172 | Chobar Gorge virus | | scientific name -1679238 | Fusarium oxysporum f. sp. dianthi mycovirus 1 | | scientific name -1679933 | Rattus norvegicus polyomavirus 1 | | scientific name -1680130 | unclassified Endornaviridae | | scientific name -1680130 | unclassified Endornavirus | | equivalent name -1681229 | Blastomyces gilchristii | | scientific name -1681229 | Blastomyces gilchristii Eliz.M. Brown, L.R. McTaggart, Sean X. Zhang, D.E. Low, D.A. Stevens & S.E. Richardson, 2013 | | authority -1681229 | CBS 134223 | CBS 134223 | type material -1681229 | PHO TB00018 | PHO TB00018 | type material -1681229 | TB00018 2005 | TB00018 2005 | type material -1682186 | Bee Macula-like virus | | scientific name -1682187 | Varroa Tymo-like virus | | scientific name -1682340 | Human papillomavirus 201 | | scientific name -1682340 | Human papillomavirus type 201 | | equivalent name -1685502 | Pseudogymnoascus destructans partitivirus-pa | | scientific name -1685502 | Pseudogymnoascus destructans virus | | equivalent name -1685755 | Lake Sarah-associated circular virus-28 | | scientific name -1685953 | Macrosiphum euphorbiae virus 1 | | scientific name -1688637 | Lettuce Italian necrotic virus | | scientific name -1690666 | Bombyx mori iflavirus | | scientific name -1690672 | White sucker hepadnavirus | | equivalent name -1690672 | White sucker hepatitis B virus | | scientific name -1692045 | Tobacco virus 1 | | scientific name -1692107 | Fengkai orbivirus | | scientific name -1692242 | Aiptasia sp. sea anemone associated circular virus | | scientific name -1692243 | Artemia melana sponge associated circular genome | | scientific name -1692244 | Calanoida sp. copepod associated circular virus | | scientific name -1692245 | Callinectes ornatus blue crab associated circular virus | | scientific name -1692246 | Callinectes sapidus associated circular virus | | scientific name -1692247 | Didemnum sp. Sea Squirt associated virus | | scientific name -1692248 | Farfantepenaeus duorarum pink shrimp associated circular virus | | scientific name -1692249 | Fiddler Crab associated circular virus | | scientific name -1692250 | Gammarus sp. amphipod associated circular virus | | scientific name -1692251 | Hermit crab associated circular genome | | scientific name -1692252 | Hermit crab associated circular virus | | scientific name -1692253 | Littorina sp. associated circular virus | | scientific name -1692254 | Lytechinus variegatus variable sea urchin associated circular virus | | scientific name -1692255 | Marine snail associated circular virus | | scientific name -1692256 | Mytilus sp. clam associated circular virus | | scientific name -1692257 | Palaemonetes intermedius brackish grass shrimp associated circular virus | | scientific name -1692258 | Palaemonetes kadiakensis Mississippi grass shrimp associated circular virus | | scientific name -1692259 | Palaemonetes sp. common grass shrimp associated circular virus | | scientific name -1692260 | Paramuricea placomus associated circular virus | | scientific name -1692261 | Petrochirus diogenes giant hermit crab associated circular virus | | scientific name -1692262 | Primnoa pacifica coral associated circular virus | | scientific name -1692263 | Sicyonia brevirostris associated circular virus | | scientific name -1699094 | Poecile atricapillus GI tract-associated gemycircularvirus | | scientific name -1701404 | Gokushovirinae GAIR4 | | scientific name -1701405 | Gokushovirinae GNX3R | | scientific name -1705090 | Luffa begomovirus betasatellite | | scientific name -1705091 | Malachra yellow vein mosaic betasatellite | | scientific name -1705092 | Ageratum conyzoides symptomless alphasatellite | | scientific name -1705297 | Ageratum yellow vein virus-Malaysia [Malaysia-Tomato Leaf curl-2011] | | equivalent name -1705297 | Ageratum yellow vein virus-[Malaysia-Tomato Leaf curl-2011] | | scientific name -1705841 | Iodes cirrhosa | | scientific name -1705841 | Iodes cirrhosa Turcz., 1855 | | authority -1708248 | Aster procerus | | scientific name -1708248 | Aster procerus Hemsl., 1888 | | authority -1708572 | Phopivirus | | equivalent name -1708572 | hepatovirus B1 | | scientific name -1708653 | Gemycircularvirus gemy-ch-rat1 | | scientific name -1708712 | Rosellinia necatrix endornavirus 1 | | scientific name -1711684 | HPEV | | acronym -1711684 | Hot pepper alphaendornavirus | | scientific name -1711684 | Hot pepper endornavirus | | equivalent name -1711685 | Atractylodes mild mottle virus | | scientific name -1712570 | Kasokero virus | | scientific name -1712572 | Yogue virus | | scientific name -1714362 | Red clover powdery mildew-associated totivirus 1 | | scientific name -1714363 | Red clover powdery mildew-associated totivirus 2 | | scientific name -1714364 | Red clover powdery mildew-associated totivirus 3 | | scientific name -1714366 | Red clover powdery mildew-associated totivirus 5 | | scientific name -1714367 | Red clover powdery mildew-associated totivirus 6 | | scientific name -1714368 | Red clover powdery mildew-associated totivirus 7 | | scientific name -1714370 | Red clover powdery mildew-associated totivirus 9 | | scientific name -1714570 | Blueberry shoestring virus | | scientific name -1714618 | unclassified Hepatovirus | | scientific name -1715288 | Avian bornavirus C1 | | equivalent name -1715288 | Canary bornavirus 1 | | scientific name -1715288 | CnBV-1 | | acronym -1720595 | Bellflower vein chlorosis virus | | scientific name -1721090 | Tasmanian aquabirnavirus | | scientific name -1723728 | unassigned Polyomaviridae | | equivalent name -1723728 | unclassified Polyomaviridae | | scientific name -1725329 | Potato necrosis virus | | scientific name -1729112 | Passerellidae | | scientific name -1729112 | Passerellidae (Cabanis and Heine 1850) | | authority -1729141 | Human pegivirus 2 | | scientific name -1729670 | Maize associated totivirus 1 | | equivalent name -1729670 | Maize-associated totivirus 1 | | scientific name -1736759 | Chayote yellow mosaic Benin betasatellite | | scientific name -1737345 | Grapevine latent viroid | | scientific name -1737346 | Apple hammerhead viroid-like circular RNA | | scientific name -1737522 | Bank vole polyomavirus | | scientific name -1737523 | Common vole polyomavirus | | scientific name -1738045 | Andrographis yellow vein leaf curl virus | | equivalent name -1738045 | Begomovirus andrographis | | scientific name -1742594 | Melochia mosaic virus | | scientific name -1742595 | Melochia yellow mosaic virus | | scientific name -1742596 | PavYMV | | acronym -1742596 | Pavonia yellow mosaic virus | | scientific name -1743411 | Gorilla anellovirus | | scientific name -1746057 | Beihai barnacle viurs 1 | | scientific name -1746058 | Bole tick virus 4 | | scientific name -1746059 | Gamboa mosquito virus | | scientific name -1746060 | Sanxia water strider virus 6 | | scientific name -1746061 | Shayang fly virus 4 | | scientific name -1746062 | Shayang spider virus 4 | | scientific name -1746063 | Shuangao insect virus 7 | | scientific name -1746064 | Shuangao lacewing virus 2 | | scientific name -1746065 | Tacheng tick virus 8 | | scientific name -1746066 | Wenling shark virus | | scientific name -1746067 | Wuhan aphid virus 1 | | scientific name -1746068 | Wuhan aphid virus 2 | | scientific name -1746069 | Wuhan centipede virus | | scientific name -1746070 | Wuhan cricket virus | | scientific name -1746071 | Wuhan flea virus | | scientific name -1746072 | Xingshan cricket virus | | scientific name -1746073 | Xinzhou spider virus 2 | | scientific name -1746074 | Xinzhou spider virus 3 | | scientific name -1747648 | unclassified Betapartitivirus | | scientific name -1755198 | Parthenium leaf curl alphasatellite | | scientific name -1755467 | Penicillium aurantiogriseum totivirus 1 | | scientific name -1755752 | Penicillium aurantiogriseum fusarivirus 1 | | scientific name -1755785 | Pleospora typhicola fusarivirus 1 | | scientific name -1755792 | Penicillium janczewskii chrysovirus 1 | | scientific name -1756157 | Penicillium aurantiogriseum partitivirus 1 | | scientific name -1756191 | Megabat bufavirus 1 | | scientific name -1756445 | Rattus norvegicus papillomavirus 3 | | scientific name -1756615 | Ustilaginoidea virens RNA virus 5 | | scientific name -1757958 | Hydrobates tethys kelsalli | | synonym -1757958 | Hydrobates tethys kelsalli (Lowe, PR, 1925) | | authority -1757958 | Oceanodroma tethys kelsalli | | scientific name -1757958 | Oceanodroma tethys kelsalli (Lowe, 1925) | | authority -1757958 | Thalassidroma tethys kelsalli | | synonym -1757958 | Thalassidroma tethys kelsalli Lowe, 1925 | | authority -1758139 | CPSbV | | acronym -1758139 | Colombian potato soil-borne virus | | scientific name -1758883 | Imjin River virus 1 | | scientific name -1761477 | Tomato brown rugose fruit virus | | scientific name -1762023 | Pan troglodytes verus polyomavirus 8 | | scientific name -1763507 | Rat bufavirus SY-2015 | | scientific name -1764085 | Toros virus | | scientific name -1764086 | Zerdali virus | | scientific name -1765736 | Nigrospora oryzae victorivirus 1 | | scientific name -1765754 | Camponotus nipponicus virus | | scientific name -1766554 | Swine enteric coronavirus | | scientific name -1766557 | Gallivirus Pf-CHK1/GV | | scientific name -1766559 | Avisivirus Pf-CHK1/AsV | | scientific name -1766828 | Turnip leaf roll virus | | scientific name -1768064 | Tupaia hepatovirus A | | scientific name -1768874 | Sinapis alba cryptic virus 1 | | scientific name -1769780 | Anopheles C virus | | scientific name -1769949 | Rabbit bocaparvovirus | | scientific name -1770265 | Alfalfa dwarfism associated virus | | equivalent name -1770265 | Alfalfa enamovirus 1 | | equivalent name -1770265 | Alfalfa enamovirus-1 | | equivalent name -1770265 | Enamovirus AEV | | scientific name -1770613 | Thelephora terrestris virus 1 | | scientific name -1770617 | unclassified Capillovirus | | scientific name -1770618 | Currant virus A | | scientific name -1774200 | Pepper yellow leaf curl Thailand virus | | scientific name -1774200 | Pepper yellow leaf curl virus-Thailand | | equivalent name -1774276 | Hordeum vulgare alphaendornavirus | | scientific name -1774276 | Hordeum vulgare endornavirus | | equivalent name -1775963 | Jasmine potyvirus T | | equivalent name -1775963 | Jasmine ringspot virus | | equivalent name -1775963 | Jasmine virus T | | scientific name -1776109 | Goose dicistrovirus | | scientific name -1776153 | Diaphorina citri densovirus | | scientific name -1776177 | Cucumis melo alphaendornavirus | | scientific name -1776177 | Cucumis melo endornavirus | | equivalent name -1777015 | Erysiphe cichoracearum alphaendornavirus | | scientific name -1777015 | Erysiphe cichoracearum endornavirus | | equivalent name -1777016 | Panax notoginseng virus A | | scientific name -1778558 | Ctenophore-associated circular virus 1 | | scientific name -1778559 | Ctenophore-associated circular virus 2 | | scientific name -1778560 | Ctenophore-associated circular virus 3 | | scientific name -1778561 | Ctenophore-associated circular virus 4 | | scientific name -1778570 | Ctenophore-associated circular genome 1 | | scientific name -1778571 | Ctenophore-associated circular genome 2 | | scientific name -1778572 | Ctenophore-associated circular genome 3 | | scientific name -1778573 | Ctenophore-associated circular genome 4 | | scientific name -1778580 | Nectarine marafivirus M | | scientific name -1778580 | Nectarine virus M | | equivalent name -1779340 | Phomopsis longicolla RNA virus 1 | | scientific name -1780507 | Myotis gammaherpesvirus 8 | | scientific name -1781241 | Delisea pulchra RNA virus | | scientific name -1788315 | Rat bocavirus | | scientific name -1792583 | Tobacco mosqueado virus | | scientific name -1795648 | Picornavirales Tottori-HG1 | | scientific name -1798085 | Piscine myocarditis-like virus | | scientific name -1802790 | Icacinales | | scientific name -1802790 | Icacinales Tiegh. ex Tiegh., 1993 | | authority -1803898 | Pepper virus A | | scientific name -1804153 | Marine RNA virus PAL128 | | scientific name -1804154 | Marine RNA virus PAL156 | | scientific name -1804156 | Marine RNA virus PAL473 | | scientific name -1804622 | Suaedoideae | | scientific name -1804623 | Chenopodiaceae | | scientific name -1804623 | Chenopodiaceae Vent., 1799 | | authority -1804623 | goosefoot family | | common name -1805494 | Bamaga virus | | scientific name -1809242 | unclassified Flexiviridae | | equivalent name -1809242 | unclassified Tymovirales | | scientific name -1809767 | Ixeridium yellow mottle virus 1 | | scientific name -1811230 | Callinectes sapidus reovirus 1 | | scientific name -1811408 | Privet leaf blotch-associated virus | | scientific name -1812179 | Bovine calicivirus strain Kirklareli | | scientific name -1812308 | Deinbollia mosaic virus | | scientific name -1812308 | East African cassava mosaic-like virus | | equivalent name -1813613 | Picornavirales Bu-3 | | scientific name -1813615 | Picornavirales Bu-1 | | scientific name -1815581 | Grapevine leafroll-associated virus 13 | | scientific name -1816484 | Cronartium ribicola mitovirus 1 | | scientific name -1816485 | Cronartium ribicola mitovirus 2 | | scientific name -1816486 | Cronartium ribicola mitovirus 3 | | scientific name -1816487 | Cronartium ribicola mitovirus 4 | | scientific name -1816488 | Cronartium ribicola mitovirus 5 | | scientific name -1817526 | Ixeridium yellow mottle virus 2 | | scientific name -1819678 | Cucurbit yellow mosaic alphasatellite | | scientific name -1820326 | Avian paramyxovirus 13 goose/Kazakhstan/5751/2013 | | scientific name -1821222 | Culiseta flavivirus | | scientific name -1821227 | Xishuangbanna aedes flavivirus | | scientific name -1822365 | BoRV-CH15 | | acronym -1822365 | Bovine betaretrovirus CH15 | | equivalent name -1822365 | Bovine retrovirus CH15 | | scientific name -1823757 | Kafue kinda chacma baboon virus | | scientific name -1823757 | Kafue kinda x chacma baboon virus | | equivalent name -1825924 | Barley virus G | | scientific name -1825931 | Tomato yellow leaf curl Shuangbai virus - [Y4536] | | scientific name -1826059 | Enterovirus SEV-gx | | scientific name -1826822 | Alternaria arborescens mitovirus 1 | | scientific name -1833824 | Maize yellow dwarf virus-RMV2 | | scientific name -1833938 | Penicillium digitatum virus 1 | | scientific name -1837089 | Rhizoctonia oryzae-sativae mitovirus 1 | | scientific name -1840528 | Sclerotinia sclerotiorum mycoreovirus 4 | | scientific name -1841147 | Bhindi yellow vein alphasatellite | | scientific name -1843734 | Faeces associated gemycircularvirus 14 | | scientific name -1843734 | Faeces associated gemycircularvirus-14 | | equivalent name -1843735 | Faeces associated gemycircularvirus 15 | | scientific name -1843735 | Faeces associated gemycircularvirus-15 | | equivalent name -1843736 | Faeces associated gemycircularvirus 16 | | scientific name -1843736 | Faeces associated gemycircularvirus-16 | | equivalent name -1843737 | Faeces associated gemycircularvirus 17 | | scientific name -1843737 | Faeces associated gemycircularvirus-17 | | equivalent name -1843738 | Faeces associated gemycircularvirus 18 | | scientific name -1843738 | Faeces associated gemycircularvirus-18 | | equivalent name -1843739 | 49 Fec80061 pig | | acronym -1843739 | Faeces associated gemycircularvirus 19 | | scientific name -1843739 | Faeces associated gemycircularvirus-19 | | equivalent name -1843740 | Faeces associated gemycircularvirus 20 | | scientific name -1843740 | Faeces associated gemycircularvirus-20 | | equivalent name -1843742 | Faeces associated gemycircularvirus 22 | | scientific name -1843742 | Faeces associated gemycircularvirus-22 | | equivalent name -1843761 | Faecal-associated gemycircularvirus-23 | | equivalent name -1843761 | Sewage associated gemycircularvirus 3 | | scientific name -1843761 | Sewage associated gemycircularvirus-3 | | equivalent name -1843761 | Sewage-associated gemycircularvirus 3 | | equivalent name -1843761 | Sewage-associated gemycircularvirus-3 | | equivalent name -1843773 | Porcine associated stool circular virus | | equivalent name -1843773 | Porcine stool-associated circular virus | | scientific name -1844928 | Avian-like circovirus | | scientific name -1848040 | Water chestnut soymovirus 1 | | scientific name -1848042 | Fusarium poae dsRNA virus 2 | | scientific name -1848150 | Fusarium poae mitovirus 1 | | scientific name -1848151 | Fusarium poae mitovirus 2 | | scientific name -1848152 | Fusarium poae mitovirus 3 | | scientific name -1848153 | Fusarium poae mitovirus 4 | | scientific name -1848169 | Fusarium poae dsRNA virus 3 | | scientific name -1849328 | Enterovirus goat/JL14 | | scientific name -1849531 | Fusarium poae narnavirus 1 | | scientific name -1849532 | Fusarium poae narnavirus 2 | | scientific name -1849533 | Fusarium poae partitivirus 2 | | scientific name -1849534 | Fusarium poae virus 1-240374 | | scientific name -1849535 | Fusarium poae victorivirus 1 | | scientific name -1849537 | Fusarium poae fusarivirus 1 | | scientific name -1849542 | Fusarium poae mycovirus 1 | | scientific name -1849543 | Fusarium poae mycovirus 2 | | scientific name -1849544 | Fusarium poae negative-stranded virus 1 | | scientific name -1849545 | Fusarium poae negative-stranded virus 2 | | scientific name -1850906 | Catopsilia pomona nucleopolyhedrovirus | | scientific name -1853762 | Jasmine virus C | | scientific name -1853865 | EcmLV | | acronym -1853865 | Euphorbia caput-medusae latent virus | | scientific name -1856030 | Golden shiner totivirus | | scientific name -1856031 | Pecan mosaic-associated virus | | scientific name -1856627 | Phytomonas serpens narnavirus 1 | | scientific name -1856627 | PserNV1 | | acronym -1856642 | Maize yellow mosaic virus | | scientific name -1857323 | Tospovirus kiwifruit/YXW/2014 | | scientific name -1859149 | Torque teno mini virus 18 | | scientific name -1859161 | Sclerotinia nivalis victorivirus 1 | | scientific name -1862127 | Wild onion symptomless virus | | scientific name -1862824 | Gemycircularvirus HV-GcV1 | | scientific name -1862825 | Gemycircularvirus HV-GcV2 | | scientific name -1862978 | Etheostoma fonticola aquareovirus | | scientific name -1864484 | Ungulate bocaparvovirus 6 | | equivalent name -1864484 | bovine bocaparvovirus 2 | | scientific name -1868472 | Yacon virus A | | scientific name -1869931 | Evergestis extimalis | | scientific name -1869931 | Phalaena extimalis | | synonym -1869931 | Phalaena extimalis Scopoli, 1763 | | authority -1871153 | Nylanderia fulva virus 1 | | scientific name -1871631 | Rhizoctonia solani flexivirus 1 | | scientific name -1872710 | Fusarium graminearum deltaflexivirus 1 | | scientific name -1872719 | Botrytis ourmia like virus | | equivalent name -1872719 | Botrytis ourmia-like virus | | scientific name -1873455 | Atypical porcine pestivirus 1 | | scientific name -1874267 | Maize associated totivirus-2 | | equivalent name -1874267 | Maize-associated totivirus 2 | | scientific name -1874267 | Maize-associated totivirus-2 | | equivalent name -1874886 | Ramie mosaic Yunnan virus | | scientific name -1881013 | Senna mosaic virus | | scientific name -1882382 | Sea otter parvovirus 1 | | scientific name -1882732 | Corythaixoides concolor bechuanae | | scientific name -1882732 | Corythaixoides concolor bechuanae Roberts, 1932 | | authority -1884450 | Husa-like virus KS-2016a | | scientific name -1884455 | Anphevirus | | scientific name -1884456 | Arlivirus | | scientific name -1884458 | Crustavirus | | scientific name -1884460 | Anphevirus xinchengense | | scientific name -1884460 | Xincheng anphevirus | | equivalent name -1884461 | Arlivirus arachnae | | scientific name -1884461 | Lishi arlivirus | | equivalent name -1884640 | Bulleribasidiaceae | | scientific name -1884640 | Bulleribasidiaceae X.Z. Liu, F.Y. Bai, M. Groenew. & Boekhout, 2016 | | authority -1884640 | Bulleribasidiaceae Xin Zhan Liu, F.Y. Bai, M. Groenew. & Boekhout, 2015 | | authority -1884832 | Gompholobium virus A | | scientific name -1884917 | ABBV-2 | | acronym -1884917 | Aquatic bird bornavirus 2 | | scientific name -1884917 | Avian bornavirus MALL | | equivalent name -1884991 | Senna leaf curl virus | | scientific name -1885248 | VSBV-1 | | acronym -1885248 | Variegated squirrel bornavirus 1 | | scientific name -1885927 | Sparus aurata polyomavirus 1 | | scientific name -1885928 | Sparus aurata papillomavirus 1 | | scientific name -1886606 | Callistephus mottle virus | | scientific name -1887213 | Bos taurus papillomavirus 13 | | scientific name -1887213 | Bovine papillomavirus type 13 | | synonym -1887214 | Bos taurus papillomavirus 16 | | scientific name -1887215 | Bos taurus papillomavirus 17 | | scientific name -1887216 | Bos taurus papillomavirus 18 | | scientific name -1887217 | Bos taurus papillomavirus 19 | | scientific name -1887218 | Bos taurus papillomavirus 20 | | scientific name -1887219 | Bos taurus papillomavirus 21 | | scientific name -1888309 | Washington bat picornavirus | | scientific name -1888311 | Bat tymo-like virus | | scientific name -1890365 | Coccinia mottle virus | | scientific name -1890423 | Tomato yellow leaf distortion virus - Sidastrum | | scientific name -1891704 | Sophora japonica powdery mildew-associated partitivirus | | scientific name -1891713 | Alphapolyomavirus | | scientific name -1891714 | Betapolyomavirus | | scientific name -1891715 | Deltapolyomavirus | | scientific name -1891741 | Alphapolyomavirus ponabelii | | scientific name -1891741 | Pongo abelii polyomavirus 1 | | equivalent name -1895012 | Plagiorhegma | | scientific name -1895012 | Plagiorhegma Maxim., 1859 | | authority -1897087 | Mammalian 2 bornavirus | | equivalent name -1897087 | Mammalian 2 orthobornavirus | | equivalent name -1897087 | Orthobornavirus sciuri | | scientific name -1897538 | Common bean-associated gemycircularvirus | | scientific name -1897731 | Aichivirus D | | equivalent name -1897731 | Kobuvirus dekago | | scientific name -1899219 | Synedrella leaf curl virus | | scientific name -1899566 | Ligustrum virus A | | scientific name -1902501 | Rosavirus B | | scientific name -1902502 | Rosavirus C | | scientific name -1903340 | Anopheles flavivirus - variant 1 | | equivalent name -1903340 | Anopheles flavivirus variant 1 | | scientific name -1903412 | Hafniaceae | | scientific name -1903412 | Hafniaceae Adeolu et al. 2016 | | authority -1904408 | Miniopterus schreibersii polyomavirus 1 | | scientific name -1904409 | Miniopterus schreibersii polyomavirus 2 | | scientific name -1904410 | Rhinolophus hildebrandtii polyomavirus 1 | | scientific name -1904411 | Rousettus aegyptiacus polyomavirus 1 | | scientific name -1904439 | Simian retrovirus 8 | | scientific name -1904880 | Macroptilium bright mosaic virus | | scientific name -1904881 | Macroptilium common mosaic virus | | scientific name -1904882 | Sida angular mosaic virus | | scientific name -1904883 | Sida chlorotic vein virus | | scientific name -1904884 | Wissadula yellow mosaic virus | | scientific name -1906179 | Anopheles flavivirus Liberia/2013 | | scientific name -1906245 | Moku virus | | scientific name -1906317 | Grapevine geminivirus A | | scientific name -1906668 | Malvastrum bright yellow mosaic virus | | scientific name -1907771 | Parus major densovirus | | scientific name -1908665 | Myotis oxyotus gardneri | | scientific name -1908665 | Myotis oxyotus gardneri LaVal, 1973 | | authority -1908807 | Ceratobasidium endornavirus B | | scientific name -1908808 | Ceratobasidium endornavirus D | | scientific name -1908811 | Ceratobasidium endornavirus G | | scientific name -1908813 | Ceratobasidium endornavirus C | | scientific name -1910928 | Genomoviridae | | scientific name -1910929 | unclassified Gemycircularvirus | | scientific name -1910929 | unclassified Gemycircularvirus group | | equivalent name -1911602 | Pelarspovirus | | scientific name -1912919 | Isoptera | | synonym -1912919 | Termitoidae | | scientific name -1912919 | termites | termites | blast name -1912919 | termites | termites | genbank common name -1913124 | Cowpea polerovirus 1 | | scientific name -1913125 | Cowpea polerovirus 2 | | scientific name -1914295 | Prunevirus | | scientific name -1914297 | Quinvirinae | | scientific name -1914298 | Trivirinae | | scientific name -1914447 | atypical porcine pestivirus | | scientific name -1916095 | Hydrobates tethys tethys | | synonym -1916095 | Hydrobates tethys tethys (Bonaparte, 1852) | | authority -1916095 | Oceanodroma tethys tethys | | scientific name -1916095 | Oceanodroma tethys tethys (Bonaparte, 1852) | | authority -1916236 | Tobamovirus ToBRTm-2 | | equivalent name -1916236 | Tomato brown rugose fruit virus-israeli | | scientific name -1918013 | Botybirnavirus | | scientific name -1918014 | Botrytis porri RNA virus 1 | | equivalent name -1918014 | Botrytis porri botybirnavirus 1 | | scientific name -1922348 | unclassified RNA viruses ShiM-2016 | | scientific name -1922602 | Beihai picorna-like virus 57 | | scientific name -1922604 | Beihai picorna-like virus 59 | | scientific name -1922669 | Beihai shrimp virus 3 | | scientific name -1922934 | Hubei myriapoda virus 5 | | scientific name -1922938 | Hubei myriapoda virus 9 | | scientific name -1923351 | Jingmen tombus-like virus 1 | | scientific name -1923697 | Wuhan cricket virus 2 | | scientific name -1923716 | Wuhan insect virus 12 | | scientific name -1923726 | Wuhan insect virus 22 | | scientific name -1923736 | Wuhan insect virus 33 | | scientific name -1923737 | Wuhan insect virus 34 | | scientific name -1923738 | Wuhan insect virus 35 | | scientific name -1923739 | Wuhan insect virus 8 | | scientific name -1923740 | Wuhan insect virus 9 | | scientific name -1923742 | Wuhan millipede virus 3 | | scientific name -1923743 | Wuhan nido-like virus 1 | | scientific name -1923745 | Wuhan pillworm virus 2 | | scientific name -1923746 | Wuhan pillworm virus 3 | | scientific name -1923748 | Wuhan poty-like virus 1 | | scientific name -1923752 | Wuhan spider virus 3 | | scientific name -1923753 | Wuhan spider virus 4 | | scientific name -1923754 | Wuhan spider virus 5 | | scientific name -1923755 | Wuhan spider virus 6 | | scientific name -1923756 | Wuhan spider virus 7 | | scientific name -1923757 | Wuhan spider virus 8 | | scientific name -1923758 | Wuhan spider virus 9 | | scientific name -1923759 | Wuhan spirurian nematodes virus 1 | | scientific name -1923761 | Xingshan nematode virus 2 | | scientific name -1923763 | Xingshan nematode virus 4 | | scientific name -1923764 | Xingshan nematode virus 5 | | scientific name -1923765 | Xingshan nematode virus 6 | | scientific name -1923768 | Xinzhou dimarhabdovirus virus 1 | | scientific name -1923769 | Xinzhou nematode virus 1 | | scientific name -1923770 | Xinzhou nematode virus 2 | | scientific name -1923771 | Xinzhou nematode virus 3 | | scientific name -1923772 | Xinzhou nematode virus 4 | | scientific name -1923773 | Xinzhou nematode virus 5 | | scientific name -1923775 | Xinzhou nematode virus 7 | | scientific name -1923777 | Xinzhou toro-like virus | | scientific name -1923778 | Zhejiang mosquito virus 1 | | scientific name -1923781 | Ubei picorna-like virus 3 | | scientific name -1928073 | Maiestas dorsalis | | scientific name -1928073 | Maiestas dorsalis (Motschulsky, 1859) | | authority -1929150 | Enterovirus AN12 | | scientific name -1930602 | Psocodea | | scientific name -1930602 | Psocodea Hennig, 1966 | | authority -1930602 | Psocoptera | | synonym -1930602 | booklice, barklice & lice | booklice, barklice & lice | blast name -1930602 | booklice, barklice & lice | booklice, barklice & lice | genbank common name -1931113 | Pea leaf distortion betasatellite | | scientific name -1936269 | Helicoverpa armigera iflavirus | | scientific name -1938656 | Jingmen tombus-like virus 2 | | scientific name -1940252 | Cacao mild mosaic virus | | scientific name -1940555 | Murine roseolovirus | | scientific name -1941233 | Thrips-associated gemycircularvirus 1 | | equivalent name -1941233 | Thrips-associated genomovirus 1 | | scientific name -1941234 | Thrips-associated gemycircularvirus 2 | | equivalent name -1941234 | Thrips-associated genomovirus 2 | | scientific name -1941235 | unclassified Genomoviridae | | scientific name -1941236 | Gemykibivirus | | scientific name -1941237 | Thrips-associated gemykibivirus 1 | | equivalent name -1941237 | Thrips-associated genomovirus 3 | | scientific name -1941238 | Gemykolovirus | | scientific name -1941239 | Thrips-associated gemykolovirus 1 | | equivalent name -1941239 | Thrips-associated genomovirus 4 | | scientific name -1941435 | Amphibola crenata associated bacilladnavirus 1 | | scientific name -1941436 | Amphibola crenata associated bacilladnavirus 2 | | scientific name -1941437 | Avon-Heathcote estuary associated bacilladnavirus | | scientific name -1950126 | Clematis chlorotic mottle virus | | scientific name -1955054 | Tomato leaf curl Burkina Faso virus | | scientific name -1955247 | Auchenorrhyncha | | scientific name -1955493 | Orbivirus SX-2017a | | scientific name -1955730 | Peach virus D | | scientific name -1958777 | Bat sapelovirus | | scientific name -1958778 | Bat iflavirus | | scientific name -1958784 | Bat dicibavirus | | scientific name -1958957 | Cassava satellite virus | | scientific name -1959930 | Bat sapovirus | | scientific name -1961665 | Qinghai Himalayan marmot astrovirus 1 | | scientific name -1961665 | Qinghai Himalayana marmot AstV1 | | equivalent name -1961666 | Qinghai Himalayan marmot astrovirus 2 | | scientific name -1961666 | Qinghai Himalayana marmot AstV 2 | | equivalent name -1961785 | Rhopapillomavirus 2 | | scientific name -1961833 | Ceuthmochares | | scientific name -1961834 | Ceuthmochares aereus | | scientific name -1961834 | Ceuthmochares aereus (Vieillot, 1817) | | authority -1961834 | Cuculus aereus | | synonym -1961834 | Cuculus aereus Vieillot, 1817 | | authority -1963758 | Myomorpha | | scientific name -1963758 | Sciurognathi | Sciurognathi | in-part -1963758 | mice and others | | genbank common name -1964372 | Circovirus sp. | | scientific name -1965238 | Pityohyphantes rubrofasciatus iflavirus | | scientific name -1965306 | Lagenaria siceraria endornavirus-Hubei | | scientific name -1965344 | LI polyomavirus | | scientific name -1967841 | Tomato yellow mottle-associated virus | | scientific name -1970065 | Alpaca polyomavirus | | scientific name -1972572 | Cocal vesiculovirus | | equivalent name -1972572 | Vesiculovirus cocal | | scientific name -1972589 | Adelaide River ephemerovirus | | equivalent name -1972589 | Ephemerovirus adelaide | | scientific name -1972596 | Ephemerovirus koolpinyah | | scientific name -1972596 | Koolpinyah ephemerovirus | | equivalent name -1972597 | Ephemerovirus yata | | scientific name -1972597 | Yata ephemerovirus | | equivalent name -1972700 | Diamondback moth iflavirus | | scientific name -1972716 | Arracacha virus V | | scientific name -1972995 | Tobacco virus 2 | | scientific name -1973265 | WBV1 | | acronym -1973265 | Wisteria badnavirus 1 | | scientific name -1977105 | Crustavirus wenzhouense | | scientific name -1977105 | Wenzhou crustavirus | | equivalent name -1977392 | Cassava virus X | | scientific name -1978413 | Watermelon betaflexivirus 1 | | equivalent name -1978413 | Watermelon virus A | | scientific name -1978532 | Ledantevirus | | scientific name -1978539 | Ledantevirus yongjia | | scientific name -1978539 | Yongjia ledantevirus | | equivalent name -1978541 | Ledantevirus wuhan | | scientific name -1978541 | Wuhan ledantevirus | | equivalent name -1978543 | Kumasi ledantevirus | | equivalent name -1978543 | Ledantevirus kumasi | | scientific name -1978920 | Raccoon-associated polyomavirus 2 | | scientific name -1980412 | Fimoviridae | | scientific name -1980415 | Nairoviridae | | scientific name -1980416 | Bunyaviridae | | equivalent name -1980416 | Peribunyaviridae | | scientific name -1980417 | Feraviridae | | includes -1980417 | Jonviridae | | includes -1980417 | Phasmaviridae | | scientific name -1980418 | Phenuiviridae | | scientific name -1980419 | Tospoviridae | | scientific name -1980420 | Goukovirus | | scientific name -1980421 | Phasivirus | | scientific name -1980427 | Emaravirus fici | | scientific name -1980427 | Fig mosaic emaravirus | | equivalent name -1980427 | Fig mosaic virus | | equivalent name -1980428 | Emaravirus tritici | | scientific name -1980428 | High Plains wheat mosaic emaravirus | | equivalent name -1980428 | High Plains wheat mosaic virus | | equivalent name -1980429 | Emaravirus cajani | | scientific name -1980429 | Pigeonpea sterility mosaic emaravirus 1 | | equivalent name -1980429 | Pigeonpea sterility mosaic virus 1 | | equivalent name -1980429 | Pigeonpea sterility mosaic virus-I | | equivalent name -1980429 | Pigeonpea sterlity mosaic virus-I | | equivalent name -1980430 | Emaravirus toordali | | scientific name -1980430 | Pigeonpea sterility mosaic emaravirus 2 | | equivalent name -1980430 | Pigeonpea sterility mosaic virus 2 | | equivalent name -1980430 | Pigeonpea sterility mosaic virus II | | equivalent name -1980430 | Pigeonpea sterility mosaic virus-II | | equivalent name -1980430 | Pigeonpea sterlity mosaic virus-II | | equivalent name -1980431 | Emaravirus idaeobati | | scientific name -1980431 | Raspberry leaf blotch emaravirus | | equivalent name -1980431 | Raspberry leaf blotch virus | | equivalent name -1980517 | Nairovirus | | equivalent name -1980517 | Nairoviruses | | equivalent name -1980517 | Orthonairovirus | | scientific name -1980538 | Orthophasmavirus | | scientific name -1985366 | Gemygorvirus | | scientific name -1985372 | bovine associated gemycircularvirus 1 | | scientific name -1985375 | Chickadee associated gemycircularvirus 1 | | scientific name -1985376 | Chicken associated gemycircularvirus 1 | | scientific name -1985377 | Chicken associated gemycircularvirus 2 | | scientific name -1985379 | Equine associated gemycircularvirus 1 | | scientific name -1985392 | Poaceae associated gemycircularvirus 1 | | scientific name -1985392 | Poaceae-associated gemycircularvirus 1 | | equivalent name -1985392 | Poaceae-associated gemycircularvirus-1 | | equivalent name -1985393 | Porcine associated gemycircularvirus 1 | | scientific name -1985405 | Rat associated gemycircularvirus 1 | | scientific name -1985412 | sheep associated gemycircularvirus 1 | | scientific name -1985425 | Canine associated gemygorvirus 1 | | scientific name -1985426 | Mallard associated gemygorvirus 1 | | scientific name -1985699 | Barley yellow striate mosaic cytorhabdovirus | | equivalent name -1985699 | Barley yellow striate mosaic virus | | equivalent name -1985699 | Cytorhabdovirus hordei | | scientific name -1986112 | Bovine nidovirus 1 | | scientific name -1986190 | Alfalfa enamovirus 2 | | scientific name -1986960 | Ampivirus A | | equivalent name -1986960 | Ampivirus apilisi | | scientific name -1986961 | Ampivirus | | scientific name -1987123 | Hepatovirus B | | scientific name -1987125 | Hepatovirus D | | scientific name -1987129 | Hepatovirus H | | scientific name -1987130 | Hepatovirus I | | scientific name -1987140 | Rodent hepatovirus RMU101637Micarv2010 | | scientific name -1987140 | Rodent hepatovirus [RMU101637Micarv2010] | | equivalent name -1987144 | Hedgehog hepatovirus Igel8Erieur2014 | | scientific name -1987144 | Hedgehog hepatovirus [Igel8Erieur2014] | | equivalent name -1987145 | Shrew hepatovirus KS121232Sorara2012 | | scientific name -1987145 | Shrew hepatovirus [KS121232Sorara2012] | | equivalent name -1987744 | Squirrel associated cyclovirus 1 | | scientific name -1993640 | Tolecusatellitidae | | scientific name -2003309 | Bat associated circovirus 4 | | scientific name -2003309 | Tadarida brasiliensis circovirus 1 | | equivalent name -2003394 | Alphaendornavirus | | scientific name -2003394 | Endornavirus | | equivalent name -2003395 | Betaendornavirus | | scientific name -2004962 | Human associated gemykibivirus 5 | | scientific name -2005033 | Anoeconeossa | | scientific name -2006147 | Myodes glareolus polyomavirus 1 | | scientific name -2006148 | Microtus arvalis polyomavirus 1 | | scientific name -2006158 | Betapolyomavirus octipanos | | scientific name -2006158 | Pan troglodytes polyomavirus 8 | | equivalent name -2010320 | French bean leaf curl betasatellite | | scientific name -2010321 | Momordica yellow mosaic betasatellite | | scientific name -2018325 | Tettigoniidea | | scientific name -2020310 | Aegosoma sinicum | | scientific name -2020310 | Aegosoma sinicum White, 1853 | | authority -2021209 | Human astrovirus 4c | | scientific name -2022639 | Solinviviridae | | scientific name -2022641 | Nyfulvavirus | | scientific name -2022857 | Capulavirus | | scientific name -2022857 | Capulaviruses | | equivalent name -2029065 | Hemerobiiformia | | scientific name -2034996 | Tilapia tilapinevirus | | equivalent name -2034996 | Tilapinevirus tilapiae | | scientific name -2034997 | Tilapinevirus | | scientific name -2038729 | Black medic leaf roll virus | | scientific name -2038729 | Black medic leafroll virus | | equivalent name -2039307 | Cirsium japonicum var. spinossimum | | scientific name -2039307 | Cirsium japonicum var. spinossimum (Kitam.) Kitam., 1944 | | authority -2039307 | Cirsium maackii var. spinossimum | | synonym -2039307 | Cirsium maackii var. spinossimum Kitam., 1937 | | authority -2045258 | Nemaliophycidae | | scientific name -2045261 | Rhodymeniophycidae | | scientific name -2047826 | Calophya californica | | scientific name -2047826 | Calophya californica Schwarz, 1904 | | authority -2048238 | Tetraonchoididae | | scientific name -2048239 | Paratetraonchoides | | scientific name -2048240 | Paratetraonchoides inermis | | scientific name -2048240 | Paratetraonchoides inermis Bychowsky, Gussev & Nagibina, 1965 | | authority -2050584 | French bean leaf curl virus | | scientific name -2065824 | Sineleotris | | scientific name -2065826 | Sineleotris saccharae | | scientific name -2065826 | Sineleotris saccharae Herre, 1940 | | authority -2072024 | Mocis latipes granulovirus | | scientific name -2072716 | Spiruromorpha | | scientific name -2080833 | unclassified Avisivirus | | scientific name -2136291 | Obrimoposthia wandeli | | scientific name -2136291 | Obrimoposthia wandeli (Hallez, 1906) | | authority -2169561 | Ortervirales | | scientific name -2169567 | Bacilladnaviridae | | scientific name -2169568 | Deltaflexiviridae | | scientific name -2169569 | Deltaflexivirus | | scientific name -2169574 | Smacoviridae | | scientific name -2169577 | Solemoviridae | | scientific name -2169595 | Firstpapillomavirinae | | scientific name -2169596 | Secondpapillomavirinae | | scientific name -2169609 | Kieseladnavirus | | scientific name -2169610 | Protobacilladnavirus | | scientific name -2169619 | Colecusatellite | | scientific name -2169650 | Alefpapillomavirus | | scientific name -2169663 | Porprismacovirus | | scientific name -2169692 | Alefpapillomavirus 1 | | scientific name -2169693 | Winged bean alphaendornavirus 1 | | scientific name -2169726 | Cacao yellow vein banding virus | | scientific name -2169726 | Cacao yellow vein-banding virus | | equivalent name -2169738 | Tomato yellow leaf curl Shuangbai virus | | scientific name -2169757 | Betapolyomavirus vicugnae | | scientific name -2169757 | Vicugna pacos polyomavirus 1 | | equivalent name -2169801 | Sambucus virus C | | scientific name -2169802 | Sambucus virus D | | scientific name -2169803 | Sambucus virus E | | scientific name -2169864 | Fusarium deltaflexivirus 1 | | scientific name -2169878 | Dyokappapapillomavirus 3 | | scientific name -2169879 | Dyokappapapillomavirus 4 | | scientific name -2169881 | Dyoxipapillomavirus 2 | | scientific name -2169885 | Enterovirus L | | scientific name -2169886 | Epsilonpapillomavirus 2 | | scientific name -2169902 | Gammapapillomavirus 27 | | scientific name -2169960 | Privet ringspot virus | | scientific name -2170064 | Mahlapitsi orthoreovirus | | scientific name -2170064 | Mahlapitsi virus | | equivalent name -2170103 | Thetapolyomavirus trepennellii | | scientific name -2170103 | Trematomus pennellii polyomavirus 1 | | equivalent name -2170103 | Trematomus polyomavirus 1 | | equivalent name -2170117 | Porcine associated porprismacovirus 10 | | scientific name -2170126 | Rat associated porprismacovirus 1 | | scientific name -2170132 | Barbacena virus Y | | scientific name -2170135 | Impatiens flower break potyvirus | | equivalent name -2170135 | Impatiens flower break virus | | scientific name -2170170 | Psipapillomavirus 2 | | scientific name -2170171 | Psipapillomavirus 3 | | scientific name -2170255 | Xipapillomavirus 4 | | scientific name -2172821 | Multicrustacea | | scientific name -2204151 | DNA viruses | | synonym -2204151 | unclassified DNA viruses | | scientific name -2218011 | Anoeconeossa unicornuta | | scientific name -2218011 | Anoeconeossa unicornuta Taylor, 1987 | | authority -2218046 | Diclidophlebia paucipunctata | | synonym -2218046 | Diclidophlebia paucipunctata (Brown & Hodkinson, 1988) | | authority -2218046 | Haplaphalara paucipunctata | | synonym -2218046 | Haplaphalara paucipunctata Brown & Hodkinson, 1988 | | authority -2218046 | Melanastera paucipunctata | | scientific name -2218046 | Melanastera paucipunctata (Brown & Hodkinson, 1988) | | authority -2218050 | Lanthanaphalara mira | | scientific name -2218050 | Lanthanaphalara mira Tuthill, 1959 | | authority -2218081 | Allocarsidara | | scientific name -2218081 | Allocarsidara Hollis, 1987 | | authority -2218082 | Allocarsidara bakeri | | scientific name -2218082 | Allocarsidara bakeri Hollis, 1987 | | authority -2218119 | Homotoma | | scientific name -2218119 | Homotoma Guerin-Meneville, 1844 | | authority -2218120 | Chermes ficus | | synonym -2218120 | Chermes ficus Linnaeus, 1758 | | authority -2218120 | Homotoma ficus | | scientific name -2218120 | Homotoma ficus (Linnaeus, 1758) | | authority -2218135 | Paracarsidara | | scientific name -2218135 | Paracarsidara Heslop-Harrison, 1960 | | authority -2218136 | Carsidara gigantea | | synonym -2218136 | Carsidara gigantea Crawford, 1911 | | authority -2218136 | Paracarsidara gigantea | | scientific name -2218136 | Paracarsidara gigantea (Crawford, 1911) | | authority -2218198 | Psyllinae | | scientific name -2219049 | Husa-like viruses | | equivalent name -2219049 | Husavirus | | scientific name -2219049 | human stool-associated RNA viruses | | equivalent name -2219055 | Porcine stool-associated RNA virus | | equivalent name -2219055 | Porcine stool-associated RNA viruses | | equivalent name -2219055 | Posavirus | | scientific name -2219055 | Posaviruses | | equivalent name -2219250 | Naprepa albicollis | | synonym -2219250 | Ocinara albicollis | | scientific name -2219250 | Ocinara albicollis (Walker, 1862) | | authority -2231382 | NPAAA clade | | scientific name -2231382 | canavanine-accumulating clade | | synonym -2231382 | non-protein amino acid accumulating clade | | synonym -2231384 | genistoids sensu lato | | scientific name -2231385 | core genistoids | | scientific name -2231387 | dalbergioids sensu lato | | scientific name -2231390 | Pterocarpus clade | | scientific name -2231393 | 50 kb inversion clade | | scientific name -2233855 | indigoferoid/millettioid clade | | scientific name -2248770 | Panax notoginseng virus B | | scientific name -2259808 | Mink bocavirus 1 | | scientific name -2290931 | Stenosarchaea | | equivalent name -2290931 | Stenosarchaea Aouad et al. 2018 | | authority -2290931 | Stenosarchaea group | | scientific name -2315733 | Cymbidium banaense | | scientific name -2315733 | Cymbidium banaense Gagnep., 1951 | | authority -2485233 | Apple hammerhead viroid | | equivalent name -2485233 | Pelamoviroid malleusmali | | scientific name -2486284 | Dactylogyridea | | scientific name -2497569 | Negarnaviricota | | scientific name -2497569 | Negative-strand RNA viruses | | common name -2497570 | Haploviricotina | | scientific name -2497571 | Polyploviricotina | | scientific name -2497572 | Chunqiuviricetes | | scientific name -2497574 | Monjiviricetes | | scientific name -2497574 | Mono-Chu-like virus sp. | | equivalent name -2497577 | Insthoviricetes | | scientific name -2499398 | Arnidovirineae | | scientific name -2499399 | Cornidovirineae | | scientific name -2499403 | Tornidovirineae | | scientific name -2499405 | Muvirales | | scientific name -2499407 | Jingchuvirales | | scientific name -2499411 | Articulavirales | | scientific name -2499606 | Simarterivirinae | | scientific name -2499615 | Iotaarterivirus | | scientific name -2499616 | Thetaarterivirus | | scientific name -2501926 | Rhinolophus ferrumequinum alphacoronavirus HuB-2013 | | scientific name -2501927 | Myotis ricketti alphacoronavirus Sax-2011 | | scientific name -2501928 | Nyctalus velutinus alphacoronavirus SC-2013 | | scientific name -2501931 | Orthocoronavirinae | | scientific name -2501940 | Mypoviridae | | scientific name -2501942 | Gerrid arlivirus | | equivalent name -2501942 | Sanstrivirus gerridis | | scientific name -2501945 | Ganiavirus tachengense | | scientific name -2501945 | Tacheng arlivirus | | equivalent name -2501949 | Amnoonviridae | | scientific name -2501952 | Chuviridae | | scientific name -2501968 | Qinviridae | | scientific name -2501970 | Shaspivirus | | scientific name -2501971 | Striwavirus | | scientific name -2501976 | Horwuvirus | | scientific name -2501985 | Xinmoviridae | | scientific name -2501987 | Lispiviridae | | scientific name -2501994 | Shangavirus | | scientific name -2501998 | Wuhivirus | | scientific name -2501999 | Thetaarterivirus kafuba | | scientific name -2507291 | Mivirus | | scientific name -2507320 | Xinzhou mivirus | | scientific name -2507497 | Yingvirus | | scientific name -2507505 | Xinzhou yingvirus | | equivalent name -2507505 | Yingvirus xinzhouense | | scientific name -2508209 | Tobaniviridae | | scientific name -2508239 | Remotovirinae | | scientific name -2508240 | Serpentovirinae | | scientific name -2508241 | Bostovirus | | scientific name -2508242 | Bosnitovirus | | scientific name -2508243 | Infratovirus | | scientific name -2508247 | Xintolivirus | | scientific name -2508251 | Infratovirus 1 | | scientific name -2508258 | Hubavirus | | scientific name -2508259 | Hubavirus myriapedis | | scientific name -2508259 | Myriapod hubavirus | | equivalent name -2509479 | Decacovirus | | scientific name -2509489 | Kaftartevirus | | scientific name -2509500 | Myotacovirus | | scientific name -2509503 | Nyctacovirus | | scientific name -2509509 | Rhinacovirus | | scientific name -2509514 | Tegacovirus | | scientific name -2545470 | Maize sterile stunt virus | | scientific name -2547355 | Bukakata virus | | scientific name -2547356 | Fomede virus | | scientific name -2555566 | Noctuini | | scientific name -2558200 | Accipitriformes | | scientific name -2558200 | hawks & eagles | hawks & eagles | blast name -2558200 | hawks & eagles | hawks & eagles | genbank common name -2559587 | RNA viruses | | common name -2559587 | RNA viruses and retroviruses | | genbank common name -2559587 | RNA viruses and viroids | | common name -2559587 | Riboviria | | scientific name -2560063 | Botourmiaviridae | | scientific name -2560069 | Avulavirinae | | scientific name -2560072 | Calvusvirinae | | scientific name -2560076 | Orthoparamyxovirinae | | scientific name -2560077 | Procedovirinae | | scientific name -2560078 | Regressovirinae | | scientific name -2560088 | Alphanemrhavirus | | scientific name -2560100 | Betachrysovirus | | scientific name -2560105 | Botoulivirus | | scientific name -2560185 | Narmovirus | | scientific name -2560194 | Orthoavulavirus | | scientific name -2560196 | Orthotospovirus | | scientific name -2560196 | Tospovirus | | equivalent name -2560218 | Salisharnavirus | | scientific name -2560230 | Sogarnavirus | | scientific name -2560252 | Wamavirus | | scientific name -2560254 | Wenrivirus | | scientific name -2560289 | Aino orthobunyavirus | | equivalent name -2560289 | Orthobunyavirus ainoense | | scientific name -2560321 | Avian avulavirus 13 | | equivalent name -2560321 | Avian orthoavulavirus 13 | | equivalent name -2560321 | Avian paramyxovirus (APMV/goose/Shimane/67/2000) | | equivalent name -2560321 | Avian paramyxovirus goose/Shimane/67/2000 | | synonym -2560321 | avian paramyxovirus 13 | | scientific name -2560349 | Blackberry virus F | | scientific name -2560351 | Botrytis botoulivirus | | scientific name -2560371 | Canna yellow mottle associated virus | | scientific name -2560371 | Canna yellow mottle-associated virus | | synonym -2560468 | Felid gammaherpesvirus 1 | | scientific name -2560468 | Felis catus gammaherpesvirus 1 | | equivalent name -2560479 | Betachrysovirus foxyspori | | scientific name -2560479 | Fusarium oxysporum chrysovirus 2 | | equivalent name -2560568 | Macaca nemestrina herpesvirus 7 | | equivalent name -2560568 | macacine betaherpesvirus 9 | | scientific name -2560614 | Nectarine stem pitting associated virus | | scientific name -2560614 | Nectarine stem pitting-associated virus | | equivalent name -2560620 | Palmarnavirus 128 | | scientific name -2560621 | Palmarnavirus 156 | | scientific name -2560622 | Palmarnavirus 473 | | scientific name -2560642 | Perigonia lusca nucleopolyhedrovirus | | scientific name -2560648 | Idaeovirus ligustri | | scientific name -2560648 | Privet idaeovirus | | equivalent name -2560649 | Deltapolyomavirus secuprocyonis | | scientific name -2560649 | Procyon lotor polyomavirus 2 | | equivalent name -2560801 | Testudinid alphaherpesvirus 3 | | scientific name -2560801 | Testudinid herpesvirus 3 | | equivalent name -2560801 | tortoise herpesvirus 3 | | equivalent name -2560845 | Alphanemrhavirus xingshan | | scientific name -2560845 | Xingshan alphanemrhavirus | | equivalent name -2560846 | Alphanemrhavirus xinzhou | | scientific name -2560846 | Xinzhou alphanemrhavirus | | equivalent name -2566501 | Cyclorhipidion bodoanum | | scientific name -2566501 | Cyclorhipidion bodoanus (Reitter, 1913) | | authority -2572045 | Tomato brown rugose fruit virus - Palestinian isolate | | scientific name -2576578 | unclassified Salisharnavirus | | scientific name -2585030 | unclassified RNA viruses | | equivalent name -2585030 | unclassified Riboviria | | scientific name -2585815 | Bucco haemacephalus | | synonym -2585815 | Bucco haemacephalus Muller, 1776 | | authority -2585815 | Megalaima haemacephala | | synonym -2585815 | Megalaima haemacephala (Statius Mller, 1776) | | authority -2585815 | Psilopogon haemacephalus | | scientific name -2585815 | coppersmith barbet | | genbank common name -2599620 | unclassified Mivirus | | scientific name -2609695 | DNA satellites | | scientific name -2613861 | unclassified Tospoviridae | | scientific name -2613861 | unclassified Tospovirus | | equivalent name -2621980 | unclassified Hafnia | | scientific name -2622732 | unclassified Haladaptatus | | scientific name -2654645 | Tomato brown rugose fruit virus Tom1-Jo | | scientific name -2670808 | unclassified Begomovirus-associated DNA beta-like sequences | | equivalent name -2670808 | unclassified Betasatellite | | scientific name -2670808 | unclassified betasatellites | | equivalent name -2684882 | Zygnematophycidae | | scientific name -2684882 | Zygnematophycidae Melkonian, Gontcharov & Marin, 2019 | | authority -2691594 | unclassified Rhinacovirus | | scientific name -2692248 | core chlorophytes | | scientific name -2696291 | Ochrophyta | | scientific name -2696291 | Ochrophyta Cavalier-Smith 1986 | | authority -2697495 | Spiralia | | scientific name -2698737 | SAR supergroup | | synonym -2698737 | Sar | | scientific name -2698737 | Sar Burki et al. 2008 | | authority -2707335 | Colletotrichum acutatum species complex | | scientific name -2707348 | Colletotrichum caudatum species complex | | includes -2707348 | Colletotrichum graminicola species complex | | scientific name -2721536 | Schizothoracinae | | scientific name -2731341 | Duplodnaviria | | scientific name -2731341 | double-stranded DNA viruses | | genbank common name -2731342 | Monodnaviria | | scientific name -2731342 | single-stranded DNA viruses | | genbank common name -2731360 | Heunggongvirae | | scientific name -2731361 | Peploviricota | | scientific name -2731363 | Herviviricetes | | scientific name -2732091 | Sangervirae | | scientific name -2732092 | Shotokuvirae | | scientific name -2732396 | Orthornavirae | | scientific name -2732397 | Pararnavirae | | scientific name -2732405 | Duplornaviricota | | scientific name -2732406 | Kitrinoviricota | | scientific name -2732406 | Tombus-Noda-like virus sp. | | equivalent name -2732407 | Lenarviricota | | scientific name -2732408 | Pisuviricota | | scientific name -2732409 | Artverviricota | | scientific name -2732412 | Phixviricota | | scientific name -2732413 | Malgrandaviricetes | | scientific name -2732414 | Petitvirales | | scientific name -2732415 | Cossaviricota | | scientific name -2732416 | Cressdnaviricota | | scientific name -2732416 | eukaryotic Rep-encoding ssDNA viruses | | common name -2732421 | Papovaviricetes | | scientific name -2732422 | Quintoviricetes | | scientific name -2732423 | Arfiviricetes | | scientific name -2732424 | Repensiviricetes | | scientific name -2732458 | Chrymotiviricetes | | scientific name -2732459 | Resentoviricetes | | scientific name -2732461 | Alsuviricetes | | scientific name -2732462 | Flasuviricetes | | scientific name -2732463 | Tolucaviricetes | | scientific name -2732464 | Magsaviricetes | | scientific name -2732498 | Amabiliviricetes | | scientific name -2732499 | Howeltoviricetes | | scientific name -2732500 | Miaviricetes | | scientific name -2732502 | Wolframvirales | | scientific name -2732503 | Cryppavirales | | scientific name -2732504 | Ourlivirales | | scientific name -2732505 | Duplopiviricetes | | scientific name -2732506 | Pisoniviricetes | | scientific name -2732507 | Stelpaviricetes | | scientific name -2732514 | Revtraviricetes | | scientific name -2732515 | Blubervirales | | scientific name -2732532 | Sepolyvirales | | scientific name -2732533 | Zurhausenvirales | | scientific name -2732534 | Piccovirales | | scientific name -2732535 | Baphyvirales | | scientific name -2732536 | Cirlivirales | | scientific name -2732537 | Cremevirales | | scientific name -2732538 | Mulpavirales | | scientific name -2732539 | Geplafuvirales | | scientific name -2732540 | Ghabrivirales | | scientific name -2732541 | Reovirales | | scientific name -2732541 | Reoviridae | | synonym -2732543 | Hepelivirales | | scientific name -2732544 | Martellivirales | | scientific name -2732545 | Amarillovirales | | scientific name -2732546 | Nodamuvirales | | scientific name -2732548 | Luteoviridae | | includes -2732548 | Tolivirales | | scientific name -2732549 | Durnavirales | | scientific name -2732550 | Patatavirales | | scientific name -2732551 | Stellavirales | | scientific name -2732553 | Sobelivirales | | scientific name -2732890 | Mayoviridae | | scientific name -2732892 | Mitoviridae | | scientific name -2733223 | Aquambidensovirus | | scientific name -2733224 | Blattambidensovirus | | scientific name -2733246 | Arurhavirus | | scientific name -2733248 | Betanucleorhabdovirus | | scientific name -2733254 | Sunrhavirus | | scientific name -2733256 | Bandavirus | | scientific name -2733256 | Banyangvirus | | equivalent name -2733291 | Parahepadnavirus | | scientific name -2733293 | Vaccinivirus | | scientific name -2734294 | Alphapolyomavirus quardecihominis | | scientific name -2734294 | Human polyomavirus 14 | | equivalent name -2734349 | Rosellinia necatrix betaendornavirus 1 | | scientific name -2734371 | Arurhavirus inhangapi | | scientific name -2734371 | Inhangapi arurhavirus | | equivalent name -2734385 | Cytorhabdovirus lycopersici | | scientific name -2734385 | Tomato yellow mottle-associated cytorhabdovirus | | equivalent name -2734386 | Cytorhabdovirus alphawuhaninsectum | | scientific name -2734386 | Wuhan 4 insect cytorhabdovirus | | equivalent name -2734387 | Cytorhabdovirus betawuhaninsectum | | scientific name -2734387 | Wuhan 5 insect cytorhabdovirus | | equivalent name -2734388 | Cytorhabdovirus gammawuhaninsectum | | scientific name -2734388 | Wuhan 6 insect cytorhabdovirus | | equivalent name -2734409 | Sunrhavirus walkabout | | scientific name -2734409 | Walkabout sunrhavirus | | equivalent name -2734433 | Adana phlebovirus | | equivalent name -2734433 | Phlebovirus adanaense | | scientific name -2734594 | Kabutovirus | | synonym -2734594 | Uukuvirus | | scientific name -2741926 | Amblemini | | scientific name -2741929 | Popenaidini | | scientific name -2743705 | Smiliogastrinae | | scientific name -2743714 | Gobionidae | | scientific name -2743715 | Gobioninae | | scientific name -2743716 | Sarcocheilichthyinae | | scientific name -2748958 | Bandavirus dabieense | | scientific name -2748958 | Dabie bandavirus | | synonym -2748958 | Huaiyangshan banyangvirus | | synonym -2748958 | SFTSV | SFTSV | acronym -2748959 | Betanucleorhabdovirus daturae | | scientific name -2748959 | DYVV | | acronym -2748959 | Datura yellow vein betanucleorhabdovirus | | equivalent name -2748967 | Iotaarterivirus pejah | | scientific name -2748967 | PBJV | PBJV | acronym -2756270 | Monochamus alternatus alternatus | | scientific name -2768478 | Deltocephalini | | scientific name -2768478 | Deltocephalini Dallas, 1870 | | authority -2785011 | Autobranchia | | scientific name -2785015 | Imparidentia | | scientific name -2788829 | unclassified Resentoviricetes | | scientific name -2788833 | unclassified Tolucaviricetes | | scientific name -2788857 | unclassified Zurhausenvirales | | scientific name -2788865 | unclassified Reovirales | | scientific name -2788865 | unclassified Reoviridae | | synonym -2789204 | Enterobacteria allolevivirus II | | equivalent name -2789204 | Enterobacteria phage FI sensu lato | | equivalent name -2789204 | Escherichia phage FI | | scientific name -2797651 | Zygometra comata | | scientific name -2797651 | Zygometra comata Clark, 1911 | | authority -2810354 | Isognathotermes | | scientific name -2810354 | Isognathotermes Sjostedt, 1926 | | authority -2811596 | Iberoporus pluto | | scientific name -2811596 | Iberoporus pluto Ribera & Reboleira, 2019 | | authority -2812636 | CS clade | | scientific name -2812636 | SV clade | | includes -2821351 | Conifers II | | scientific name -2839668 | Tagiadinae | | scientific name -2840056 | Baculovirus-related double-stranded DNA viruses of arthropods | | common name -2840056 | Naldaviricetes | | scientific name -2840070 | Lefavirales | | scientific name -2841720 | Asterinae | | scientific name -2841720 | Asterinae Dumort., 1827 | | authority -2842243 | Allassoviricetes | | synonym -2842243 | Leviviricetes | | scientific name -2842243 | prokaryotic virus | prokaryotic virus | in-part -2842247 | Levivirales | | synonym -2842247 | Norzivirales | | scientific name -2842313 | Aliusviridae | | scientific name -2842319 | Fiersviridae | | scientific name -2842319 | Leviviridae | | synonym -2842319 | bacterial virus | bacterial virus | in-part -2842319 | bacterial viruses | bacterial viruses | in-part -2842319 | prokaryotic virus | prokaryotic virus | in-part -2842325 | Natareviridae | | scientific name -2842369 | Alphadrosrhavirus | | scientific name -2842407 | Alpharhabdovirinae | | scientific name -2842408 | Betarhabdovirinae | | scientific name -2842542 | Alpharicinrhavirus | | scientific name -2842594 | Charybdivirus | | scientific name -2842607 | Citlodavirus | | scientific name -2842620 | Culicidavirus | | scientific name -2842645 | Diciambidensovirus | | scientific name -2842680 | Felismacovirus | | scientific name -2842848 | Maldovirus | | scientific name -2842882 | Morsusvirus | | scientific name -2842921 | Ollusvirus | | scientific name -2842923 | Omegatorquevirus | | scientific name -2842950 | Penoulivirus | | scientific name -2842995 | Allolevivirus | | synonym -2842995 | Qubevirus | | scientific name -2843481 | Peiartevirus | | scientific name -2843859 | Alpharicinrhavirus bole | | scientific name -2843859 | BlTV-2 | | acronym -2843859 | Bole alpharicinrhavirus | | equivalent name -2843935 | Charybdivirus charybdis | | scientific name -2843935 | WzCV-3 | | acronym -2844037 | Culicidavirus culicidae | | scientific name -2844037 | WhMV-8 | | acronym -2844039 | Culicidavirus imjinense | | scientific name -2844039 | IjRV-1 | | acronym -2844095 | Domestica sigmavirus | | equivalent name -2844095 | Sigmavirus domestica | | scientific name -2844095 | WhFV-2 | | acronym -2844423 | BoGCV1 | | acronym -2844423 | Gemycircularvirus bovas1 | | scientific name -2844427 | ChiGCV1 | | acronym -2844427 | Gemycircularvirus chicas1 | | scientific name -2844428 | ChiGCV2 | | acronym -2844428 | Gemycircularvirus chicas2 | | scientific name -2844429 | ChGCV1 | | acronym -2844429 | Gemycircularvirus chickad1 | | scientific name -2844440 | Gemycircularvirus echiam1 | | scientific name -2844441 | EGCV1 | | acronym -2844441 | Gemycircularvirus equas1 | | scientific name -2844504 | Gemycircularvirus poass1 | | scientific name -2844504 | PGCV1 | | acronym -2844505 | Gemycircularvirus porci1 | | scientific name -2844505 | PoGCV1 | | acronym -2844518 | Gemycircularvirus ratas1 | | scientific name -2844518 | RGCV1 | | acronym -2844528 | Gemycircularvirus sheas1 | | scientific name -2844528 | ShGCV1 | | acronym -2844548 | CGGV1 | | acronym -2844548 | Gemygorvirus cania1 | | scientific name -2844550 | Gemygorvirus malas1 | | scientific name -2844550 | MGGV1 | | acronym -2844569 | Gemykibivirus echi1 | | scientific name -2844585 | Gemykibivirus humas5 | | scientific name -2844585 | HGKV5 | | acronym -2844603 | Gemykibivirus sewopo1 | | scientific name -2844603 | SeGKV1 | | acronym -2844612 | Gemykolovirus echia1 | | scientific name -2844799 | GyV8 | | acronym -2844799 | Gyrovirus fulgla1 | | scientific name -2844804 | GyV4 | GyV4 | acronym -2844804 | Gyrovirus homsa3 | | scientific name -2844833 | Hippoboscid sigmavirus | | equivalent name -2844833 | Sigmavirus hippoboscid | | scientific name -2844833 | WhLFV-9 | | acronym -2844861 | Alphadrosrhavirus hubei | | scientific name -2844861 | Hubei alphadrosrhavirus | | equivalent name -2844861 | WhHFV-2 | | acronym -2845539 | Lousefly sigmavirus | | equivalent name -2845539 | Sigmavirus lousefly | | scientific name -2845539 | WhLFV-10 | | acronym -2845619 | Mivirus boleense | | scientific name -2845620 | CpTV-2 | | acronym -2845620 | Mivirus changpingense | | scientific name -2845621 | CpTV-3 | | acronym -2845621 | Mivirus dermacentoris | | scientific name -2845625 | Mivirus suffolkense | | scientific name -2845625 | SFKV | | acronym -2845626 | Mivirus wuhanense | | scientific name -2845626 | WhTV-2 | | acronym -2845639 | Morsusvirus argatis | | scientific name -2845639 | TcTV-4 | | acronym -2845713 | Ollusvirus shayangense | | scientific name -2845713 | Olluvirus shayangense | | equivalent name -2845835 | Phomosis penoulivirus | | scientific name -2845835 | PlRV1 | | acronym -2845912 | Porprismacovirus porci10 | | scientific name -2845922 | Porprismacovirus porci1 | | scientific name -2845932 | Porprismacovirus ratas1 | | scientific name -2846193 | Alphadrosrhavirus shayang | | scientific name -2846193 | Shayang alphadrosrhavirus | | equivalent name -2846193 | SyFV-3 | | acronym -2846195 | Shayang sigmavirus | | equivalent name -2846195 | Sigmavirus shayang | | scientific name -2846195 | SyFV-1 | | equivalent name -2846667 | Alpharicinrhavirus wuhan | | scientific name -2846667 | WhTV-1 | | acronym -2846667 | Wuhan alpharicinrhavirus | | equivalent name -2846668 | Sigmavirus wuhan | | scientific name -2846668 | WhHFV-1 | | acronym -2846668 | Wuhan sigmavirus | | equivalent name -2847088 | GB virus D | | equivalent name -2847088 | GB virus-D | | scientific name -2847270 | Picornaviridae sp. rodent/RL/PicoV/FJ2015 | | equivalent name -2847270 | rosavirus C4 | | scientific name -2847522 | Herona marathus angustata | | scientific name -2847522 | Herona marathus angustata Moore, 1878 | | authority -2848317 | Trichechus manatus latirostris papillomavirus 4 | | scientific name -2848317 | Trichechus manatus papillomavirus 4 | | equivalent name -2866655 | Bos arnee | | synonym -2866655 | Bos arnee Kerr, 1792 | | authority -2866655 | Bubalus arnee | | scientific name -2866655 | Bubalus arnee (Kerr, 1792) | | authority -2866655 | wild water buffalo | | genbank common name -2867347 | Retinodendron rassak | | synonym -2867347 | Retinodendron rassak Korth., 1840 | | authority -2867347 | Vatica rassak | | scientific name -2867347 | Vatica rassak (Korth.) Blume, 1856 | | authority -2870378 | Miniopterus schreibersii picornavirus 1 | | equivalent name -2870378 | mischivirus A1 | | scientific name -2871195 | rosavirus B1 | | scientific name -2871196 | rosavirus B2 | | scientific name -2876817 | Vatica xishuangbannaensis | | scientific name -2876817 | Vatica xishuangbannaensis G.D.Tao & J.H.Zhang, 1983 | | authority -2890311 | Klebsiella/Raoultella group | | scientific name -2908833 | Neoheterodontei | | scientific name -2914707 | Apachyus feae | | scientific name -2914707 | Apachyus feae de Bormans, 1894 | | authority -2916678 | CTG clade | | common name -2916678 | CUG-Ser1 clade | | genbank common name -2916678 | Serinales | | scientific name -2916678 | Serinales M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority -2927998 | Arremon aurantiirostris erythrorhynchus | | scientific name -2927998 | Arremon aurantiirostris erythrorhynchus Sclater, 1855 | | authority -2927999 | Arremon aurantiirostris spectabilis | | scientific name -2927999 | Arremon aurantiirostris spectabilis Sclater, 1855 | | authority -2928000 | Arremon aurantiirostris occidentalis | | scientific name -2928000 | Arremon aurantiirostris occidentalis Hellmayr, 1911 | | authority -2928001 | Arremon aurantiirostris strictocollaris | | scientific name -2928001 | Arremon aurantiirostris strictocollaris Todd, 1922 | | authority -2928006 | Arremon aurantiirostris aurantiirostris | | scientific name -2928006 | Arremon aurantiirostris aurantiirostris Lafresnaye, 1847 | | authority -2928007 | Arremon aurantiirostris saturatus | | scientific name -2928007 | Arremon aurantiirostris saturatus Cherrie, 1891 | | authority -2928008 | Arremon aurantiirostris santarosae | | scientific name -2928008 | Arremon aurantiirostris santarosae Chapman, 1925 | | authority -2932129 | Phragmipedium hirtzii | | scientific name -2932129 | Phragmipedium hirtzii Dodson, 1988 | | authority -2942679 | Rohanvirales | | scientific name -2942681 | Yadokarivirales | | scientific name -2946186 | Sedoreoviridae | | scientific name -2946186 | Sedoreovirinae | | synonym -2946187 | Spinareoviridae | | scientific name -2946187 | Spinareovirinae | | synonym -2946194 | Yadokariviridae | | scientific name -2946627 | Caphthovirinae | | scientific name -2946630 | Ensavirinae | | scientific name -2946633 | Heptrevirinae | | scientific name -2946635 | Kodimesavirinae | | scientific name -2946639 | Orthohepevirinae | | scientific name -2946640 | Paavivirinae | | scientific name -2946790 | Alphafusarivirus | | scientific name -2946823 | Betafusarivirus | | scientific name -2946827 | Betayadokarivirus | | scientific name -2948661 | Chirohepevirus | | scientific name -2948686 | Duamitovirus | | scientific name -2948721 | Ganiavirus | | scientific name -2948851 | Orthopicobirnavirus | | scientific name -2948851 | Picobirnavirus | | equivalent name -2948893 | Sanstrivirus | | scientific name -2948924 | Thetapolyomavirus | | scientific name -2948930 | Tralespevirus | | scientific name -2948932 | Triamitovirus | | scientific name -2948940 | Unuamitovirus | | scientific name -2955264 | Alphafusarivirus ioaponiae | | scientific name -2955269 | Alphafusarivirus penicilli | | scientific name -2955271 | Alphafusarivirus pleosporae | | scientific name -2955296 | Alphapolyomavirus mischreibersii | | scientific name -2955300 | Alphapolyomavirus ranorvegicus | | scientific name -2955303 | Alphapolyomavirus secumischreibersii | | scientific name -2955369 | Apscaviroid glvd | | equivalent name -2955369 | Apscaviroid latensvitis | | scientific name -2955443 | Betachrysovirus pripenicillii | | scientific name -2955454 | Betafusarivirus sclerotiniae | | scientific name -2955468 | Betapolyomavirus marvalis | | scientific name -2955470 | Betapolyomavirus myoglareolus | | scientific name -2955472 | Betapolyomavirus raegyptiacus | | scientific name -2955492 | Betayadokarivirus ichibani | | scientific name -2955588 | Carlavirus PepVA | | scientific name -2955770 | Duamitovirus boci3 | | scientific name -2955781 | Duamitovirus fupo3 | | scientific name -2955782 | Duamitovirus fupo4 | | scientific name -2955836 | Duamitovirus scsc3 | | scientific name -2956328 | Pospiviroid plvd | | scientific name -2956522 | Thetapolyomavirus spari | | scientific name -2956541 | Tralespevirus gompholobii | | scientific name -2956547 | Triamitovirus rhor1 | | scientific name -2956583 | Unuamitovirus alar1 | | scientific name -2956585 | Unuamitovirus boci2 | | scientific name -2956586 | Unuamitovirus boci4 | | scientific name -2956587 | Unuamitovirus crri1 | | scientific name -2956588 | Unuamitovirus crri2 | | scientific name -2956589 | Unuamitovirus crri3 | | scientific name -2956590 | Unuamitovirus crri4 | | scientific name -2956591 | Unuamitovirus crri5 | | scientific name -2956607 | Unuamitovirus fupo1 | | scientific name -2956608 | Unuamitovirus fupo2 | | scientific name -2960224 | unclassified Ensavirinae | | scientific name -2960910 | unclassified Orthopicobirnavirus | | scientific name -2960910 | unclassified Picobirnavirus | | equivalent name -2965324 | Paris lancifolia | | scientific name -2965324 | Paris lancifolia Hayata, 1906 | | authority -2976112 | Jeffersonieae | | scientific name -2976112 | Jeffersonieae C.L.Hsieh, C.C.Yu & K.F.Chung, 2022 | | authority -2976338 | Myotis nigricans osculatii | | scientific name -2976338 | Myotis nigricans osculatii (Cornalia 1849) | | authority -2976338 | Myotis osculatii | | synonym -2976338 | Myotis osculatii (Cornalia, 1849) | | authority -2976338 | Vespertilio osculatii | | synonym -2976338 | Vespertilio osculatii Cornalia, 1849 | | authority -2980669 | Myotis yumanensis yumanensis | | scientific name -2980669 | Vespertilio yumanensis yumanensis | | synonym -2980669 | Vespertilio yumanensis yumanensis Allen, 1864 | | authority -2982303 | Tricholomatineae | | scientific name -2982303 | Tricholomatineae Aime, Dentinger & Gaya, 2015 | | authority -2982305 | Agaricineae | | scientific name -2982305 | Agaricineae Fr., emend. Aime, Dentinger & Gaya, 2015 | | authority -2982316 | Marasmiineae | | scientific name -2982316 | Marasmiineae Aime, Dentinger & Gaya, 2015 | | authority -2982806 | Jingmenvirus group | | scientific name -2982806 | unclassified Jingmenvirus group | | includes -3004043 | Calorhabdos latifolia | | synonym -3004043 | Calorhabdos latifolia Hemsl., 1890 | | authority -3004043 | Veronicastrum latifolium | | scientific name -3004043 | Veronicastrum latifolium (Hemsl.) T.Yamaz., 1957 | | authority -3039755 | Neodermaptera | | scientific name -3039756 | Epidermaptera | | scientific name -3042114 | Anthophila | Anthophila | scientific name -3042114 | bees | bees | blast name -3042114 | bees | bees | genbank common name -3044472 | Orthoherpesviridae | | scientific name -3047382 | Caulimovirus maculatractylodei | | scientific name -3047678 | Comovirus rugomusivum | | scientific name -3047681 | Waikavirus campanulae | | scientific name -3047686 | Badnavirus phirubi | | scientific name -3047704 | Alphabaculovirus busuppressariae | | scientific name -3047706 | Badnavirus tessellotheobromae | | scientific name -3047715 | Badnavirus venatheobromae | | scientific name -3047722 | Badnavirus alphamaculaflavicannae | | scientific name -3047737 | Alphabaculovirus capomonae | | scientific name -3047760 | Pelarspovirus clematis | | scientific name -3047783 | Cheravirus ribis | | scientific name -3047795 | Betabaculovirus disaccharalis | | scientific name -3047819 | Tombusvirus melongenae | | scientific name -3047843 | Badnavirus venaribis | | scientific name -3047845 | Nepovirus anatoliense | | scientific name -3047850 | Nepovirus deformationis | | scientific name -3047854 | Badnavirus decoloratiovitis | | scientific name -3048157 | Umbravirus ixeridii | | scientific name -3048204 | Betabaculovirus molatipedis | | scientific name -3048218 | Marafivirus nucipersicae | | scientific name -3048219 | Luteovirus nucipersicae | | scientific name -3048236 | Umbravirus papaveri | | scientific name -3048251 | Nepovirus persicae | | scientific name -3048283 | Alphanecrovirus solani | | scientific name -3048345 | Alphabaculovirus sujujubae | | scientific name -3048399 | Betatorquevirus homini32 | | scientific name -3048408 | Iotatorquevirus suida1a | | scientific name -3048442 | Alphabaculovirus urprotei | | scientific name -3048451 | Badnavirus wisteriae | | scientific name -3048458 | Circovirus zebrafinch | | scientific name -3050241 | Circovirus bastao | | scientific name -3050251 | Varicellovirus canidalpha1 | | scientific name -3050258 | Cytomegalovirus cercopithecinebeta5 | | scientific name -3050262 | Scutavirus chelonidalpha5 | | scientific name -3050267 | Mardivirus columbidalpha1 | | scientific name -3050285 | Percavirus felidgamma1 | | scientific name -3050304 | Simplexvirus leporidalpha4 | | scientific name -3050310 | Roseolovirus macacinebeta9 | | scientific name -3050317 | Simplexvirus macropodidalpha1 | | scientific name -3050360 | Scutavirus testudinidalpha3 | | scientific name -3050361 | Betatorquevirus homini18 | | scientific name -3050363 | Bocaparvovirus ungulate6 | | scientific name -3051377 | Orthoavulavirus japanense | | scientific name -3051421 | Alphabaculovirus peluscae | | scientific name -3051977 | Aquambidensovirus decapod1 | | scientific name -3051977 | CqDV | | acronym -3051977 | Decapod ambidensovirus 1 | | synonym -3051977 | Decapod aquambidensovirus 1 | | equivalent name -3051989 | Bandavirus bhanjanagarense | | scientific name -3051989 | Bhanja bandavirus | | equivalent name -3052031 | Bocaparvovirus carnivoran6 | | scientific name -3052031 | Carnivore bocaparvovirus 6 | | equivalent name -3052037 | Bocaparvovirus lagomorph1 | | scientific name -3052037 | Lagomorph bocaparvovirus 1 | | equivalent name -3052043 | Bocaparvovirus rodent1 | | scientific name -3052043 | Rodent bocaparvovirus 1 | | equivalent name -3052135 | Circovirus yaa | | scientific name -3052135 | Tick associated circovirus 1 | | equivalent name -3052163 | Cyclovirus risi | | scientific name -3052180 | Dependoparvovirus squamate2 | | scientific name -3052180 | Squamate dependoparvovirus 2 | | equivalent name -3052183 | DcDV | | acronym -3052183 | Diciambidensovirus hemipteran1 | | scientific name -3052183 | Hemipteran diciambidensovirus 1 | | equivalent name -3052212 | Goukovirus yichangense | | scientific name -3052212 | Yichang insect goukovirus | | equivalent name -3052248 | Horsefly horwuvirus | | equivalent name -3052248 | Horwuvirus wuhanense | | scientific name -3052256 | Iteradensovirus lepidopteran2 | | scientific name -3052256 | Lepidopteran iteradensovirus 2 | | equivalent name -3052258 | Iteradensovirus lepidopteran4 | | scientific name -3052258 | Lepidopteran iteradensovirus 4 | | equivalent name -3052270 | Avon-Heathcote Estuary associated kieseladnavirus | | equivalent name -3052270 | Kieseladnavirus ampcren | | scientific name -3052318 | Arenavirus N27 | | equivalent name -3052318 | MRTV | | acronym -3052318 | Mammarenavirus marientalense | | scientific name -3052318 | Mariental mammarenavirus | | equivalent name -3052318 | Mariental virus | | equivalent name -3052318 | Mariental virus N27 | | equivalent name -3052321 | Arenavirus N73 | | equivalent name -3052321 | Mammarenavirus okahandjaense | | scientific name -3052321 | OKAV | | acronym -3052321 | Okahandja mammarenavirus | | equivalent name -3052321 | Okahandja virus | | equivalent name -3052321 | Okahandja virus N73 | | equivalent name -3052333 | Marafivirus pruni | | scientific name -3052333 | Peach marafivirus D | | equivalent name -3052347 | Morbillivirus phocae | | scientific name -3052353 | Nariva narmovirus | | equivalent name -3052353 | Narmovirus narivaense | | scientific name -3052366 | Omegatorquevirus hominid1 | | scientific name -3052366 | Torque teno hominid virus 1 | | equivalent name -3052437 | Orthobunyavirus schmallenbergense | | scientific name -3052437 | Schmallenberg orthobunyavirus | | equivalent name -3052441 | Orthobunyavirus simbuense | | scientific name -3052441 | Simbu bunyavirus group | | equivalent name -3052441 | Simbu orthobunyavirus | | equivalent name -3052441 | Simbu serogroup | | equivalent name -3052441 | Simbu virus | | equivalent name -3052441 | Simbu virus Group | | equivalent name -3052520 | HpTV-1 | | acronym -3052520 | Huangpi orthonairovirus | | equivalent name -3052520 | Orthonairovirus huangpiense | | scientific name -3052522 | Orthonairovirus japonicum | | scientific name -3052522 | Tofla orthonairovirus | | equivalent name -3052523 | Kasokero orthonairovirus | | equivalent name -3052523 | Orthonairovirus kasokeroense | | scientific name -3052536 | Orthonairovirus tachengense | | scientific name -3052536 | Tacheng orthonairovirus | | equivalent name -3052536 | TcTV-1 | | acronym -3052540 | Orthonairovirus wenzhouense | | scientific name -3052540 | Wenzhou orthonairovirus | | equivalent name -3052540 | WzTV | | acronym -3052541 | Orthonairovirus yogueense | | scientific name -3052541 | YOGV | | acronym -3052541 | Yogue orthonairovirus | | equivalent name -3052543 | Orthophasmavirus aedis | | scientific name -3052543 | Wuhan mosquito orthophasmavirus 2 | | equivalent name -3052553 | Orthophasmavirus wuchangense | | scientific name -3052553 | Wuchang cockroach orthophasmavirus 1 | | equivalent name -3052554 | Orthophasmavirus wuhanense | | scientific name -3052554 | Wuhan mosquito orthophasmavirus 1 | | equivalent name -3052569 | Orthotospovirus capsicimaculaflavi | | scientific name -3052569 | Pepper chlorotic spot orthotospovirus | | equivalent name -3052570 | Chrysanthemum stem necrosis orthotospovirus | | equivalent name -3052570 | Orthotospovirus chrysanthinecrocaulis | | scientific name -3052577 | Iris yellow spot orthotospovirus | | equivalent name -3052577 | Iris yellow spot tospovirus | | equivalent name -3052577 | Orthotospovirus iridimaculaflavi | | scientific name -3052579 | Melon severe mosaic orthotospovirus | | equivalent name -3052579 | Orthotospovirus melotessellati | | scientific name -3052581 | Bean necrotic mosaic orthotospovirus | | equivalent name -3052581 | Orthotospovirus phaseolinecrotessellati | | scientific name -3052606 | Pegivirus H | | equivalent name -3052606 | Pegivirus columbiaense | | scientific name -3052611 | Pegivirus B | | equivalent name -3052611 | Pegivirus pteropi | | scientific name -3052624 | Pestivirus K | | equivalent name -3052624 | Pestivirus scrofae | | scientific name -3052632 | Fly phasivirus | | equivalent name -3052632 | Phasivirus wuhanense | | scientific name -3052632 | WhFV-1 | | acronym -3052633 | Phasivirus wutaiense | | scientific name -3052633 | Wutai Mosquito Virus | | equivalent name -3052633 | Wutai mosquito phasivirus | | equivalent name -3052665 | Munguba phlebovirus | | equivalent name -3052665 | Phlebovirus mungubaense | | scientific name -3052666 | Phlebovirus napoliense | | scientific name -3052685 | Phlebovirus torosense | | scientific name -3052685 | Toros phlebovirus | | equivalent name -3052690 | Phlebovirus zerdaliense | | scientific name -3052690 | Zerdali phlebovirus | | equivalent name -3052702 | Chaetoceros protobacilladnavirus 2 | | equivalent name -3052702 | Protobacilladnavirus chaetoc | | scientific name -3052704 | Protobacilladnavirus hasleos | | scientific name -3052704 | Snail associated protobacilladnavirus 2 | | equivalent name -3052705 | Protobacilladnavirus mudflat | | scientific name -3052705 | Snail associated protobacilladnavirus 1 | | equivalent name -3052711 | Chiropteran protoparvovirus 1 | | equivalent name -3052711 | Protoparvovirus chiropteran1 | | scientific name -3052719 | Protoparvovirus rodent3 | | scientific name -3052719 | Rodent protoparvovirus 3 | | equivalent name -3052723 | Golden reptarenavirus | | equivalent name -3052723 | Reptarenavirus aurei | | scientific name -3052724 | California reptarenavirus | | equivalent name -3052724 | Reptarenavirus californiae | | scientific name -3052730 | Caprine respirovirus 3 | | equivalent name -3052730 | Respirovirus caprae | | scientific name -3052748 | Insect shangavirus | | equivalent name -3052748 | Shangavirus shuangaoense | | scientific name -3052748 | Shuangao insect herbevirus 1 | | equivalent name -3052749 | Shaspivirus aranei | | scientific name -3052749 | Spider shaspivirus | | equivalent name -3052756 | Strider striwavirus | | equivalent name -3052756 | Striwavirus sanxiaense | | scientific name -3052771 | Tetraparvovirus ungulate 1 | | includes -3052771 | Tetraparvovirus ungulate1 | | scientific name -3052771 | Ungulate tetraparvovirus 1 | | equivalent name -3052800 | HpTV-2 | | acronym -3052800 | Huangpi uukuvirus | | equivalent name -3052800 | Uukuvirus huangpiense | | scientific name -3052813 | Blueberry fruit drop associated virus | | equivalent name -3052813 | Vaccinivirus cadovaccinii | | scientific name -3052826 | Shrimp wenrivirus | | equivalent name -3052826 | Wenrivirus penaei | | scientific name -3052827 | Insect wuhivirus | | equivalent name -3052827 | Wuhivirus insecti | | scientific name -3054905 | Moreae | | scientific name -3054905 | Moreae Dumort., 1829 | | authority -3058443 | SCWL tick virus | | scientific name -3058444 | Sichuan tick virus | | scientific name -3059782 | Blattambidensovirus incertum1 | | scientific name -3060718 | Soymovirus eleocharis | | scientific name -3064797 | Haladaptataceae | | scientific name -3064797 | Haladaptataceae Chuvochina et al. 2024 | | synonym -3064797 | Haladaptataceae Cui et al. 2023 | | authority -3072906 | Musteloidea | | scientific name -3073806 | Otidimorphae | | scientific name -3073806 | bustards, cuckoos & allies | | genbank common name -3073808 | Telluraves | | scientific name -3073808 | core landbirds | | genbank common name -3073809 | Australaves | | scientific name -3073809 | Australaves Ericson, 2011 | | authority -3073810 | Coraciimorphae | | scientific name -3073811 | Accipitrimorphae | | scientific name -3073812 | Aequornithes | | scientific name -3073812 | Aequornithes Mayr, 2011 | | authority -3073812 | core waterbirds | | genbank common name -3078114 | Neoaves | | scientific name -3079366 | Hepeviridae | | scientific name -3079366 | Hepeviridae_temp | | equivalent name -3101718 | Carsidarinae | | scientific name -3118152 | Hafnia sp. KE9867 | | scientific name -3137121 | Anemone | | scientific name -3137121 | Anemone L., 1753 | | authority -3143224 | Melanastera | | scientific name -3143224 | Melanastera Serbina, Malenovsky, Queiroz & Burckhardt, 2023 | | authority -3151693 | Bunyaviricetes | | scientific name -3151837 | Elliovirales | | scientific name -3151838 | Gredzevirales | | scientific name -3151839 | Hareavirales | | scientific name -3151840 | Jormunvirales | | scientific name -3151845 | Saturnivirales | | scientific name -3152106 | Adamaviridae | | scientific name -3152107 | Anicreviridae | | scientific name -3152110 | Botybirnaviridae | | scientific name -3152116 | Draupnirviridae | | scientific name -3152119 | Fusagraviridae | | scientific name -3152120 | Gandrviridae | | scientific name -3152124 | Inseviridae | | scientific name -3152126 | Kanorauviridae | | scientific name -3152141 | Orthototiviridae | | scientific name -3152142 | Ouroboviridae | | scientific name -3152144 | Phlegiviridae | | scientific name -3152146 | Pistolviridae | | scientific name -3152147 | Pseudototiviridae | | scientific name -3152207 | Deltarhabdovirinae | | scientific name -3152209 | Feraresvirinae | | scientific name -3152475 | Celebovirus | | scientific name -3152483 | Stoorivirus | | scientific name -3152501 | Manawavirus | | scientific name -3152639 | Gammaricinrhavirus | | scientific name -3152641 | Stangrhavirus | | scientific name -3152653 | Citiorivirus | | scientific name -3152867 | Fusagravirus | | scientific name -3152873 | Satyrivirus | | scientific name -3152905 | Insevirus | | scientific name -3152926 | Ninurtavirus | | scientific name -3153030 | Dorisivirus | | scientific name -3153055 | Tethyvirus | | scientific name -3153067 | Phlegivirus | | scientific name -3153072 | Pistolvirus | | scientific name -3239873 | Dipodascomycetes | | scientific name -3239873 | Dipodascomycetes M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority -3239874 | Pichiomycetes | | scientific name -3239874 | Pichiomycetes M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority -3240463 | Potyvirus alliumagrestis | | scientific name -3240468 | Potyvirus arracachae | | scientific name -3240474 | Potyvirus barbacenense | | scientific name -3240485 | Potyvirus calistephi | | scientific name -3240497 | Potyvirus caryae | | scientific name -3240498 | Potyvirus catharantessellati | | scientific name -3240517 | Potyvirus cyrtanthi | | scientific name -3240525 | Potyvirus duobatatae | | scientific name -3240527 | Potyvirus euphorbiae | | scientific name -3240530 | Potyvirus gebatatae | | scientific name -3240544 | Potyvirus hippeastri | | scientific name -3240546 | Potyvirus impatiensis | | scientific name -3240548 | Potyvirus iriseverum | | scientific name -3240550 | Potyvirus jasmini | | scientific name -3240554 | Potyvirus lactucaitalicense | | scientific name -3240568 | Potyvirus nicotianamaculae | | scientific name -3241188 | apricot vein clearing associated virus | | scientific name -3243772 | Dipodascales | | scientific name -3243772 | Dipodascales M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority -3243775 | Pichiales | | scientific name -3243775 | Pichiales M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority -3303203 | CAH clade | | common name -3303203 | Candidozyma | | scientific name -3303203 | Candidozyma Q.M. Wang, Yurkov, Boekhout & F.Y. Bai, 2024 | | authority -3342348 | Oceanites oceanicus chilensis | | scientific name -3342348 | Oceanites oceanicus chilensis Murphy, 1936 | | authority -3358290 | Formosan arrowfin goby | | genbank common name -3358290 | Oligolepis formosanus | | scientific name -3358290 | Oligolepis formosanus (Nichols, 1958) | | authority -3358290 | Oxyurichthys formosanus | | synonym -3358290 | Oxyurichthys formosanus Nichols, 1958 | | authority -3366610 | "Euryarchaeida" Luketa 2012 | | authority -3366610 | Euryarchaeida | | synonym -3366610 | Methanobacteriati | | scientific name -3366610 | Methanobacteriati (Garrity and Holt 2023) Oren and Goker 2024 | | authority -3368986 | Haladaptatus sp. CMAA 1909 | | scientific name -3368987 | Haladaptatus sp. CMAA 1911 | | scientific name -3379134 | Pseudomonadati | | scientific name -3379134 | Pseudomonadati (Gibbons and Murray 1978) Oren and Goker 2024 | | authority -3390273 | Klebsiella pneumoniae complex | | scientific name -3403061 | Viruses incertae sedis | | scientific name -3412625 | Commensaviricota | | scientific name -3412723 | Cardeaviricetes | | scientific name -3415267 | Alphatotivirineae | | scientific name -3417955 | Entransiales | | scientific name -3417957 | Entransiaceae | | scientific name -3420546 | Sanitavirales | | scientific name -3421323 | Betatotivirineae | | scientific name -3424890 | Alphacytorhabdovirus | | scientific name -3424891 | Betacytorhabdovirus | | scientific name -3424976 | Unirnavirus | | scientific name -3425084 | Crabreovirus | | scientific name -3425096 | Rhabdoviridae incertae sedis | | scientific name -3425105 | Alphaplatrhavirus | | scientific name -3425826 | Ritunrivirus | | scientific name -3426109 | Alphacytorhabdovirus alphawuhaninsectum | | scientific name -3426122 | Alphacytorhabdovirus betawuhaninsectum | | scientific name -3426137 | Alphacytorhabdovirus gammawuhaninsectus | | scientific name -3426146 | Alphacytorhabdovirus lycopersici | | scientific name -3426172 | Alphaendornavirus cucumis | | scientific name -3426174 | Alphaendornavirus erysiphes | | scientific name -3426175 | Alphaendornavirus fucapsici | | scientific name -3426179 | Alphaendornavirus hordei | | scientific name -3426186 | Alphaendornavirus psophocarpi | | scientific name -3426258 | Alphaplatrhavirus vulpes | | scientific name -3426277 | Alpharicinrhavirus huangpi | | scientific name -3426285 | Alpharicinrhavirus taishun | | scientific name -3426347 | Ampelovirus tredecimvitis | | scientific name -3426670 | Begomovirus abelsmoschusomanense | | scientific name -3426674 | Begomovirus ageravenae | | scientific name -3426677 | Begomovirus alceamuvisi | | scientific name -3426712 | Begomovirus capsicumthailandense | | scientific name -3426730 | Begomovirus chlorocucumis | | scientific name -3426765 | Begomovirus deinbolliae | | scientific name -3426792 | Begomovirus gossypiflavi | | scientific name -3426840 | Begomovirus macroptilicommunis | | scientific name -3426844 | Begomovirus macroptilimusivi | | scientific name -3426850 | Begomovirus malvastrumflavi | | scientific name -3426852 | Begomovirus malvastrumhonghense | | scientific name -3426866 | Begomovirus melochiae | | scientific name -3426867 | Begomovirus melochiaflavi | | scientific name -3426880 | Begomovirus nicotianacubaense | | scientific name -3426899 | Begomovirus pavoniaflavi | | scientific name -3426905 | Begomovirus phaseoligallici | | scientific name -3426918 | Begomovirus ramiis | | scientific name -3426929 | Begomovirus sennae | | scientific name -3426935 | Begomovirus sidaflavachinaense | | scientific name -3426951 | Begomovirus sidamusivi | | scientific name -3426968 | Begomovirus sidavenae | | scientific name -3426987 | Begomovirus solanumburkinafasoense | | scientific name -3426990 | Begomovirus solanumcomorosense | | scientific name -3427005 | Begomovirus solanumflavuscontorsionis | | scientific name -3427008 | Begomovirus solanumflavushuangbaiense | | scientific name -3427013 | Begomovirus solanumflavusmaliense | | scientific name -3427043 | Begomovirus solanumliwaense | | scientific name -3427106 | Begomovirus vincae | | scientific name -3427111 | Begomovirus wissadulaflavi | | scientific name -3427192 | Betacytorhabdovirus hordei | | scientific name -3427224 | Betaendornavirus roselliniae | | scientific name -3427248 | Betapartitivirus cannabis | | scientific name -3427251 | Betapartitivirus fusarii | | scientific name -3427352 | Betasatellite momordicae | | scientific name -3427357 | Betasatellite nicotianasheikhupuraense | | scientific name -3427360 | Betasatellite phaseoli | | scientific name -3427361 | Betasatellite pisi | | scientific name -3427400 | Betasatellite solanipakistanense | | scientific name -3427571 | Botoulivirus botrytidis | | scientific name -3427581 | Botybirnavirus ichi | | scientific name -3427583 | Botybirnavirus ni | | scientific name -3427666 | Bymovirus oryzae | | scientific name -3427713 | Capillovirus alpharibis | | scientific name -3427722 | Capulavirus euphorbiae | | scientific name -3427735 | Carlavirus alphacapsici | | scientific name -3427738 | Carlavirus alphaligustri | | scientific name -3427747 | Carlavirus chisolani | | scientific name -3427752 | Carlavirus deltasambuci | | scientific name -3427755 | Carlavirus epsilonsambuci | | scientific name -3427756 | Carlavirus gammasambuci | | scientific name -3427760 | Carlavirus ipomoeae | | scientific name -3427761 | Carlavirus jasmini | | scientific name -3427773 | Carlavirus latensnerinis | | scientific name -3427788 | Carlavirus pisi | | scientific name -3427841 | Celebovirus lorelli | | scientific name -3427963 | Citiorivirus crordgris | | scientific name -3427967 | Citlodavirus citri | | scientific name -3428012 | Closterovirus tabaci | | scientific name -3428035 | Colecusatellite ageravenachinaense | | scientific name -3428042 | Colecusatellite gossypimultanense | | scientific name -3428104 | Crabreovirus callinectes | | scientific name -3428201 | Deltaflexivirus fusarii | | scientific name -3428207 | Deltapartitivirus duocapsici | | scientific name -3428321 | Dorisivirus aiptaes | | scientific name -3428514 | Enterovirus lesimi | | scientific name -3428669 | Felismacovirus porci4 | | scientific name -3428775 | Fijivirus zeae | | scientific name -3428809 | Foveavirus duoasiaticum | | scientific name -3428880 | Fusagravirus hachi | | scientific name -3428898 | Fusagravirus shichi | | scientific name -3428964 | Gammaricinrhavirus tacheng | | scientific name -3429213 | Hepatovirus bephopi | | scientific name -3429215 | Hepatovirus devoli | | scientific name -3429219 | Hepatovirus hedgi | | scientific name -3429220 | Hepatovirus ishrewi | | scientific name -3429932 | Ilarvirus PrRSV | | scientific name -3429955 | Insevirus ichi | | scientific name -3429963 | Insevirus kyu | | scientific name -3429964 | Insevirus ni | | scientific name -3429978 | Ipomovirus cocciniae | | scientific name -3430566 | Macluravirus dioscoreachinense | | scientific name -3430613 | Maldovirus vitis | | scientific name -3430629 | Mamastrovirus hominis | | scientific name -3430652 | Manawavirus kapowais | | scientific name -3430695 | Mastrevirus bourbonense | | scientific name -3430893 | Mischivirus acombewi | | scientific name -3431044 | Nanovirus flavipisi | | scientific name -3431046 | Nanovirus medicagonis | | scientific name -3431121 | Ninurtavirus duliaris | | scientific name -3431136 | Ninurtavirus procoris | | scientific name -3431208 | Nyfulvavirus nylanderiae | | scientific name -3431242 | Orbivirus chenudaense | | scientific name -3431243 | Orbivirus chobarense | | scientific name -3431256 | Orbivirus wadmedaniense | | scientific name -3431303 | Orthohepadnavirus lagothricis | | scientific name -3431365 | Parahepadnavirus osdeorsi | | scientific name -3431402 | Pasivirus agallia | | scientific name -3431495 | Orthoreovirus mahlapitsiense | | scientific name -3431573 | Penoulivirus phomopsis | | scientific name -3431645 | Phlegivirus ni | | scientific name -3431697 | Pistolvirus ni | | scientific name -3431731 | Polerovirus BVG | | scientific name -3431741 | Polerovirus CPPV1 | | scientific name -3431742 | Polerovirus CPPV2 | | scientific name -3431754 | Polerovirus LABYV | | scientific name -3431756 | Polerovirus MAYMV | | scientific name -3431761 | Polerovirus PABYV | | scientific name -3431814 | Pomovirus colombiense | | scientific name -3431861 | Pospiviroid latensportulacae | | scientific name -3432190 | Rosavirus brorati | | scientific name -3432191 | Rosavirus chewhibe | | scientific name -3432238 | Salisharnavirus mirandaeae | | scientific name -3432239 | Salisharnavirus stewardii | | scientific name -3432269 | Satyrivirus cordulis | | scientific name -3432492 | Sobemovirus ARTVA | | scientific name -3432493 | Sobemovirus BSSV | | scientific name -3432496 | Sobemovirus CYCMV | | scientific name -3432503 | Sobemovirus PLYV | | scientific name -3432505 | Sobemovirus ROMOV | | scientific name -3432511 | Sobemovirus SNMOV | | scientific name -3432521 | Sogarnavirus palmerensis | | scientific name -3432584 | Stangrhavirus wuhan | | scientific name -3432597 | Stoorivirus tarnae | | scientific name -3432787 | Tethyvirus nemileis | | scientific name -3432872 | Tobamovirus fructirugosum | | scientific name -3432893 | Tobamovirus tropici | | scientific name -3432941 | Totivirus hachi | | scientific name -3432943 | Totivirus jyu | | scientific name -3432946 | Totivirus jyuichi | | scientific name -3432948 | Totivirus jyuni | | scientific name -3432950 | Totivirus jyusani | | scientific name -3432951 | Totivirus jyushi | | scientific name -3432953 | Totivirus kyu | | scientific name -3432971 | Totivirus shichi | | scientific name -3432979 | Trichomonasvirus vagiprimus | | scientific name -3433039 | Turncurtovirus rapae | | scientific name -3433064 | Unirnavirus beauveriae | | scientific name -3433066 | Unirnavirus cohigginsiani | | scientific name -3433152 | Velarivirus arecae | | scientific name -3433226 | Victorivirus nijyu | | scientific name -3433229 | Victorivirus nijyuichi | | scientific name -3433231 | Victorivirus nijyuni | | scientific name -3433233 | Victorivirus nijyusani | | scientific name -3433234 | Victorivirus nijyushi | | scientific name -3433265 | Vitivirus phivitis | | scientific name -3433267 | Vitivirus viarracaciae | | scientific name -3433335 | Wamavirus alphacitrulli | | scientific name -3433737 | Bostovirus bovis | | scientific name -3433752 | Alphacoronavirus ferrumequini | | scientific name -3433782 | Alphacoronavirus ricketti | | scientific name -3433784 | Alphacoronavirus nyctali | | scientific name -3433814 | Alphacoronavirus suis | | scientific name -3433816 | Infratovirus hubeiense | | scientific name -3433830 | Potexvirus ecsmanihotis | | scientific name -3433836 | Potexvirus ecsplantagonis | | scientific name -3433853 | Potexvirus marmorsennae | | scientific name -3456997 | Saprolegniomycetes | | scientific name -3456997 | Saprolegniomycetes Thines & Beakes, 2015 | | authority diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/nodes.dmp b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/nodes.dmp deleted file mode 100644 index 0dbeed2..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/nodes.dmp +++ /dev/null @@ -1,3599 +0,0 @@ -1 | 1 | no rank | | 8 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | -2 | 131567 | domain | | 0 | 0 | 11 | 0 | 0 | 0 | 0 | 0 | -543 | 91347 | family | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -548 | 570 | species | KA | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified -568 | 1903412 | genus | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -570 | 2890311 | genus | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -573 | 3390273 | species | KP | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified -574 | 573 | subspecies | KP | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified -1224 | 3379134 | phylum | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1236 | 1224 | class | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -2157 | 131567 | domain | | 0 | 0 | 11 | 0 | 0 | 0 | 0 | 0 | -2235 | 183963 | order | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -2759 | 131567 | domain | | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | -2763 | 2759 | phylum | | 4 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2781 | 31469 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -2806 | 2763 | class | | 4 | 1 | 1 | 1 | 4 | 0 | 0 | 0 | code compliant -2870 | 569578 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2886 | 2870 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2887 | 2886 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2888 | 2887 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3041 | 33090 | phylum | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3166 | 2692248 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3176 | 2684882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3178 | 3176 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3193 | 131221 | clade | | 4 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | -3208 | 3193 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -3214 | 404260 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3296 | 1437180 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant -3297 | 1445963 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3313 | 58019 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3394 | 3297 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3395 | 3394 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3398 | 58024 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3400 | 232347 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3401 | 3400 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3402 | 3401 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3440 | 41768 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3487 | 3744 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3502 | 91835 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3503 | 3502 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3511 | 3503 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3524 | 1437201 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3650 | 71239 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3669 | 1003875 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3744 | 91835 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3745 | 3744 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3764 | 1176516 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3803 | 72025 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3814 | 3803 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3841 | 163735 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4011 | 41937 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4036 | 91882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4037 | 364270 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4055 | 91888 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4143 | 91888 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4149 | 4143 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4199 | 91882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4200 | 4199 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4209 | 91882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4210 | 4209 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4231 | 102814 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4321 | 1802790 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4447 | 1437183 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -4454 | 16360 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4479 | 38820 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4496 | 640623 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4500 | 4496 | species | AL | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -4523 | 1293364 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4581 | 1648004 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4667 | 1437197 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4734 | 1437197 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | -4747 | 73496 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4751 | 33154 | kingdom | | 4 | 0 | 1 | 1 | 4 | 0 | 0 | 0 | code compliant -4762 | 33634 | phylum | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4763 | 3456997 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4764 | 4763 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4769 | 4764 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4890 | 451864 | phylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -4958 | 766764 | genus | | 4 | 1 | 12 | 1 | 4 | 1 | 0 | 0 | code compliant -4972 | 165440 | species | DH | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5036 | 299071 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5037 | 5036 | species | HC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5039 | 229219 | species | BD | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5125 | 222543 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5139 | 222544 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5149 | 35718 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5197 | 388435 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5198 | 157822 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5199 | 5198 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5204 | 451864 | phylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5234 | 155616 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5302 | 5204 | subphylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5303 | 355688 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5305 | 396331 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5314 | 5317 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5317 | 5303 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5338 | 452333 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5455 | 681950 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5500 | 33184 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5501 | 5500 | species | CI | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5506 | 110618 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5550 | 34384 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5551 | 5550 | species | TR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5794 | 33630 | phylum | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5796 | 1280412 | subclass | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5809 | 423054 | family | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5819 | 422676 | order | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5820 | 1639119 | genus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5825 | 418101 | species | PC | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5857 | 418103 | species | PF | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5860 | 418101 | species | PV | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5863 | 422676 | order | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5872 | 5873 | species | TE | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5873 | 27994 | genus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5874 | 5873 | species | TA | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -6072 | 33208 | clade | | 1 | 1 | 1 | 1 | 5 | 0 | 1 | 0 | -6073 | 6072 | phylum | | 1 | 1 | 1 | 1 | 4 | 0 | 0 | 0 | code compliant -6101 | 6073 | class | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -6102 | 6101 | subclass | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -6125 | 6102 | order | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -6126 | 123757 | family | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -6127 | 6126 | genus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -6157 | 1206795 | phylum | | 1 | 1 | 1 | 1 | 9 | 0 | 0 | 0 | code compliant -6159 | 166126 | order | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -6199 | 6157 | class | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -6200 | 6199 | subclass | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -6217 | 1206795 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6218 | 6217 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6219 | 6218 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6222 | 6219 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6231 | 1206794 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6236 | 119089 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6249 | 6274 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6267 | 33256 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6274 | 6236 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6447 | 1206795 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6544 | 6447 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6599 | 2785011 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -6656 | 88770 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6657 | 197562 | subphylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6681 | 2172821 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6682 | 72041 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6683 | 6682 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6692 | 6683 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6712 | 6692 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6738 | 6692 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6744 | 6738 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6745 | 6744 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6746 | 6745 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6752 | 6692 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6960 | 197562 | subphylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6961 | 33339 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6970 | 33341 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6993 | 33341 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6994 | 6993 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7041 | 33392 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7042 | 71529 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7088 | 85604 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7089 | 37569 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7100 | 37570 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7147 | 33392 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7148 | 7147 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7157 | 41827 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7158 | 1056966 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7399 | 33392 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7400 | 7399 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7401 | 7400 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7402 | 7401 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7434 | 7400 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7458 | 3042114 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7459 | 83321 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7496 | 85512 | subclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7516 | 85817 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7524 | 33342 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7581 | 35070 | order | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -7586 | 33511 | phylum | | 1 | 1 | 1 | 1 | 9 | 0 | 0 | 0 | code compliant -7711 | 33511 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7742 | 89593 | clade | | 10 | 0 | 1 | 1 | 2 | 1 | 0 | 0 | -7776 | 7742 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -7777 | 7776 | class | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -7778 | 7777 | subclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -7898 | 117571 | superclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -7952 | 186627 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -7953 | 30727 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -7982 | 30725 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -7983 | 278169 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8006 | 41705 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8015 | 8006 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8033 | 504568 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8034 | 8033 | species | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -8035 | 8034 | subspecies | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -8111 | 1489922 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8113 | 1489911 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8205 | 8111 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8219 | 1489878 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8220 | 8219 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8252 | 1489904 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8256 | 30942 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8287 | 117571 | superclass | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -8292 | 32523 | class | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8293 | 41666 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8294 | 30367 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8295 | 8294 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8306 | 8295 | species | AT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -8342 | 41666 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8416 | 8342 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8426 | 8416 | superfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8427 | 8426 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8457 | 32524 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -8492 | 1329799 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -8782 | 436492 | class | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8825 | 8782 | infraclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8826 | 1549675 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8827 | 8826 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8828 | 8827 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8906 | 3078114 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8936 | 3073810 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8940 | 3073806 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8941 | 8940 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8948 | 3073809 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8949 | 8948 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8955 | 56259 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9108 | 3078114 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9126 | 3073809 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9219 | 3073810 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9223 | 3073809 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9224 | 9223 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9230 | 3073812 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9231 | 9230 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9239 | 9231 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9263 | 32525 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -9265 | 38605 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9266 | 126287 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9347 | 32525 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -9397 | 314145 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9431 | 30560 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9434 | 9431 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9655 | 3072906 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9671 | 169417 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9672 | 9671 | species | PB | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -9681 | 379583 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9688 | 338153 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9690 | 9688 | species | PO | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -9845 | 91561 | suborder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9895 | 35500 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9918 | 27592 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9975 | 314147 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9979 | 9975 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9980 | 9979 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9989 | 314147 | order | | 6 | 0 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -10045 | 10066 | subfamily | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -10066 | 337687 | family | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -10239 | 1 | acellular root | | 9 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | -10293 | 3044472 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10294 | 10293 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10319 | 10293 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10357 | 3044472 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10358 | 10357 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10374 | 3044472 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10404 | 2732515 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10405 | 10404 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10442 | 2840070 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10566 | 173087 | species | HP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10567 | 325456 | species | IX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10639 | 186534 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10652 | 186534 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10780 | 2732534 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10803 | 40119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10811 | 2732539 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10812 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10814 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10841 | 2732414 | family | | 3 | 0 | 11 | 0 | 0 | 1 | 0 | 0 | code compliant -10882 | 2946187 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10892 | 2946186 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10979 | 2946187 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10988 | 2946187 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10989 | 3428775 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10993 | 2732396 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11006 | 2732540 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11007 | 3152141 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11012 | 2732549 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11050 | 2732545 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11095 | 11050 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11102 | 11050 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11118 | 2499399 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11157 | 2497574 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11158 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11229 | 2560076 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11240 | 3052347 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -11270 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11271 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11308 | 2499411 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11318 | 352235 | species | TD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -11319 | 11318 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -11572 | 1980416 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11582 | 2560289 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -11584 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11617 | 3151839 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11632 | 2169561 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11974 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12027 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -12030 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -12031 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -12036 | 2560078 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -12050 | 675072 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12051 | 249184 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12058 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12059 | 2960224 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -12091 | 2946633 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12109 | 2946627 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12137 | 2169577 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12141 | 2560077 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -12160 | 69973 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12163 | 1914297 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12174 | 1914298 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12176 | 675064 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12195 | 39729 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12234 | 675071 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12258 | 675075 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12270 | 675075 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12283 | 2732546 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12289 | 2169577 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12316 | 39740 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12429 | 10239 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -12456 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -12471 | 3432511 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -12701 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -12877 | 12429 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -12929 | 9224 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -13366 | 1156497 | genus | | 4 | 1 | 1 | 1 | 4 | 0 | 0 | 0 | code compliant -13502 | 13366 | species | BN | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -14366 | 1006621 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -16360 | 4447 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant -23461 | 4011 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -24966 | 4055 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -25623 | 1446379 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -25628 | 25623 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -26473 | 216806 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -26867 | 216794 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -27319 | 2916678 | family | | 4 | 1 | 12 | 1 | 4 | 1 | 0 | 0 | code compliant -27337 | 1036719 | species | VD | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -27434 | 33341 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -27483 | 7400 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -27592 | 9895 | subfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -27668 | 9434 | species | ML | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -27708 | 1278288 | species | PC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -27994 | 5863 | family | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -28267 | 11240 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -28725 | 192204 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -28843 | 1224679 | family | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -28890 | 3366610 | phylum | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -29961 | 6712 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -29962 | 116707 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -30092 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -30093 | 38124 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -30102 | 33368 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -30367 | 8293 | superfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -30388 | 8828 | species | CT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -30449 | 3073812 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -30560 | 9397 | suborder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -30725 | 7952 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -30727 | 7952 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -30806 | 8205 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -30871 | 1489943 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -30942 | 8252 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -31271 | 5825 | subspecies | PC | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -31370 | 2045258 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -31371 | 31370 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -31468 | 2045261 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -31469 | 31468 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -31612 | 1972589 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -31870 | 2707348 | species | CG | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -32443 | 41665 | infraclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -32519 | 186634 | subcohort | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -32523 | 1338369 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -32524 | 32523 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -32525 | 40674 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -32561 | 8457 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -32613 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -32620 | 3240548 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -33090 | 2759 | kingdom | | 4 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -33154 | 2759 | clade | | 4 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | -33183 | 451871 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -33184 | 33183 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -33208 | 33154 | kingdom | | 1 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -33213 | 6072 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -33256 | 6249 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33317 | 33213 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -33339 | 7496 | infraclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33340 | 7496 | infraclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33341 | 33340 | cohort | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33342 | 33340 | cohort | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33365 | 1955247 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -33368 | 33365 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33372 | 30102 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33373 | 7524 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33375 | 33373 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33392 | 33340 | cohort | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33415 | 37572 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33511 | 33213 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -33554 | 314145 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -33599 | 8940 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -33600 | 33599 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -33601 | 33600 | species | PC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -33630 | 2698737 | clade | | 1 | 0 | 1 | 1 | 4 | 0 | 0 | 0 | -33634 | 2698737 | clade | | 4 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | -34111 | 35466 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -34145 | 131211 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -34384 | 33183 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -34392 | 34384 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -34397 | 5125 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -34448 | 654128 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -34667 | 71528 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -34735 | 7434 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -35069 | 133550 | class | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -35070 | 35069 | subclass | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -35249 | 10374 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35278 | 439490 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35300 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35303 | 11270 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35323 | 11308 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -35325 | 2559587 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -35342 | 2204151 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35466 | 35491 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -35491 | 2812636 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -35493 | 33090 | phylum | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -35500 | 9845 | infraorder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -35627 | 2231390 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -35634 | 85819 | parvorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -35709 | 1648008 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -35718 | 5139 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -35740 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35741 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35869 | 43951 | species | ZC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -36050 | 569360 | species | FP | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -36291 | 9126 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -37130 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37567 | 41197 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -37569 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -37570 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -37572 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -37573 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -37660 | 35627 | species | SH | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -37754 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37755 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37756 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37757 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37758 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37759 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37760 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37844 | 37945 | subclass | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -37850 | 29961 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -37945 | 6157 | class | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -37960 | 11012 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -38033 | 5149 | species | CG | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -38124 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -38144 | 11050 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -38605 | 9263 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -38820 | 4734 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -38950 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -39249 | 216812 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -39724 | 2732536 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39725 | 39724 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39729 | 2732550 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39731 | 39729 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39733 | 2732551 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39734 | 2560072 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -39738 | 2732548 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -39740 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39750 | 10993 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39756 | 11006 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -39760 | 2732890 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39780 | 35325 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -39804 | 2842995 | species | QF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -39829 | 116707 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -39831 | 573 | subspecies | KP | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified -40065 | 3431242 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -40067 | 3431256 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -40068 | 10892 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -40092 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -40093 | 40092 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -40119 | 10780 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -40120 | 10780 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -40122 | 40120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -40272 | 10357 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -40562 | 2982305 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -40588 | 41938 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -40674 | 32524 | class | | 2 | 0 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -40948 | 241792 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -41071 | 7041 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41073 | 535382 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41084 | 7041 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41088 | 41084 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41154 | 34667 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41155 | 34667 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41191 | 7088 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41196 | 41191 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -41197 | 41196 | parvorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -41479 | 2841720 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -41549 | 742010 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -41665 | 186623 | subclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -41666 | 8292 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -41705 | 1489388 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -41768 | 1437183 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -41773 | 41768 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -41827 | 43786 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41937 | 91836 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -41938 | 91836 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -43358 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -43464 | 8955 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -43786 | 7148 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -43817 | 7157 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -43951 | 3178 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -44560 | 3426674 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -45234 | 474943 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -45357 | 3303203 | species | CH | 4 | 1 | 12 | 0 | 4 | 1 | 1 | 0 | code compliant; specified -45607 | 45787 | species | WS | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -45787 | 410830 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -45950 | 105711 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -45951 | 45950 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -46108 | 1804622 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -46366 | 241785 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -46569 | 1912919 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -46619 | 3240530 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -47455 | 1648023 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -47456 | 47455 | species | PR | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -47520 | 6599 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -47521 | 47520 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -47522 | 47521 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -47523 | 47526 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -47524 | 2741926 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -47526 | 47522 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -47567 | 6267 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -49188 | 1463140 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -49669 | 50362 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -49817 | 3841 | species | EC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -50292 | 3050258 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -50362 | 4667 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -50435 | 2029065 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -50488 | 6961 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -50489 | 70893 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -50515 | 535378 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -50557 | 6960 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -50713 | 1972572 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -51909 | 9224 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -52123 | 85545 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -52360 | 47524 | species | AP | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -52974 | 1034061 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -52975 | 52974 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -52976 | 52975 | species | BP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -53017 | 11318 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -53058 | 158424 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -53124 | 158330 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -53300 | 156511 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -53541 | 7158 | subgenus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -54049 | 8906 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -54057 | 54049 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -54059 | 54057 | species | SP | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -54354 | 9108 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -54355 | 54354 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -54356 | 54355 | species | AG | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -54357 | 9108 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -54358 | 54357 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -54359 | 54358 | species | PC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -54757 | 5860 | subspecies | PV | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -55136 | 1158979 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -55193 | 742845 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -55267 | 6159 | suborder | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -55867 | 7042 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -56259 | 2558200 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56301 | 3073806 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56302 | 56301 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56308 | 3073810 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56309 | 56308 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56310 | 56309 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56311 | 56310 | species | TM | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -56342 | 8949 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56343 | 56342 | species | HC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -56646 | 569360 | species | FV | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -56785 | 28725 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56866 | 3669 | species | LA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -57379 | 3073810 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -57382 | 8940 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -57383 | 8936 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -57401 | 57382 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -57405 | 57383 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -58019 | 1437180 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -58023 | 3193 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -58024 | 78536 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -58627 | 4958 | species | DF | 4 | 1 | 12 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -59171 | 4200 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -59172 | 59171 | species | PR | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -59500 | 3427666 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -60456 | 3052577 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -60807 | 706622 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -60808 | 60807 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -60809 | 60808 | species | SS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -62020 | 50489 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -62110 | 163733 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -62784 | 70905 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -63225 | 9980 | species | LT | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -63405 | 34392 | species | MC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -64021 | 265963 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -64579 | 65009 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -65009 | 40588 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant -65068 | 3048251 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -65386 | 735337 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -66236 | 35634 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -67753 | 69973 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -67762 | 291027 | species | TL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -68416 | 3431303 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -69720 | 293500 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -69721 | 69720 | species | ZA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -69973 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -70085 | 497679 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -70170 | 702736 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -70439 | 30806 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -70440 | 70439 | species | CW | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -70564 | 70170 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -70778 | 6127 | species | AN | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -70893 | 50488 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -70905 | 2018325 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -70987 | 7458 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -71112 | 169417 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -71239 | 91835 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -71240 | 1437183 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -71274 | 1437201 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -71275 | 1437201 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -71528 | 41088 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -71529 | 41088 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -71950 | 40562 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -72018 | 198625 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -72019 | 72018 | species | SA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -72025 | 91835 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -72041 | 6681 | subclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -72407 | 573 | subspecies | KP | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified -72876 | 29962 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -73275 | 4231 | species | HA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -73496 | 1437197 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -73501 | 45234 | species | CM | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -74132 | 318529 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -74133 | 74132 | species | SA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -74320 | 3047704 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -74649 | 3764 | species | RC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -74694 | 216795 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -75725 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -75739 | 5796 | order | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -75747 | 3427251 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -76717 | 71112 | species | LC | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -76775 | 55193 | species | MR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -76803 | 2499398 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -76804 | 2732506 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -77519 | 418103 | species | PG | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -78060 | 157822 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -78536 | 58023 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | -79078 | 35627 | species | SS | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -79236 | 3426792 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -79514 | 34667 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -79633 | 52123 | species | OT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -79652 | 85545 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -79653 | 79652 | species | OO | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -82582 | 33415 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -82676 | 325461 | species | OX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -83312 | 7459 | species | AN | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -83321 | 70987 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -83871 | 3052570 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -85103 | 8906 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -85104 | 85103 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -85512 | 50557 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -85545 | 30449 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -85604 | 33392 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -85817 | 33392 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -85819 | 160148 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -85823 | 6970 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -86721 | 3402 | species | MD | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -86989 | 169626 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -86990 | 86989 | species | EH | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -87139 | 55136 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -88159 | 2888 | species | AP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -88770 | 1206794 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -89593 | 7711 | subphylum | | 10 | 0 | 1 | 1 | 2 | 0 | 0 | 0 | code compliant -90010 | 12059 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -91347 | 1236 | order | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -91561 | 314145 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -91771 | 9219 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -91776 | 91771 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -91827 | 71240 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -91835 | 71275 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -91836 | 71275 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -91882 | 71274 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -91888 | 71274 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -92738 | 46569 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -93386 | 3050267 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -94231 | 1505891 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -94243 | 1489894 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -94642 | 5809 | genus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -94643 | 94642 | species | BB | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -94844 | 28843 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -94845 | 94844 | species | LI | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 0 | code compliant; specified -95179 | 7100 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -95337 | 11974 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -95341 | 11974 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -98220 | 2888 | species | AC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -98221 | 2888 | species | AM | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -99756 | 37850 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -100182 | 9980 | species | LG | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -100750 | 33415 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -101203 | 4769 | species | SP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -102804 | 4210 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -102805 | 4210 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -102809 | 102804 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -102814 | 911341 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -102818 | 219103 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -103490 | 3511 | species | QG | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -103723 | 327107 | species | GR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -103955 | 56302 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -103956 | 103955 | species | CC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -104430 | 37567 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -104431 | 37567 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -104435 | 104430 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -104766 | 251095 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -105711 | 278205 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -106324 | 47567 | species | CO | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -106325 | 106324 | subspecies | CO | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -106742 | 72876 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -107843 | 50515 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -107924 | 183385 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -110618 | 5125 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -111067 | 6746 | species | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -111670 | 5199 | species | CR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -112415 | 78060 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -113113 | 57379 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -113114 | 113113 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -113115 | 113114 | species | RC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -114658 | 3214 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -115354 | 104435 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -116704 | 6752 | no rank | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -116707 | 116704 | no rank | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -117010 | 180950 | species | TC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -117570 | 7776 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -117571 | 117570 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -117574 | 10841 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -117677 | 62784 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -117678 | 473626 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -117776 | 6127 | species | AD | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -117778 | 6127 | species | AY | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -117851 | 117893 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -117893 | 7778 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -119089 | 6231 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -119164 | 2169577 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -119257 | 37569 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -120864 | 7402 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -120865 | 120864 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -121422 | 36291 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -121822 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -121823 | 121822 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -121826 | 30093 | species | TU | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -122260 | 28843 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -122261 | 122260 | species | DI | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 0 | code compliant; specified -123365 | 1489388 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -123366 | 123365 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -123367 | 123366 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -123368 | 123367 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -123369 | 123368 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -123757 | 6125 | suborder | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -124006 | 55867 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -124426 | 34397 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -124960 | 4321 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -126287 | 9265 | subfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -127916 | 33154 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -128790 | 3047678 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -128818 | 3430566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -129017 | 166052 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -129725 | 1914297 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -130990 | 3417957 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -130991 | 130990 | species | EF | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -131209 | 131221 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -131210 | 2684882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -131211 | 131210 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -131220 | 35493 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -131221 | 35493 | subphylum | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant -131567 | 1 | cellular root | CO | 8 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -133550 | 7586 | clade | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | -135166 | 9219 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -135167 | 135166 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -135168 | 135167 | species | BC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -135425 | 175121 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -135426 | 667167 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -137443 | 3050317 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -137757 | 39729 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -138977 | 9434 | species | MH | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -140052 | 327045 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -144051 | 232795 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -145388 | 34111 | species | MN | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -147100 | 6157 | class | | 1 | 1 | 1 | 1 | 9 | 0 | 0 | 0 | code compliant -147271 | 1293359 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147366 | 359160 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147368 | 359160 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147369 | 147370 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147370 | 4479 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -147376 | 1648035 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147377 | 1648035 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147387 | 1648037 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147428 | 1648036 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147537 | 716545 | subphylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -147538 | 716545 | subphylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -147545 | 716546 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -147547 | 716546 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -147550 | 715989 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -150311 | 497220 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -151340 | 2788857 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -151341 | 2732532 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -153135 | 327045 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -153286 | 9434 | species | MN | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -153287 | 9434 | species | MT | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -155616 | 5302 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -155619 | 5302 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -155768 | 65386 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -156152 | 4143 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -156208 | 39729 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -156505 | 106742 | species | CI | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -156511 | 1293059 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -156760 | 9239 | species | SM | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -157270 | 3047843 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -157317 | 294824 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -157777 | 3427788 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -157822 | 5197 | suborder | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -158330 | 4747 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -158332 | 4747 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -158391 | 158332 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -158397 | 158332 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -158424 | 158397 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -159141 | 3052437 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -159150 | 3052437 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -159322 | 9434 | species | MA | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -159325 | 9434 | species | MD | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -159332 | 9434 | species | MO | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -159333 | 9434 | species | MR | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -159335 | 9434 | species | MV | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -159337 | 9434 | species | MY | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -160079 | 66236 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -160148 | 1930602 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -160394 | 278171 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -162474 | 1538075 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -163125 | 94243 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -163611 | 319058 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -163725 | 2231387 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -163733 | 2233855 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -163735 | 2233855 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -163739 | 2231385 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -165250 | 157777 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -165440 | 1884640 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -165826 | 3426730 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -166052 | 8427 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -166126 | 147100 | clade | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | -166236 | 55267 | superfamily | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -166243 | 166236 | family | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -166244 | 166243 | subfamily | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -166586 | 53541 | species | AF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -166784 | 8219 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -167449 | 70085 | species | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -168496 | 1503305 | varietas | BA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -168834 | 1895012 | species | PD | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -169417 | 9655 | subfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -169618 | 24966 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -169626 | 169618 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -170325 | 3050251 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -171627 | 5506 | species group | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | -171638 | 3745 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -171788 | 102805 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -171944 | 23461 | species | MS | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -172915 | 2743715 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -172976 | 2781 | species | GL | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -173087 | 333774 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -175121 | 9126 | superfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -175529 | 12929 | species | AG | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -176938 | 57405 | species | CA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -178830 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -178941 | 2218198 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -178948 | 178941 | species | AS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -180252 | 10293 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -180950 | 930979 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -181089 | 135425 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -181124 | 34448 | species | MO | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -181762 | 71950 | species | PC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -182093 | 95337 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -182724 | 155768 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -182725 | 182724 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -183385 | 107843 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -183963 | 2290931 | class | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -184751 | 1914298 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -185002 | 26867 | species | PO | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -185751 | 3403061 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -185752 | 3403061 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -185753 | 185751 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -185756 | 185751 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -185759 | 185752 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -185786 | 10979 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -186121 | 50435 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -186458 | 178830 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -186534 | 2169561 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -186623 | 7898 | class | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -186625 | 1489341 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -186626 | 32519 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -186627 | 186626 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -186634 | 186625 | cohort | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -186766 | 2732502 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -186767 | 186766 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -186886 | 675071 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -186938 | 3152209 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -187214 | 186534 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -190729 | 1993640 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -192204 | 9126 | superfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -192380 | 79514 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -192381 | 192380 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -192382 | 192381 | species | MA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -193267 | 62020 | species | MT | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -194960 | 2946635 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -195059 | 2748959 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -195633 | 8256 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -195798 | 111670 | subspecies | CR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -197056 | 111670 | subspecies | CR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -197112 | 270256 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -197562 | 197563 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -197563 | 6656 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -197613 | 74649 | varietas | RC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -198607 | 1250315 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -198625 | 127916 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -201863 | 11240 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -203261 | 94231 | species | EB | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -205083 | 45951 | species | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -211557 | 211567 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -211558 | 211557 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -211567 | 3039756 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -214437 | 8955 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -215788 | 100750 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -216794 | 156152 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -216795 | 156152 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -216806 | 4149 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -216812 | 4149 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -217160 | 69973 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -219103 | 4210 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -220121 | 53300 | species | MA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -222078 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -222543 | 147550 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -222544 | 147550 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -222556 | 12283 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -223251 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -223286 | 165826 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -223769 | 3047845 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -224510 | 183385 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -225962 | 453050 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -226102 | 49188 | species | AC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -227307 | 687329 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -228457 | 182725 | species | LE | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -228657 | 163739 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -228658 | 228657 | species | EK | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -229219 | 299071 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -231932 | 5305 | species | PC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -232347 | 1437183 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -232795 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -232799 | 699189 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -233784 | 3047850 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -234792 | 172915 | species | SD | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -240201 | 85104 | species | BB | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -241749 | 1729112 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -241750 | 241749 | species | AA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -241751 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -241778 | 4037 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -241780 | 241778 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -241785 | 241778 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -241792 | 241780 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -241932 | 3054905 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -246410 | 5501 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -249184 | 675063 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -249185 | 249184 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -249310 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -249588 | 39733 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -251095 | 2732538 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -252798 | 214437 | species | ST | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -255330 | 453050 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -257883 | 9434 | species | ME | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -260377 | 3427013 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -263002 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -265123 | 291286 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -265963 | 2559587 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -268499 | 37573 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -270256 | 3047819 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -272620 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -274794 | 30871 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -278169 | 7982 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -278171 | 30725 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -278205 | 2908833 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -283494 | 1458186 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -287184 | 115354 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -287195 | 8034 | subspecies | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -290090 | 1195641 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -290849 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -291027 | 10814 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -291286 | 3240527 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -292474 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -292479 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -293500 | 421921 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -294824 | 41155 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -299071 | 33183 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -299368 | 268499 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -301920 | 2741929 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -301921 | 301920 | species | PP | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -306901 | 38033 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -307635 | 252798 | subspecies | ST | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -310684 | 675072 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -311227 | 2946187 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -311900 | 51909 | species | PR | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -314145 | 1437010 | superorder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -314146 | 1437010 | superorder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -314147 | 314146 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -315357 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -315838 | 27483 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -315840 | 315838 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -318529 | 318559 | tribe | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -318546 | 319095 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -318559 | 319056 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -319056 | 8113 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -319058 | 318546 | tribe | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -319095 | 8113 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -320454 | 74133 | subspecies | SA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -320455 | 74133 | subspecies | SA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -321084 | 43464 | species | CP | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -321263 | 9434 | species | MA | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -323096 | 4581 | species | BV | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -323895 | 35709 | species | CC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -324901 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -325454 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -325455 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -325456 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -325459 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -325461 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -327045 | 11632 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -327107 | 249185 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -327375 | 12163 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -327387 | 3432893 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -327770 | 94231 | species | ET | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -328429 | 119164 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -328527 | 2743716 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -329860 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -330383 | 249184 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -333774 | 151340 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -333921 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -333938 | 333774 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -334425 | 270256 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -334873 | 163125 | species | PC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -336476 | 232799 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -336633 | 144051 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -336635 | 232795 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -336987 | 3426880 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -337052 | 325454 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -337687 | 1963758 | clade | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -338153 | 9681 | subfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -339076 | 53058 | species | CP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -341117 | 7983 | species | MB | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -341128 | 160394 | species | BN | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -344417 | 39750 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -345249 | 39725 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -346391 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -347957 | 140052 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -351425 | 129725 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -351426 | 3428809 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -351428 | 351425 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -352235 | 35323 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -352926 | 39733 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -352927 | 67753 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -353154 | 5874 | strain | | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -353769 | 153135 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -354837 | 2839668 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -355688 | 155619 | no rank | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -357852 | 40948 | species | AL | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -358814 | 121422 | species | PA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -359160 | 4479 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -359505 | 46366 | species | BA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -361688 | 2609695 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -364270 | 4036 | suborder | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant -367188 | 3064797 | genus | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -367682 | 797075 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -368620 | 64021 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -369752 | 3240498 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -371833 | 95341 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -371917 | 56785 | species | NC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -375141 | 435738 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -375142 | 375141 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -375143 | 375142 | species | CC | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -376274 | 376275 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -376275 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -377833 | 92738 | no rank | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -379583 | 33554 | suborder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -379584 | 33554 | suborder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -384633 | 9434 | species | MA | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -388435 | 1520881 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -391337 | 260377 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -396331 | 5303 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -397273 | 46108 | species | SM | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -398816 | 336987 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -399178 | 9690 | subspecies | PO | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -399254 | 38124 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -399255 | 399254 | species | AD | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -404260 | 3208 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -404297 | 114658 | superorder | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -405558 | 3240468 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -410297 | 10045 | genus | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -410302 | 410297 | species | GL | 6 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -410830 | 3243772 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -413970 | 39740 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -416867 | 6222 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -416868 | 416867 | species | NG | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -418101 | 5820 | subgenus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -418103 | 5820 | subgenus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -420948 | 87139 | species | AF | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -421010 | 3240544 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -421921 | 4454 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -422676 | 5794 | class | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -423054 | 75739 | suborder | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -423369 | 8034 | subspecies | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -423370 | 8034 | subspecies | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -425264 | 76775 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -427924 | 205083 | subspecies | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -431037 | 40272 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -433372 | 252798 | subspecies | ST | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -435738 | 2072716 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -436486 | 8492 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -436489 | 436486 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -436491 | 436489 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -436492 | 436491 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -437064 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -437489 | 2555566 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -437490 | 437489 | species | SA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -439490 | 2585030 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -441227 | 473626 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -441892 | 2888 | species | AC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -442243 | 215788 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -442302 | 2960910 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -442316 | 82582 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -445316 | 72876 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -446318 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -447093 | 5037 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -450882 | 25628 | species | TF | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -451864 | 4751 | subkingdom | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -451871 | 147545 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -452284 | 5204 | subphylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -452333 | 155619 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -453050 | 3240525 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -456398 | 445316 | species | PS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -461132 | 442243 | species | LL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -464095 | 2732506 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -464925 | 464095 | no rank | | 11 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured -469369 | 475327 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -473626 | 117677 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -473674 | 473713 | subspecies | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -473713 | 117678 | species | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -473783 | 39734 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -473784 | 3048236 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -474943 | 5125 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -475272 | 475327 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -475273 | 475272 | species | EM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -475327 | 7089 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -475347 | 119257 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -475348 | 475347 | species | PF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -478825 | 12058 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -481315 | 3050304 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -484021 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -485724 | 3052579 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -490134 | 68416 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493796 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493797 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493798 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493799 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493800 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493801 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493802 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -494651 | 3052771 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -497220 | 8220 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -497679 | 8220 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -498257 | 27337 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -501251 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -501252 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -504568 | 8015 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -516546 | 41549 | species | CJ | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -526119 | 249588 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -535378 | 41071 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -535382 | 41071 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -535600 | 10780 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -538002 | 73501 | varietas | CM | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -547124 | 311227 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -547455 | 147271 | species | PV | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -548681 | 2731363 | order | | 9 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | code compliant -548688 | 10374 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -552816 | 99756 | species | EL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -554155 | 63405 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -558016 | 10442 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -558017 | 10442 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -558690 | 352927 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -559297 | 5039 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -559298 | 1681229 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -559305 | 5551 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -560253 | 112415 | species | LL | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -564644 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -569360 | 5506 | species group | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -569578 | 2696291 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -570949 | 1250315 | species | CM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -570950 | 1250315 | species | CM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -578617 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -584378 | 41154 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -585893 | 2732549 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -590647 | 3052353 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -590745 | 353769 | species | MM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -626155 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626156 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626157 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626158 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626159 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626160 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626161 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626162 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626163 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626164 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626165 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626166 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626167 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626168 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626169 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626170 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626171 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626172 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626173 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626174 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626175 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626176 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626177 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626178 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626179 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626180 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626181 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626182 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626183 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626184 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626185 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626186 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626187 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626188 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626189 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626190 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626191 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626192 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626193 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626194 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626195 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626196 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626197 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626198 | 37130 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -632743 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -640623 | 1652080 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -642248 | 39724 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -642994 | 442316 | species | HM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -644269 | 31371 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -645133 | 31870 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -649996 | 3427005 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -650164 | 231932 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -652723 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652811 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652812 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652813 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652814 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652815 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652816 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652817 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652818 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652819 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652820 | 35740 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -654128 | 2982316 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -667127 | 39831 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -667151 | 135426 | species | DC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -667167 | 175121 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -667516 | 38144 | species | NV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -667725 | 72019 | strain | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | -674952 | 3152147 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -674953 | 3432979 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -674981 | 3152147 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -674996 | 291027 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -675063 | 2732461 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675064 | 675063 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675068 | 675063 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675071 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675072 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675073 | 675072 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675074 | 464095 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -675075 | 675072 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675845 | 1980412 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -676044 | 3426852 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -676058 | 6127 | species | AR | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -681501 | 241932 | species | TC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -681950 | 1028384 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -685445 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -685899 | 3432503 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -686565 | 10841 | subfamily | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -686982 | 2946630 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -687091 | 299368 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -687329 | 3420546 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -687332 | 687329 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -687339 | 687329 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -687387 | 3048408 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -693996 | 2501931 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -693997 | 3433814 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -695850 | 101203 | strain | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | -696855 | 11974 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -699189 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -702736 | 3050262 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -703582 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -706525 | 82676 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -706526 | 1513275 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -706527 | 1513252 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -706622 | 41073 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -706663 | 7581 | family | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -707741 | 706663 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -715989 | 716546 | clade | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -716545 | 4890 | clade | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -716546 | 147538 | clade | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -735337 | 6599 | infraclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -735504 | 325455 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -742010 | 102818 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -742845 | 162474 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -742914 | 39724 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -748365 | 2721536 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -748366 | 748365 | species | AL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -753343 | 287184 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -759124 | 1231296 | species | BY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -759804 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -763898 | 157317 | species | AS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -766764 | 2916678 | family | | 4 | 1 | 12 | 1 | 4 | 1 | 0 | 0 | code compliant -796900 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796901 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796902 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796903 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796904 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796905 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796906 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796907 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796908 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796909 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796910 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -797075 | 3427773 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -861365 | 39831 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -861561 | 3240517 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -871765 | 687387 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -885375 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -885376 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -886583 | 102809 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -906906 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906907 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906908 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906909 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906910 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906911 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906912 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906913 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -908833 | 186767 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -908834 | 908833 | species | GA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -911341 | 102804 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -930979 | 2982303 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -935296 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -935650 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -936057 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -936058 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -938257 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -939922 | 674981 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -940834 | 1513253 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -941259 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -943329 | 40948 | species | AL | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -944994 | 3426677 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -977912 | 222556 | species | OV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -983644 | 73501 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -988644 | 439490 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -990925 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -992212 | 2748958 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -994805 | 9266 | species | DP | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -997078 | 3426990 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1003875 | 3650 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1005902 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1005903 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1005904 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1006621 | 158391 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1028307 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1028384 | 222543 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1032459 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032460 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032461 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032462 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032463 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032464 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032465 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032466 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1033976 | 3052581 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1033978 | 1028384 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1034061 | 404297 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1035782 | 129017 | species | MM | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1036719 | 1033978 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1037890 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1037908 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1046402 | 3427747 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1048227 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048228 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048229 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048230 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048231 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048232 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048233 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048436 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048668 | 3428042 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1048854 | 3052665 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1049565 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1049657 | 85823 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1050903 | 3428207 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1054649 | 3433064 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1056880 | 4523 | species | NM | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1056966 | 43817 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1070324 | 1513273 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1070408 | 1513260 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1070409 | 1513256 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1070410 | 1513261 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1070413 | 1513256 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1070417 | 1513262 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1071164 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1073966 | 686982 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1074486 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1075431 | 163611 | species | AG | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1077831 | 186766 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1077832 | 1077831 | species | PI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1080004 | 171788 | species | FS | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1080924 | 120865 | species | ZC | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1087440 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087441 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087442 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087443 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087444 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087445 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087446 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087447 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1094167 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1094168 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1094169 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1094170 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1094171 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1096141 | 3052771 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1111709 | 699189 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1112098 | 79653 | subspecies | OO | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1114942 | 3428669 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1115383 | 3395 | species | CS | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1115692 | 3427248 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1123862 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1124990 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1125630 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128946 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128947 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128948 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128949 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128950 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128951 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128952 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128953 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128954 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1132022 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1133751 | 3432492 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1136133 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1136150 | 39249 | species | SC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1156497 | 3243775 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1156769 | 1298633 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1158979 | 117851 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -1159556 | 124426 | species | UV | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1159795 | 205083 | subspecies | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1159796 | 205083 | subspecies | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1159798 | 205083 | subspecies | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1162296 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1162297 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1168062 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1168063 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1168064 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1170422 | 1307798 | species | LV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1170424 | 1307798 | species | NV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1170425 | 1307798 | species | PV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1170656 | 3427106 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1172985 | 2982806 | species | JT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1173713 | 5314 | species | GS | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1173763 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1176516 | 171638 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1177045 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1177046 | 12701 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1177047 | 35300 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1177153 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1182518 | 3430695 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1183241 | 37960 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1185359 | 371833 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1185418 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1185419 | 1460422 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1185420 | 1460422 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1187973 | 2960910 | species | OP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1188990 | 861561 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1193292 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1195163 | 413970 | species | AA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1195641 | 3426935 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1195776 | 195633 | species | PJ | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1196387 | 644269 | species | KM | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1196474 | 41479 | species | AF | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1196494 | 41479 | species | AP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1199150 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1200970 | 2050584 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1200971 | 2010320 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1202142 | 3427967 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1203539 | 1208309 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1203544 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1203545 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1203546 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1203547 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1205678 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1206794 | 33317 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -1206795 | 2697495 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -1208309 | 1891715 | species | DD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1209932 | 2707335 | species | CS | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1212766 | 1460422 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1213620 | 3051989 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1214274 | 166586 | subspecies | AF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1214275 | 166586 | subspecies | AF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1214955 | 2844804 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1216472 | 1678146 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1217821 | 3052256 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1218098 | 574 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1219210 | 73501 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -1221206 | 291027 | species | SC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1221208 | 3052258 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1221437 | 3433265 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1221521 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1223561 | 3052724 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1223562 | 3052723 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1224679 | 6200 | order | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -1225181 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1225182 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1225183 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1226115 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1226680 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1228988 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1230847 | 186121 | species | MA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1231296 | 283494 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1231522 | 3303203 | species | CD | 4 | 1 | 12 | 0 | 4 | 1 | 1 | 0 | code compliant; specified -1231523 | 45357 | varietas | CH | 4 | 1 | 12 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1232392 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1232637 | 10293 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1233522 | 696855 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1236101 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1236102 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1236400 | 1723728 | species | PT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1236676 | 2810354 | species | IU | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1238886 | 675073 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1239565 | 3430629 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1241370 | 3426670 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1241918 | 222556 | species | LB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1244085 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1248396 | 1513263 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1249508 | 11102 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1250315 | 12877 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1250520 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1263871 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1267897 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1268974 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1269006 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1272960 | 1972597 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1273128 | 3427357 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1274605 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274606 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274607 | 37130 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274608 | 37130 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274609 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274610 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274611 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274613 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274614 | 35741 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274615 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1276652 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1276653 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1278288 | 2743705 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1279040 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1279099 | 2955836 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1280412 | 5794 | class | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1284787 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284788 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284789 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284790 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284791 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284792 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284793 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284794 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284795 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284796 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284797 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284798 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284799 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284800 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284801 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284802 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284803 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284804 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284805 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284806 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284807 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284808 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284809 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284810 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284811 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284812 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284813 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284814 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284815 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284816 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284817 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284818 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284819 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284820 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284821 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284822 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284823 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284824 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284825 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284826 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284827 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284828 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284829 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284830 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284831 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284832 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284833 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284834 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1285372 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1285373 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1285596 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1285597 | 1285596 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1290996 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1292273 | 166244 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -1293059 | 39829 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1293356 | 1648033 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1293359 | 1293356 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1293364 | 147428 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1294138 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1294139 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1294140 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1294141 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1294269 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1298631 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1298633 | 194960 | species | KC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1299309 | 2560077 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1300166 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1300981 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300982 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300983 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300984 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300985 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300986 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300987 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300988 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300989 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300990 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300991 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300992 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300993 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300994 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300995 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300996 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300997 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300998 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300999 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301000 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301001 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301002 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301003 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301004 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301005 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301006 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301007 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301008 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301009 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301010 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301011 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301012 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301013 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301014 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301015 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1302145 | 181089 | species | AG | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1303385 | 3427043 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1304916 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304917 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304918 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304919 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304920 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304921 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304922 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304923 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304924 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1306546 | 2022857 | species | CM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1306950 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1307798 | 35278 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1307799 | 11050 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1307958 | 3427760 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1308539 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308684 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308685 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308686 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308687 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308688 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308731 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308858 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1309536 | 107924 | species | PO | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1310158 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1310159 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1310424 | 37960 | species | VD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1315262 | 1513265 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1316582 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1316938 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1316939 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328324 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328325 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328337 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328362 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328363 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328364 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328366 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328367 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328368 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328369 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328370 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328371 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328372 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328373 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328375 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328377 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328378 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328379 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328380 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328381 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328382 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328383 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328384 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328385 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328386 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328387 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328388 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328389 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328390 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328391 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328392 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328393 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328394 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328396 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328398 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328399 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328400 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328401 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328402 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328403 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328404 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328405 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328406 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328407 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328408 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328409 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328410 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328411 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328412 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328413 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328414 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328415 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328416 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328417 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328418 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328419 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328420 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328421 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328423 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328424 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328425 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328426 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328427 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1329649 | 1507402 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1329799 | 32561 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -1329801 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1329843 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1331744 | 3433836 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1335476 | 2170170 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1335477 | 2170171 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1338369 | 8287 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -1341693 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1343063 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1343920 | 1914295 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1345628 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1345631 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1348659 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1352932 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1352933 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1357295 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1365186 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1379687 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1379688 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1379689 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1380111 | 473713 | subspecies | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1380456 | 473713 | subspecies | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1380908 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1381121 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1382995 | 3052702 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1384549 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1384550 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1385657 | 686565 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1387562 | 33184 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1387563 | 1387562 | species | OO | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1389422 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1392499 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1392500 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1393935 | 138977 | subspecies | MH | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1393936 | 138977 | subspecies | MH | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1395574 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1395575 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400138 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400139 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400140 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400141 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400142 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400143 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400144 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400145 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400160 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400161 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400162 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400163 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400164 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400165 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400166 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400167 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400168 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400169 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400170 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400172 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400173 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400174 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400175 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400176 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400177 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400178 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400179 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400180 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400181 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400182 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400183 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400184 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400185 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1401779 | 2768478 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1406314 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1409961 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1409962 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1409963 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1409964 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1409965 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1409966 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1411646 | 573 | isolate | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1413252 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1413253 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1414655 | 3052569 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1414807 | 315840 | species | PC | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1415246 | 354837 | species | CM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1416941 | 34145 | species | CB | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1417983 | 72407 | isolate | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1418810 | 119257 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1418811 | 1418810 | species | MH | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1420012 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1420013 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1424547 | 147271 | species | PP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1427476 | 2788865 | species | CV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1427522 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1428763 | 40068 | species | TO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1431455 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432547 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432550 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432552 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432553 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432554 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432558 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432561 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432563 | 3432505 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1434070 | 2169886 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1435450 | 473783 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1436892 | 3431044 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1437010 | 9347 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -1437180 | 58024 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | -1437183 | 3398 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | -1437197 | 4447 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant -1437201 | 91827 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1438697 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438698 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438699 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438701 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438702 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438703 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438704 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438705 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438706 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438707 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438708 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438709 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438710 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438711 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438712 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438713 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438714 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438715 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438716 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438717 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438718 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438719 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438720 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438721 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438722 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438723 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438724 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438725 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438726 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438727 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438728 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438729 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438730 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438731 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438732 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438733 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438734 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438735 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438736 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438737 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438738 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438739 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438740 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438741 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438742 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438743 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438744 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438745 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438746 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438747 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438748 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438749 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438750 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438751 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438752 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438753 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438754 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438755 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438756 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438757 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438758 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438759 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438760 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438761 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438762 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438763 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438764 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438765 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438766 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438767 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438768 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438769 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438770 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438771 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438772 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438773 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438774 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438775 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438776 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438777 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438778 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438779 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438780 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438781 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438782 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438783 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438784 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438785 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438786 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438787 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438788 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438789 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438790 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438792 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438793 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438794 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438795 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438796 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438797 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438798 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438800 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438802 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438803 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438804 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438805 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438806 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438807 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438808 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438809 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438810 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438811 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1439320 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1439321 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1439322 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1439323 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1442610 | 257883 | subspecies | ME | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1445963 | 3296 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1446379 | 2821351 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1449984 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1449985 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1451263 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1451298 | 160079 | species | AD | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1452516 | 1298633 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1453155 | 753343 | species | HR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1453426 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1454021 | 3431136 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454022 | 3430652 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454023 | 3431121 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454024 | 3427841 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454025 | 3432597 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454026 | 35342 | species | DL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454027 | 35342 | species | DL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454028 | 35342 | species | DL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454029 | 35342 | species | DL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454030 | 3427963 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454227 | 3428035 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1455602 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1455603 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1455604 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1455605 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1457165 | 1307798 | species | WV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1457322 | 3052666 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1457503 | 62110 | species | DA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1458186 | 3403061 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1460422 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1461176 | 41773 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1462681 | 3431761 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1462682 | 3431754 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1462708 | 56866 | varietas | LA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1462709 | 56866 | varietas | LA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1463138 | 3440 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1463140 | 1463138 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1463147 | 1463138 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1463675 | 57401 | species | CB | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1471299 | 3047854 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1476584 | 3047783 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1481465 | 1238886 | species | TN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1484106 | 3137121 | species | AT | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1489341 | 32443 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -1489388 | 186625 | cohort | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -1489872 | 123369 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -1489875 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -1489878 | 1489875 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1489885 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -1489894 | 1489885 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1489904 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -1489908 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -1489910 | 1489908 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1489911 | 1489910 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1489922 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -1489943 | 8111 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1497848 | 39756 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1503289 | 2501927 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1503291 | 2501928 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1503292 | 2501926 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1503293 | 2691594 | species | BX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1503305 | 26473 | species | BA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1504569 | 3426258 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1504732 | 944994 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1505891 | 274794 | tribe | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1506574 | 40119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1507401 | 40119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1507402 | 1507401 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1507725 | 1231296 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1510155 | 93386 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1511771 | 2946640 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511775 | 2946635 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511778 | 2946627 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511779 | 3430893 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1511782 | 2946640 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511783 | 3431402 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1511784 | 1511783 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1511804 | 2946635 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511809 | 37960 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1511810 | 11012 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511860 | 2732549 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511911 | 40119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1513238 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513243 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513244 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513246 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513252 | 1513243 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513253 | 1513244 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513256 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513260 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513261 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513262 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513263 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513265 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513273 | 333921 | species | XX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513275 | 936058 | species | UX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513294 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1513308 | 69973 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1520881 | 147547 | clade | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | -1529392 | 3052730 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1534549 | 1511775 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1535266 | 1542665 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1537102 | 5872 | strain | | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -1537975 | 1978543 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1538075 | 452284 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1542665 | 1231296 | species | MY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1542744 | 1910928 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1548713 | 186458 | species | OA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1548718 | 1548713 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1548720 | 186458 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1548722 | 186458 | species | OA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1549198 | 311900 | subspecies | PR | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1549675 | 8825 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1549864 | 2034996 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1550518 | 1972596 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1554466 | 584378 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1562068 | 1902501 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1563660 | 3048345 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1565088 | 3433066 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1566705 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1566718 | 1566705 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1567544 | 171627 | species | FT | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1569052 | 327375 | species | EC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1569053 | 327375 | species | EC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1569054 | 2169801 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1569055 | 2169802 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1569056 | 2169803 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1569258 | 2734409 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1573459 | 1747648 | species | RN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1577137 | 2845625 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1585420 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1592764 | 1987744 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1602124 | 3432496 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1603563 | 35740 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1603564 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1604871 | 90010 | species | YE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1604875 | 1891741 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1606764 | 12109 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1606765 | 1606764 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608041 | 2843859 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608042 | 2845619 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608044 | 2845620 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608045 | 2845621 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608047 | 3052520 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608048 | 3052800 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608049 | 3426277 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608058 | 1884461 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608060 | 3052756 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608063 | 2501942 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608064 | 35303 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608065 | 2845713 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608066 | 2846195 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608067 | 2846193 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608068 | 3052749 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608072 | 988644 | species | SB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608075 | 3052748 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608083 | 3052536 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608085 | 35303 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608086 | 2845639 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608087 | 2845621 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608088 | 2501945 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608089 | 3428964 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608090 | 3426285 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608091 | 1977105 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608093 | 2843935 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608094 | 3052540 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608095 | 3052826 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608097 | 3052553 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608100 | 35303 | species | WA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608101 | 3052632 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608102 | 2844095 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608104 | 2846668 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608105 | 2844861 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608107 | 3052827 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608109 | 2734386 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608110 | 2734387 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608111 | 2734388 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608112 | 35303 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608114 | 2845539 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608119 | 1978541 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608123 | 2844833 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608126 | 3052554 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608127 | 3052543 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608133 | 2844037 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608134 | 3432584 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608137 | 2846667 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608138 | 2845626 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608139 | 3052248 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608141 | 1884460 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608144 | 3052212 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608146 | 1978539 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608533 | 3429955 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1609290 | 3427400 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1611877 | 2734433 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1615583 | 182093 | species | VF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1615758 | 3052522 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1620892 | 2734371 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1622024 | 347957 | species | DR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1628834 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1629665 | 2956585 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1629666 | 2955770 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1629667 | 2956586 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1629671 | 988644 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1631554 | 1986112 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1634381 | 1723728 | species | SP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1639119 | 5819 | family | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1640277 | 2788865 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1642018 | 3051977 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1642515 | 3048458 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1646350 | 198607 | species | TV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1647924 | 735504 | species | HP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1648004 | 147376 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1648008 | 147376 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1648023 | 147377 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1648033 | 147369 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1648035 | 147366 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1648036 | 147369 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1648037 | 147368 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1648481 | 464925 | species | AP | 11 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured -1648482 | 464925 | species | AP | 11 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured -1648483 | 464925 | species | AP | 11 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured -1648484 | 464925 | species | AP | 11 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured -1652080 | 147387 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1653394 | 11617 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1653395 | 11617 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1654339 | 3427583 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1654355 | 675074 | species | KV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1654357 | 1111709 | species | LJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1654603 | 3433152 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1655644 | 117574 | species | PP | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655645 | 117574 | species | PP | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655646 | 1385657 | species | GB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655647 | 117574 | species | MB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655648 | 117574 | species | MB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655649 | 1385657 | species | GB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655650 | 1385657 | species | GB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655651 | 117574 | species | MB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655652 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655653 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655654 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655655 | 1655647 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1655656 | 1385657 | species | GF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655657 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655658 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655659 | 1385657 | species | GF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655660 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655661 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655662 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1658615 | 2748967 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1659219 | 1897731 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1659220 | 1897731 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1661062 | 2955454 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1661063 | 2732549 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1661392 | 344417 | species | VT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1661395 | 1986960 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1661396 | 3433226 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1662272 | 526119 | species | DA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1662286 | 1723728 | species | ME | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1662464 | 1285597 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1663127 | 2219055 | species | PX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1663197 | 328527 | species | GT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1667384 | 2956328 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1667587 | 50292 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1670662 | 3052180 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1670669 | 2788865 | species | LR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1670973 | 2844799 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1670975 | 39780 | species | UV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1671382 | 352926 | species | AE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1675862 | 3047795 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1675864 | 1111709 | species | OI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1675865 | 2560642 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1675866 | 3048442 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1676181 | 117574 | species | CF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1676183 | 117574 | species | CF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1676267 | 1662464 | species | RN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1678003 | 291027 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1678042 | 441227 | species | IM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1678146 | 2948661 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1679172 | 3431243 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1679238 | 2560479 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1679933 | 2955300 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1680130 | 564644 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1681229 | 229219 | species | BG | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1682186 | 330383 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1682187 | 330383 | species | VT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1682340 | 2169902 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1685502 | 37960 | species | PD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1685755 | 3432269 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1685953 | 38144 | species | ME | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1688637 | 3240554 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1690666 | 336476 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1690672 | 3431365 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692045 | 3428012 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692107 | 1428763 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1692242 | 3428321 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692243 | 642248 | species | AM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692244 | 642248 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692245 | 642248 | species | CO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692246 | 642248 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692247 | 642248 | species | DS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692248 | 642248 | species | FD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692249 | 642248 | species | FC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692250 | 642248 | species | GS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692251 | 642248 | species | HC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692252 | 642248 | species | HC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692253 | 642248 | species | LS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692254 | 642248 | species | LV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692255 | 642248 | species | MS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692256 | 642248 | species | MS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692257 | 642248 | species | PI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692258 | 642248 | species | PK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692259 | 642248 | species | PS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692260 | 642248 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692261 | 642248 | species | PD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692262 | 642248 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692263 | 642248 | species | SB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1699094 | 1985375 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1701404 | 1385657 | species | GG | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1701405 | 1385657 | species | GG | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1705090 | 2670808 | species | LB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1705091 | 2670808 | species | MY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1705092 | 1231296 | species | AC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1705297 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1705841 | 124960 | species | IC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1708248 | 41479 | species | AP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1708572 | 1987123 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1708653 | 1985405 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1708712 | 2734349 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1711684 | 3426175 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1711685 | 3047382 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1712570 | 3052523 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1712572 | 3052541 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1714362 | 3432941 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714363 | 3432953 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714364 | 3432943 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714366 | 3432946 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714367 | 3432948 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714368 | 3432950 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714370 | 39756 | species | RC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714570 | 3432493 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714618 | 12091 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1715288 | 1548720 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1720595 | 3047681 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1721090 | 344417 | species | TA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1723728 | 151341 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1725329 | 3048283 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1729112 | 9126 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1729141 | 3052606 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1729670 | 3432971 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1736759 | 2010321 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1737345 | 2955369 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1737346 | 2485233 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1737522 | 2006147 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1737523 | 2006148 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1738045 | 10814 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1742594 | 3426866 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1742595 | 3426867 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1742596 | 3426899 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1743411 | 3052366 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1746057 | 35278 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746058 | 35278 | species | BT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746059 | 35278 | species | GM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746060 | 35278 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746061 | 35278 | species | SF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746062 | 35278 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746063 | 2982806 | species | SI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746064 | 35278 | species | SL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746065 | 35278 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746066 | 1249508 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746067 | 2982806 | species | WA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746068 | 2982806 | species | WA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746069 | 35278 | species | WC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746070 | 2982806 | species | WC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746071 | 2982806 | species | WF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746072 | 35278 | species | XC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746073 | 35278 | species | XS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746074 | 35278 | species | XS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1747648 | 1511809 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1755198 | 1231296 | species | PL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1755467 | 39756 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1755752 | 2955269 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1755785 | 2955271 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1755792 | 2955443 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1756157 | 37960 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1756191 | 3052711 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1756445 | 10567 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1756615 | 939922 | species | UV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1757958 | 79633 | subspecies | OT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1758139 | 3431814 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1758883 | 2844039 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1761477 | 3432872 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1762023 | 2006158 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1763507 | 3052719 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1764085 | 3052685 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1764086 | 3052690 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1765736 | 3433231 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1765754 | 3429964 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1766554 | 693997 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1766557 | 1534549 | species | GP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1766559 | 2080833 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1766828 | 3433039 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1768064 | 1714618 | species | TH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1768874 | 37960 | species | SA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1769780 | 336633 | species | AC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1769949 | 3052037 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1770265 | 12289 | species | EA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1770613 | 3431645 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1770617 | 12174 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1770618 | 3427713 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1774200 | 3426712 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1774276 | 3426179 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1775963 | 3240550 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1776109 | 336635 | species | GD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1776153 | 3052183 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1776177 | 3426172 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1777015 | 3426174 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1777016 | 3432951 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778558 | 35342 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778559 | 3432787 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778560 | 35342 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778561 | 35342 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778570 | 361688 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778571 | 1778570 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1778572 | 361688 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778573 | 361688 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778580 | 3048218 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1779340 | 2845835 | no rank | | 9 | 1 | 4 | 0 | 0 | 1 | 1 | 0 | -1780507 | 35249 | species | MG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1781241 | 675074 | species | DP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1788315 | 3052043 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1792583 | 3240568 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1795648 | 675074 | species | PT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1798085 | 3431697 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1802790 | 91888 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1803898 | 2955588 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1804153 | 2560620 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1804154 | 2560621 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1804156 | 2560622 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1804622 | 1804623 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1804623 | 3524 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1805494 | 38144 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1809242 | 675063 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1809767 | 328429 | species | IY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1811230 | 3428104 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1811408 | 2560648 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1812179 | 1233522 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1812308 | 3426765 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1813613 | 675074 | species | PB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1813615 | 1884450 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1815581 | 3426347 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1816484 | 2956587 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1816485 | 2956588 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1816486 | 2956589 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1816487 | 2956590 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1816488 | 2956591 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1817526 | 3048157 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1819678 | 1231296 | species | CY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1820326 | 2560321 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1821222 | 38144 | species | CF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1821227 | 38144 | species | XA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1822365 | 347957 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1823757 | 2501999 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1825924 | 3431731 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1825931 | 2169738 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1826059 | 2169885 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1826822 | 2956583 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1833824 | 1856642 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1833938 | 3433229 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1837089 | 2956547 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | -1840528 | 547124 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1841147 | 1231296 | species | BY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1843734 | 1985426 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843735 | 1985425 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843736 | 1985412 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843737 | 1985377 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843738 | 1985379 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843739 | 1985393 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843740 | 1985376 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843742 | 1985372 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843761 | 2844603 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843773 | 2845922 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1844928 | 3052135 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1848040 | 3060718 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1848042 | 3428898 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1848150 | 2956607 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1848151 | 2956608 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1848152 | 2955781 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1848153 | 2955782 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1848169 | 3428880 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849328 | 90010 | species | EG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849531 | 908833 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849532 | 908833 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849533 | 37960 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849534 | 75747 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1849535 | 3433234 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849537 | 2955264 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1849542 | 39780 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849543 | 2955492 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1849544 | 988644 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849545 | 988644 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1850906 | 3047737 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1853762 | 3427761 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1853865 | 3427722 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1856030 | 39756 | species | GS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1856031 | 3240497 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1856627 | 908833 | species | PS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1856642 | 3431756 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1857323 | 2613861 | species | TK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1859149 | 3050361 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1859161 | 3433233 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1862127 | 3240463 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1862824 | 1910929 | species | GH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1862825 | 2004962 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1862978 | 185786 | species | EF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1864484 | 3050363 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1868472 | 1770617 | species | YV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1869931 | 687091 | species | EE | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1871153 | 3431208 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1871631 | 1809242 | species | RS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1872710 | 2169864 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1872719 | 2560351 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1873455 | 1914447 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1874267 | 39756 | species | MT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1874886 | 3426918 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1881013 | 3433853 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1882382 | 535600 | species | SO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1882732 | 103956 | subspecies | CC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1884450 | 2219049 | species | HV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1884455 | 2501985 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1884456 | 2501987 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1884458 | 1513294 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1884460 | 1884455 | species | AX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1884461 | 1884456 | species | AA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1884640 | 5234 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1884832 | 2956541 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1884917 | 1548722 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1884991 | 3426929 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1885248 | 1897087 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1885927 | 2956522 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1885928 | 2169692 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1886606 | 3240485 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1887213 | 337052 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1887214 | 2169878 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1887215 | 2170255 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1887216 | 2169879 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1887217 | 2169881 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1887218 | 333938 | species | BT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1887219 | 2169881 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1888309 | 478825 | species | WB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1888311 | 1809242 | species | BT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1890365 | 3429978 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1890423 | 649996 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1891704 | 37960 | species | SJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1891713 | 151341 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1891714 | 151341 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1891715 | 151341 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1891741 | 1891713 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1895012 | 2976112 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1897087 | 186458 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1897538 | 1910929 | species | CB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1897731 | 194960 | species | KD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1899219 | 291027 | species | SL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1899566 | 3427738 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1902501 | 3432190 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1902502 | 3432191 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1903340 | 1906179 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1903412 | 91347 | family | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -1904408 | 2955296 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1904409 | 2955303 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1904410 | 1723728 | species | RH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1904411 | 2955472 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1904439 | 347957 | species | SR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1904880 | 3426844 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1904881 | 3426840 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1904882 | 3426951 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1904883 | 3426968 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1904884 | 3427111 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1906179 | 38144 | species | AF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1906245 | 336476 | species | MV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1906317 | 3430613 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1906668 | 3426850 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1907771 | 3059782 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1908665 | 159332 | subspecies | MO | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1908807 | 1680130 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1908808 | 1680130 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1908811 | 1680130 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1908813 | 1680130 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1910928 | 2732539 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1910929 | 1542744 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1911602 | 2560077 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1912919 | 1049657 | no rank | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -1913124 | 3431741 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1913125 | 3431742 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1914295 | 1914298 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1914297 | 675068 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1914298 | 675068 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1914447 | 3052624 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1916095 | 79633 | subspecies | OT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1916236 | 1761477 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1918013 | 3152110 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1918014 | 3427581 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1922348 | 2585030 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1922602 | 1922348 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1922604 | 1922348 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1922669 | 1922348 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1922934 | 2508259 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1922938 | 1922348 | species | HM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923351 | 1922348 | species | JT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923697 | 1922348 | species | WC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923716 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923726 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923736 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923737 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923738 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923739 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923740 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923742 | 1922348 | species | WM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923743 | 1922348 | species | WN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923745 | 1922348 | species | WP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923746 | 1922348 | species | WP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923748 | 1922348 | species | WP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923752 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923753 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923754 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923755 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923756 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923757 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923758 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923759 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923761 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923763 | 2560845 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1923764 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923765 | 3429963 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923768 | 1922348 | species | XD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923769 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923770 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923771 | 2507505 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1923772 | 2560846 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1923773 | 2507320 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1923775 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923777 | 2508251 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1923778 | 1922348 | species | ZM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923781 | 1922348 | species | UP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1928073 | 1401779 | species | MD | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1929150 | 90010 | species | EA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1930602 | 33342 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1931113 | 3427361 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1936269 | 336476 | species | HA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1938656 | 1922348 | species | JT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1940252 | 3047706 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1940555 | 431037 | species | MR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1941233 | 2844440 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1941234 | 1941235 | species | TG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1941235 | 1910928 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1941236 | 1910928 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1941237 | 2844569 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1941238 | 1910928 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1941239 | 2844612 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1941435 | 3052705 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1941436 | 3052704 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1941437 | 3052270 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1950126 | 3047760 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1955054 | 3426987 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1955247 | 7524 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1955493 | 40068 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1955730 | 3052333 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1958777 | 1073966 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1958778 | 336476 | species | BI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1958784 | 2576578 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1958957 | 1250315 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1959930 | 371833 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1961665 | 526119 | species | QH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1961666 | 526119 | species | QH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1961785 | 936057 | species | RX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1961833 | 8941 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1961834 | 1961833 | species | CA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1963758 | 9989 | suborder | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1964372 | 345249 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1965238 | 1111709 | species | PR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1965306 | 1680130 | species | LS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1965344 | 2734294 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1967841 | 2734385 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1970065 | 2169757 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1972572 | 11271 | species | VC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1972589 | 32613 | species | EA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1972596 | 32613 | species | EK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1972597 | 32613 | species | EY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1972700 | 336476 | species | DM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1972716 | 3433267 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1972995 | 328429 | species | TV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1973265 | 3048451 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1977105 | 1884458 | species | CW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1977392 | 3433830 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1978413 | 3433335 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1978532 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1978539 | 1978532 | species | LY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1978541 | 1978532 | species | LW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1978543 | 1978532 | species | LK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1978920 | 2560649 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1980412 | 3151837 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980415 | 3151839 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980416 | 3151837 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980417 | 3151837 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1980418 | 3151839 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980419 | 3151837 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1980420 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980421 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980427 | 675845 | species | EF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1980428 | 675845 | species | ET | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1980429 | 675845 | species | EC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1980430 | 675845 | species | ET | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1980431 | 675845 | species | EI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1980517 | 1980415 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980538 | 1980417 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1985366 | 1910928 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1985372 | 2844423 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985375 | 2844429 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985376 | 2844427 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985377 | 2844428 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985379 | 2844441 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985392 | 2844504 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985393 | 2844505 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985405 | 2844518 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985412 | 2844528 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985425 | 2844548 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985426 | 2844550 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985699 | 3427192 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1986112 | 3433737 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1986190 | 1770265 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1986960 | 1986961 | species | AA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1986961 | 12058 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1987123 | 3429213 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1987125 | 3429215 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1987129 | 3429219 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1987130 | 3429220 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1987140 | 1987125 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1987144 | 1987129 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1987145 | 1987130 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1987744 | 3052163 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1993640 | 3403061 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2003309 | 3050241 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2003394 | 564644 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2003395 | 564644 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2004962 | 2844585 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2005033 | 1566705 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2006147 | 2955470 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2006148 | 2955468 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2006158 | 1891714 | species | BO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2010320 | 3427360 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2010321 | 3427352 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2018325 | 6994 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2020310 | 1554466 | species | AS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2021209 | 35300 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2022639 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2022641 | 2022639 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2022857 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2029065 | 7516 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2034996 | 2034997 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2034997 | 2501949 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2038729 | 3431046 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2039307 | 516546 | varietas | CJ | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -2045258 | 2806 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -2045261 | 2806 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -2047826 | 121823 | species | CC | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2048238 | 2486284 | family | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -2048239 | 2048238 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -2048240 | 2048239 | species | PI | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 0 | code compliant; specified -2050584 | 3426905 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2065824 | 166784 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2065826 | 2065824 | species | SS | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -2072024 | 3048204 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2072716 | 6274 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2080833 | 1511771 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2136291 | 1292273 | species | OW | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 0 | code compliant; specified -2169561 | 2732514 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169567 | 2732535 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169568 | 675063 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169569 | 2169568 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169574 | 2732537 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169577 | 2732553 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169595 | 151340 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169596 | 151340 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169609 | 2169567 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169610 | 2169567 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169619 | 283494 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169650 | 2169596 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169663 | 2169574 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169692 | 2169650 | species | AX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169693 | 3426186 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169726 | 3047715 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2169738 | 3427008 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169757 | 1891714 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2169801 | 3427756 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169802 | 3427752 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169803 | 3427755 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169864 | 3428201 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169878 | 1513238 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169879 | 1513238 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169881 | 1513246 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169885 | 3428514 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169886 | 325459 | species | EX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169902 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169960 | 3429932 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170064 | 3431495 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170103 | 2948924 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2170117 | 2845912 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170126 | 2845932 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170132 | 3240474 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170135 | 3240546 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170170 | 935650 | species | PX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170171 | 935650 | species | PX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170255 | 333921 | species | XX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2172821 | 6657 | superclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2204151 | 12429 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2218011 | 2005033 | species | AU | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2218046 | 3143224 | species | MP | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2218050 | 1566718 | species | LM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2218081 | 3101718 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2218082 | 2218081 | species | AB | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2218119 | 376274 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2218120 | 2218119 | species | HF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2218135 | 3101718 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2218136 | 2218135 | species | PG | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2218198 | 30092 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2219049 | 675074 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2219055 | 675074 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2219250 | 469369 | species | OA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2231382 | 2231393 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2231384 | 2231393 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2231385 | 2231384 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2231387 | 2231393 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2231390 | 163725 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2231393 | 3814 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2233855 | 2231382 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2248770 | 1777016 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2259808 | 3052031 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2290931 | 28890 | clade | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -2315733 | 14366 | species | CB | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -2485233 | 185759 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2486284 | 37844 | order | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -2497569 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2497570 | 2497569 | subphylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2497571 | 2497569 | subphylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2497572 | 2497570 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2497574 | 2497570 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2497577 | 2497571 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499398 | 76804 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499399 | 76804 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499403 | 76804 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499405 | 2497572 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499407 | 2497574 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499411 | 2497577 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499606 | 76803 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499615 | 2499606 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499616 | 2499606 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501926 | 3433752 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2501927 | 3433782 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2501928 | 3433784 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2501931 | 11118 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501940 | 3151839 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501942 | 2948893 | species | SG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2501945 | 2948721 | species | GT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2501949 | 2499411 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501952 | 2499407 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501968 | 2499405 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501970 | 1980415 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501971 | 1980415 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501976 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501985 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501987 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501994 | 1980416 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501998 | 1980417 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2501999 | 2509489 | species | TK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2507291 | 2501952 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2507320 | 2599620 | species | XM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2507497 | 2501968 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2507505 | 2507497 | species | YX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2508209 | 2499403 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2508239 | 2508209 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508240 | 2508209 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508241 | 2508239 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508242 | 2508241 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508243 | 2508240 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508247 | 2508243 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508251 | 3433816 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508258 | 2501940 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508259 | 2508258 | species | HM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2509479 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2509489 | 2499616 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2509500 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2509503 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2509509 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2509514 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2545470 | 1985699 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2547355 | 1679172 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2547356 | 1679172 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2555566 | 95179 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2558200 | 3073811 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2559587 | 10239 | realm | RX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560063 | 2732504 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560069 | 11158 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560072 | 39738 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560076 | 11158 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560077 | 39738 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560078 | 39738 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560088 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560100 | 249310 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560105 | 2560063 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560185 | 2560076 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560194 | 2560069 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560196 | 1980419 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560218 | 324901 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560230 | 324901 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560252 | 1914298 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560254 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560289 | 11572 | species | OA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2560321 | 3051377 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560349 | 3047686 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560351 | 3427571 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560371 | 3047722 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560468 | 3050285 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560479 | 2560100 | species | BF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2560568 | 3050310 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560614 | 3048219 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560620 | 3432238 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560621 | 3432521 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560622 | 3432239 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560642 | 3051421 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560648 | 39760 | species | IL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2560649 | 1891715 | species | DS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2560801 | 3050360 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560845 | 2560088 | species | AX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2560846 | 2560088 | species | AX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2566501 | 124006 | species | CB | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified -2572045 | 1761477 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2576578 | 2560218 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2585030 | 2559587 | no rank | | 9 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | -2585815 | 91776 | species | PH | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2599620 | 2507291 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2609695 | 12877 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2613861 | 1980419 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2621980 | 568 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -2622732 | 367188 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -2654645 | 1761477 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2670808 | 190729 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2684882 | 131209 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2691594 | 2509509 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2692248 | 3041 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2696291 | 33634 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2697495 | 33317 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -2698737 | 2759 | clade | | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2707335 | 5455 | no rank | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | -2707348 | 5455 | no rank | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | -2721536 | 7953 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2731341 | 10239 | realm | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2731342 | 10239 | realm | MX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2731360 | 2731341 | kingdom | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2731361 | 2731360 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2731363 | 2731361 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2732091 | 2731342 | kingdom | | 3 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | -2732092 | 2731342 | kingdom | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732396 | 2559587 | kingdom | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732397 | 2559587 | kingdom | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732405 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732406 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732407 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732408 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732409 | 2732397 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732412 | 2732091 | phylum | | 3 | 1 | 11 | 0 | 0 | 1 | 0 | 0 | -2732413 | 2732412 | class | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -2732414 | 2732413 | order | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -2732415 | 2732092 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732416 | 2732092 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732421 | 2732415 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732422 | 2732415 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732423 | 2732416 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732424 | 2732416 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732458 | 2732405 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732459 | 2732405 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732461 | 2732406 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732462 | 2732406 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732463 | 2732406 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732464 | 2732406 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732498 | 2732407 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732499 | 2732407 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732500 | 2732407 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732502 | 2732498 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732503 | 2732499 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732504 | 2732500 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732505 | 2732408 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732506 | 2732408 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732507 | 2732408 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732514 | 2732409 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732515 | 2732514 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732532 | 2732421 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732533 | 2732421 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732534 | 2732422 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732535 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732536 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732537 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732538 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732539 | 2732424 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732540 | 2732458 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732541 | 2788829 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732543 | 2732461 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732544 | 2732461 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732545 | 2732462 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732546 | 2732464 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732548 | 2788833 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732549 | 2732505 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732550 | 2732507 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732551 | 2732507 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732553 | 2732506 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732890 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732892 | 2732503 | family | | 9 | 1 | 4 | 0 | 0 | 1 | 0 | 0 | -2733223 | 40120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733224 | 40120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733246 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733248 | 2842408 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733254 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733256 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733291 | 10404 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733293 | 186534 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2734294 | 1891713 | species | AQ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2734349 | 3427224 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2734371 | 2733246 | species | AI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2734385 | 3426146 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2734386 | 3426109 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2734387 | 3426122 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2734388 | 3426137 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2734409 | 2733254 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2734433 | 11584 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2734594 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2741926 | 47523 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2741929 | 47523 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2743705 | 7953 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2743714 | 30727 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2743715 | 2743714 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2743716 | 2743714 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2748958 | 2733256 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2748959 | 2733248 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2748967 | 2843481 | species | IP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2756270 | 192382 | subspecies | MA | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified -2768478 | 33372 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2785011 | 6544 | subclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2785015 | 735337 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2788829 | 2732459 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2788833 | 2732463 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2788857 | 2732533 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2788865 | 2732541 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2789204 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -2797651 | 707741 | species | ZC | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant; specified -2810354 | 377833 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2811596 | 224510 | species | IP | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified -2812636 | 3166 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2821351 | 3313 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2839668 | 40093 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2840056 | 3403061 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2840070 | 2840056 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2841720 | 886583 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2842243 | 2732407 | class | | 9 | 1 | 11 | 0 | 0 | 1 | 0 | 0 | code compliant -2842247 | 2842243 | order | | 3 | 0 | 11 | 0 | 0 | 1 | 0 | 0 | code compliant -2842313 | 2499407 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842319 | 2842247 | family | | 3 | 0 | 11 | 0 | 0 | 1 | 0 | 0 | code compliant -2842325 | 2499407 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842369 | 3152207 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842407 | 11270 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842408 | 11270 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842542 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842594 | 2842325 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842607 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842620 | 2501952 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842645 | 40120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842680 | 2169574 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842848 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842882 | 2501952 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842921 | 2842313 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842923 | 687329 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842950 | 2560063 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842995 | 2842319 | genus | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -2843481 | 2499615 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2843859 | 2842542 | species | AB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2843935 | 2842594 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844037 | 2842620 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844039 | 2842620 | species | CI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844095 | 1308858 | species | SD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844423 | 1542744 | species | GB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844427 | 1542744 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844428 | 1542744 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844429 | 1542744 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844440 | 1542744 | species | GE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844441 | 1542744 | species | GE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844504 | 1542744 | species | GP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844505 | 1542744 | species | GP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844518 | 1542744 | species | GR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844528 | 1542744 | species | GS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844548 | 1985366 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844550 | 1985366 | species | GM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844569 | 1941236 | species | GE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844585 | 1941236 | species | GH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844603 | 1941236 | species | GS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844612 | 1941238 | species | GE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844799 | 227307 | species | GF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844804 | 227307 | species | GH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844833 | 1308858 | species | SH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844861 | 2842369 | species | AH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845539 | 1308858 | species | SL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845619 | 2507291 | species | MB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845620 | 2507291 | species | MC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845621 | 2507291 | species | MD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845625 | 2507291 | species | MS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845626 | 2507291 | species | MW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845639 | 2842882 | species | MA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845713 | 2842921 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845835 | 3431573 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2845912 | 2169663 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845922 | 2169663 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845932 | 2169663 | species | PR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2846193 | 2842369 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2846195 | 1308858 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2846667 | 2842542 | species | AW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2846668 | 1308858 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2847088 | 3052611 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2847270 | 1902502 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2847522 | 642994 | subspecies | HM | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified -2848317 | 1961785 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2866655 | 9918 | species | BA | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2867347 | 64579 | species | VR | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified -2870378 | 1511779 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2871195 | 1902501 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2871196 | 1902501 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2876817 | 64579 | species | VX | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified -2890311 | 543 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -2908833 | 2785015 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -2914707 | 211558 | species | AF | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified -2916678 | 3239874 | order | | 4 | 1 | 12 | 0 | 4 | 1 | 1 | 0 | code compliant -2927998 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2927999 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2928000 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2928001 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2928006 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2928007 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2928008 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2932129 | 53124 | species | PH | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified -2942679 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2942681 | 2732408 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946186 | 2732541 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946187 | 2732541 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946194 | 2942681 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946627 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946630 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946633 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946635 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946639 | 3079366 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946640 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946790 | 1661063 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946823 | 1661063 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946827 | 2946194 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948661 | 2946639 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948686 | 2732892 | genus | | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | -2948721 | 2501987 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948851 | 585893 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948893 | 2501987 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948924 | 151341 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948930 | 2560077 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948932 | 2732892 | genus | | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | -2948940 | 2732892 | genus | | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | -2955264 | 2946790 | species | AI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955269 | 2946790 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955271 | 2946790 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955296 | 1891713 | species | AM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955300 | 1891713 | species | AR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955303 | 1891713 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955369 | 185756 | species | AL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955443 | 2560100 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955454 | 2946823 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955468 | 1891714 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955470 | 1891714 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955472 | 1891714 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955492 | 2946827 | species | BI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955588 | 3427735 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2955770 | 2948686 | species | DB | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955781 | 2948686 | species | DF | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955782 | 2948686 | species | DF | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955836 | 2948686 | species | DS | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956328 | 3431861 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2956522 | 2948924 | species | TS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956541 | 2948930 | species | TG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2956547 | 2948932 | species | TR | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956583 | 2948940 | species | UA | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956585 | 2948940 | species | UB | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956586 | 2948940 | species | UB | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956587 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956588 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956589 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956590 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956591 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956607 | 2948940 | species | UF | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956608 | 2948940 | species | UF | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2960224 | 2946630 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2960910 | 2948851 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2965324 | 49669 | species | PL | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified -2976112 | 1461176 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2976338 | 153286 | subspecies | MN | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2980669 | 159337 | subspecies | MY | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2982303 | 5338 | suborder | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -2982305 | 5338 | suborder | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -2982316 | 5338 | suborder | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -2982806 | 38144 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3004043 | 74694 | species | VL | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified -3039755 | 27434 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -3039756 | 3039755 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -3042114 | 34735 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -3044472 | 548681 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3047382 | 10639 | species | CM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047678 | 12258 | species | CR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047681 | 3425826 | species | WC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047686 | 10652 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047704 | 558016 | species | AB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047706 | 10652 | species | BT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047715 | 10652 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047722 | 10652 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047737 | 558016 | species | AC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047760 | 1911602 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3047783 | 310684 | species | CR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047795 | 558017 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047819 | 12141 | species | TM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3047843 | 10652 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047845 | 12270 | species | NA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047850 | 12270 | species | ND | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047854 | 10652 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048157 | 39734 | species | UI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3048204 | 558017 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048218 | 12051 | species | MN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048219 | 12036 | species | LN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3048236 | 39734 | species | UP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3048251 | 12270 | species | NP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048283 | 1299309 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3048345 | 558016 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048399 | 687332 | species | BH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048408 | 687339 | species | IS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048442 | 558016 | species | AU | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048451 | 10652 | species | BW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048458 | 39725 | species | CZ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050241 | 39725 | species | CB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050251 | 10319 | species | VC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050258 | 10358 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050262 | 1232637 | species | SC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050267 | 180252 | species | MC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050285 | 548688 | species | PF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050304 | 10294 | species | SL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050310 | 40272 | species | RM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050317 | 10294 | species | SM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050360 | 1232637 | species | ST | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050361 | 3048399 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3050363 | 1507401 | species | BU | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3051377 | 2560194 | species | OJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3051421 | 558016 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3051977 | 2733223 | species | AD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3051989 | 2733256 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052031 | 1507401 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052037 | 1507401 | species | BL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052043 | 1507401 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052135 | 39725 | species | CY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052163 | 742914 | species | CR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052180 | 10803 | species | DS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052183 | 2842645 | species | DH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052212 | 1980420 | species | GY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052248 | 2501976 | species | HW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052256 | 40122 | species | IL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052258 | 40122 | species | IL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052270 | 2169609 | species | KA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052318 | 1653394 | species | MM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052321 | 1653394 | species | MO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052333 | 12051 | species | MP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052347 | 11229 | species | MP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052353 | 2560185 | species | NN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052366 | 2842923 | species | OH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052437 | 11572 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052441 | 11572 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052520 | 1980517 | species | OH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052522 | 1980517 | species | OJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052523 | 1980517 | species | OK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052536 | 1980517 | species | OT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052540 | 1980517 | species | OW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052541 | 1980517 | species | OY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052543 | 1980538 | species | OA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052553 | 1980538 | species | OW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052554 | 1980538 | species | OW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052569 | 2560196 | species | OC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052570 | 2560196 | species | OC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052577 | 2560196 | species | OI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052579 | 2560196 | species | OM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052581 | 2560196 | species | OP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052606 | 1307799 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052611 | 1307799 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052624 | 11095 | species | PS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052632 | 1980421 | species | PW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052633 | 1980421 | species | PW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052665 | 11584 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052666 | 11584 | species | PN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052685 | 11584 | species | PT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052690 | 11584 | species | PZ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052702 | 2169610 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052704 | 2169610 | species | PH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052705 | 2169610 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052711 | 1506574 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052719 | 1506574 | species | PR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052723 | 1653395 | species | RA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052724 | 1653395 | species | RC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052730 | 186938 | species | RC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052748 | 2501994 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052749 | 2501970 | species | SA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052756 | 2501971 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052771 | 1511911 | species | TU | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052800 | 2734594 | species | UH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052813 | 2733293 | species | VC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052826 | 2560254 | species | WP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052827 | 2501998 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3054905 | 3487 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3058443 | 1172985 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3058444 | 1172985 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3059782 | 2733224 | species | BI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3060718 | 187214 | species | SE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3064797 | 2235 | family | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -3072906 | 379584 | superfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -3073806 | 3078114 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3073808 | 3078114 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3073809 | 3073808 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3073810 | 3073808 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3073811 | 3073808 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3073812 | 3078114 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3078114 | 8825 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3079366 | 2732543 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3101718 | 376275 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -3118152 | 2621980 | species | HS | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -3137121 | 1463147 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3143224 | 1585420 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -3151693 | 2497571 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3151837 | 3151693 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3151838 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3151839 | 3151693 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3151840 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3151845 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152106 | 2942679 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152107 | 2732538 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152110 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152116 | 3151840 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152119 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152120 | 3151838 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152124 | 3421323 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152126 | 3151845 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152141 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152142 | 3151838 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152144 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152146 | 3421323 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152147 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152207 | 11270 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152209 | 11158 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152475 | 3152106 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152483 | 3152106 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152501 | 3152107 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152639 | 3152207 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152641 | 3152207 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152653 | 3152116 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152867 | 3152119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152873 | 3152120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152905 | 3152124 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152926 | 3152126 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3153030 | 3152142 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3153055 | 3152142 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3153067 | 3152144 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3153072 | 3152146 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3239873 | 147537 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -3239874 | 147537 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -3240463 | 12195 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240468 | 12195 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240474 | 12195 | species | PB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240485 | 12195 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240497 | 12195 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240498 | 12195 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240517 | 12195 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240525 | 12195 | species | PD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240527 | 12195 | species | PE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240530 | 12195 | species | PG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240544 | 12195 | species | PH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240546 | 12195 | species | PI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240548 | 12195 | species | PI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240550 | 12195 | species | PJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240554 | 12195 | species | PL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240568 | 12195 | species | PN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3241188 | 1343920 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3243772 | 3239873 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -3243775 | 3239874 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -3303203 | 27319 | genus | | 4 | 1 | 12 | 1 | 4 | 1 | 0 | 0 | code compliant -3342348 | 79653 | subspecies | OO | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -3358290 | 150311 | species | OF | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -3366610 | 2157 | kingdom | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -3368986 | 2622732 | species | HS | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -3368987 | 2622732 | species | HS | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -3379134 | 2 | kingdom | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -3390273 | 570 | species group | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -3403061 | 10239 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3412625 | 2732092 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3412723 | 3412625 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3415267 | 2732540 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3417955 | 131220 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3417957 | 3417955 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3420546 | 3412723 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -3421323 | 2732540 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3424890 | 2842408 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3424891 | 2842408 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3424976 | 1511860 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3425084 | 2946186 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3425096 | 11270 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3425105 | 3425096 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3425826 | 12050 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3426109 | 3424890 | species | AA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426122 | 3424890 | species | AB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426137 | 3424890 | species | AG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426146 | 3424890 | species | AL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426172 | 2003394 | species | AC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426174 | 2003394 | species | AE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426175 | 2003394 | species | AF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426179 | 2003394 | species | AH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426186 | 2003394 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426258 | 3425105 | species | AV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426277 | 2842542 | species | AH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426285 | 2842542 | species | AT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426347 | 217160 | species | AT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426670 | 10814 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426674 | 10814 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426677 | 10814 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426712 | 10814 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426730 | 10814 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426765 | 10814 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426792 | 10814 | species | BG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426840 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426844 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426850 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426852 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426866 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426867 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426880 | 10814 | species | BN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426899 | 10814 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426905 | 10814 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426918 | 10814 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426929 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426935 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426951 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426968 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426987 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426990 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427005 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427008 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427013 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427043 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427106 | 10814 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427111 | 10814 | species | BW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427192 | 3424891 | species | BH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427224 | 2003395 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427248 | 1511809 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3427251 | 1511809 | species | BF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3427352 | 190729 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427357 | 190729 | species | BN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427360 | 190729 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427361 | 190729 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427400 | 190729 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427571 | 2560105 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427581 | 1918013 | species | BI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427583 | 1918013 | species | BN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427666 | 39731 | species | BO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427713 | 12174 | species | CA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427722 | 2022857 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427735 | 12163 | species | CA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427738 | 12163 | species | CA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427747 | 12163 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427752 | 12163 | species | CD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427755 | 12163 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427756 | 12163 | species | CG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427760 | 12163 | species | CI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427761 | 12163 | species | CJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427773 | 12163 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427788 | 12163 | species | CP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427841 | 3152475 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427963 | 3152653 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427967 | 2842607 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428012 | 12160 | species | CT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428035 | 2169619 | species | CA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428042 | 2169619 | species | CG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428104 | 3425084 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3428201 | 2169569 | species | DF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428207 | 1511810 | species | DD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428321 | 3153030 | species | DA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428514 | 12059 | species | EL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3428669 | 2842680 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428775 | 10988 | species | FZ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3428809 | 129725 | species | FD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428880 | 3152867 | species | FH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428898 | 3152867 | species | FS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428964 | 3152639 | species | GT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429213 | 12091 | species | HB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429215 | 12091 | species | HD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429219 | 12091 | species | HH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429220 | 12091 | species | HI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429932 | 12316 | species | IP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429955 | 3152905 | species | II | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429963 | 3152905 | species | IK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429964 | 3152905 | species | IN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429978 | 137757 | species | IC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3430566 | 156208 | species | MD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3430613 | 2842848 | species | MV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3430629 | 249588 | species | MH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3430652 | 3152501 | species | MK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3430695 | 10812 | species | MB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3430893 | 1511778 | species | MA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431044 | 104766 | species | NF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431046 | 104766 | species | NM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431121 | 3152926 | species | ND | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431136 | 3152926 | species | NP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431208 | 2022641 | species | NN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431242 | 10892 | species | OC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3431243 | 10892 | species | OC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3431256 | 10892 | species | OW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3431303 | 10405 | species | OL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431365 | 2733291 | species | PO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431402 | 1511782 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431495 | 10882 | species | OM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3431573 | 2842950 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431645 | 3153067 | species | PN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431697 | 3153072 | species | PN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431731 | 119164 | species | PB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431741 | 119164 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431742 | 119164 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431754 | 119164 | species | PL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431756 | 119164 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431761 | 119164 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431814 | 186886 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431861 | 185753 | species | PL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432190 | 1511804 | species | RB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432191 | 1511804 | species | RC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432238 | 2560218 | species | SM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432239 | 2560218 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432269 | 3152873 | species | SC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432492 | 12137 | species | SA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432493 | 12137 | species | SB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432496 | 12137 | species | SC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432503 | 12137 | species | SP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432505 | 12137 | species | SR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432511 | 12137 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432521 | 2560230 | species | SP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432584 | 3152641 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432597 | 3152483 | species | ST | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432787 | 3153055 | species | TN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432872 | 12234 | species | TF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432893 | 12234 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432941 | 11007 | species | TH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432943 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432946 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432948 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432950 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432951 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432953 | 11007 | species | TK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432971 | 11007 | species | TS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432979 | 674952 | species | TV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433039 | 1298631 | species | TR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433064 | 3424976 | species | UB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433066 | 3424976 | species | UC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433152 | 1513308 | species | VA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433226 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433229 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433231 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433233 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433234 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433265 | 184751 | species | VP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433267 | 184751 | species | VV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433335 | 2560252 | species | WA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433737 | 2508242 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433752 | 2509479 | species | AF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433782 | 2509500 | species | AR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433784 | 2509503 | species | AN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433814 | 2509514 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433816 | 2508247 | species | IH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433830 | 12176 | species | PE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433836 | 12176 | species | PE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433853 | 12176 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3456997 | 4762 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/virus.acc2taxid.gz b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/virus.acc2taxid.gz deleted file mode 100644 index 55c31c8..0000000 Binary files a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/virus.acc2taxid.gz and /dev/null differ diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/results/prefilter_aligns/merge/Lib_LVsim1_collapsed.bam b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/results/prefilter_aligns/merge/Lib_LVsim1_collapsed.bam deleted file mode 100644 index a646245..0000000 Binary files a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/results/prefilter_aligns/merge/Lib_LVsim1_collapsed.bam and /dev/null differ diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/expected/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/expected/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids deleted file mode 100644 index ef20c09..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/expected/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids +++ /dev/null @@ -1,1299 +0,0 @@ -M_T0_RID0_S0_NC_030117.1:111953-112007_length:55_mod0000 -M_T0_RID0_S0_NZ_JBDYLZ010000006.1:232651-232713_length:63_mod0000 -M_T0_RID0_S0_NZ_JBDYRX010000003.1:638778-638845_length:68_mod0000 -M_T0_RID0_S0_NZ_JBDYSJ010000001.1:480453-480521_length:69_mod0000 -M_T0_RID0_S1_NC_029996.1:52049-52114_length:66_mod0000 -M_T0_RID0_S1_NC_029997.2:98154-98247_length:94_mod0001 -M_T0_RID0_S1_NC_033619.1:5054-5125_length:72_mod0000 -M_T0_RID1_S0_NZ_JBDYLZ010000006.1:89475-89546_length:72_mod0000 -M_T0_RID2_S0_NC_030240.1:124812-124864_length:53_mod0000 -M_T0_RID2_S0_NZ_JBDYLZ010000014.1:79367-79450_length:84_mod0000 -M_T0_RID2_S1_NC_029132.1:78897-78961_length:65_mod0000 -M_T0_RID3_S1_NC_029996.1:125237-125310_length:74_mod0000 -M_T0_RID3_S1_NC_030229.1:666-744_length:79_mod0000 -M_T0_RID4_S0_NZ_JBDYRX010000001.1:960749-960798_length:50_mod0000 -M_T0_RID4_S1_NZ_JBDYSJ010000003.1:80602-80671_length:70_mod0000 -M_T0_RID5_S0_NC_028371.1:3473-3533_length:61_mod0000 -M_T0_RID5_S0_NZ_JBDYLZ010000014.1:31093-31169_length:77_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000003.1:463476-463555_length:80_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000004.1:91279-91382_length:104_mod0000 -M_T0_RID5_S1_NC_031272.1:12737-12796_length:60_mod0000 -M_T0_RID5_S1_NZ_JBDYSJ010000001.1:152930-152976_length:47_mod0000 -M_T0_RID6_S0_NC_018093.1:1833-1947_length:115_mod0000 -M_T0_RID6_S1_NZ_JBDYSJ010000001.1:525478-525555_length:78_mod0000 -M_T0_RID7_S0_NC_027121.1:14835-14908_length:74_mod0000 -M_T0_RID7_S0_NC_030117.1:123232-123357_length:126_mod0000 -M_T0_RID7_S0_NC_033733.1:1775-1866_length:92_mod0000 -M_T0_RID7_S0_NC_033757.1:335-408_length:74_mod0000 -M_T0_RID7_S0_NC_033816.1:2121-2169_length:49_mod0000 -M_T0_RID7_S0_NZ_JBDYRX010000001.1:768041-768147_length:107_mod0000 -M_T0_RID7_S1_NZ_JBDYRX010000003.1:741729-741847_length:119_mod0000 -M_T0_RID8_S0_NC_028255.1:2339-2453_length:115_mod0000 -M_T0_RID8_S0_NC_028362.1:3644-3681_length:38_mod0000 -M_T0_RID8_S0_NC_030295.1:5058-5146_length:89_mod0000 -M_T0_RID8_S0_NZ_JBDYLZ010000011.1:65064-65142_length:79_mod0000 -M_T0_RID8_S1_NC_029996.1:15385-15439_length:55_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000001.1:372140-372170_length:31_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000002.1:184902-185028_length:127_mod0000 -M_T0_RID9_S0_NC_018175.1:751-814_length:64_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000001.1:128705-128756_length:52_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000003.1:717567-717638_length:72_mod0000 -M_T0_RID9_S1_NZ_JBDYRX010000001.1:708791-708875_length:85_mod0001 -M_T0_RID10_S1_NC_034266.1:180760-180821_length:62_mod0000 -M_T0_RID11_S0_NC_027126.1:6629-6712_length:84_mod0000 -M_T0_RID11_S0_NC_027426.1:3579-3717_length:139_mod0000 -M_T0_RID11_S1_NC_030117.1:3968-4065_length:98_mod0000 -M_T0_RID12_S0_NC_027016.1:206020-206105_length:86_mod0000 -M_T0_RID13_S0_NC_027915.1:11194-11270_length:77_mod0000 -M_T0_RID13_S1_NZ_JBDYLZ010000012.1:21748-21797_length:50_mod0000 -M_T0_RID13_S1_NZ_JBDYSJ010000002.1:219548-219618_length:71_mod0000 -M_T0_RID14_S0_NC_033816.1:7896-7995_length:100_mod0000 -M_T0_RID14_S0_NZ_JBDYRX010000001.1:272205-272307_length:103_mod0000 -M_T0_RID14_S0_NZ_JBDYSJ010000001.1:204692-204745_length:54_mod0000 -M_T0_RID14_S1_NC_031321.1:1201-1285_length:85_mod0000 -M_T0_RID14_S1_NC_034217.1:1799-1845_length:47_mod0000 -M_T0_RID15_S0_NZ_JBDYSJ010000001.1:485204-485240_length:37_mod0001 -M_T0_RID15_S1_NC_023442.1:20190-20253_length:64_mod0001 -M_T0_RID15_S1_NC_028259.1:6855-6912_length:58_mod0000 -M_T0_RID15_S1_NZ_JBDYLZ010000014.1:31347-31473_length:127_mod0000 -M_T0_RID16_S0_NC_033718.1:9155-9282_length:128_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000014.1:112132-112219_length:88_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000018.1:30565-30632_length:68_mod0001 -M_T0_RID17_S1_NC_030658.1:888-970_length:83_mod0001 -M_T0_RID17_S1_NC_030873.1:769-848_length:80_mod0000 -M_T0_RID17_S1_NZ_JBDYRX010000004.1:479027-479133_length:107_mod0000 -M_T0_RID17_S1_NZ_JBDYSJ010000002.1:142153-142239_length:87_mod0000 -M_T0_RID18_S0_NC_033830.1:429-498_length:70_mod0000 -M_T0_RID18_S1_NC_027429.1:4469-4544_length:76_mod0000 -M_T0_RID19_S0_NC_028491.1:2563-2618_length:56_mod0000 -M_T0_RID19_S0_NC_031227.1:5693-5751_length:59_mod0000 -M_T0_RID20_S1_NC_029562.1:5000-5036_length:37_mod0000 -M_T0_RID20_S1_NZ_JBDYSJ010000004.1:235888-235979_length:92_mod0000 -M_T0_RID21_S0_NC_028242.1:2691-2737_length:47_mod0000 -M_T0_RID21_S0_NC_029052.1:6412-6494_length:83_mod0000 -M_T0_RID21_S0_NZ_JBDYSJ010000002.1:218541-218623_length:83_mod0000 -M_T0_RID21_S1_NZ_JBDYLZ010000006.1:140228-140329_length:102_mod0000 -M_T0_RID21_S1_NZ_JBDYRX010000001.1:693665-693710_length:46_mod0000 -M_T0_RID22_S0_NC_030402.1:754-835_length:82_mod0000 -M_T0_RID22_S0_NC_034216.1:12941-13048_length:108_mod0000 -M_T0_RID22_S1_NZ_JBDYRX010000001.1:435105-435213_length:109_mod0000 -M_T0_RID23_S0_NC_030701.1:5103-5151_length:49_mod0000 -M_T0_RID23_S0_NC_033762.1:10-98_length:89_mod0000 -M_T0_RID23_S0_NC_037617.1:942-1060_length:119_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000002.1:499806-499888_length:83_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000004.1:201196-201277_length:82_mod0000 -M_T0_RID23_S1_NC_031275.1:7710-7771_length:62_mod0000 -M_T0_RID24_S0_NC_030240.1:57723-57766_length:44_mod0000 -M_T0_RID24_S0_NZ_JBDYLZ010000012.1:969-1002_length:34_mod0000 -M_T0_RID24_S0_NZ_JBDYRX010000001.1:197011-197061_length:51_mod0000 -M_T0_RID24_S1_NC_027121.1:8433-8469_length:37_mod0000 -M_T0_RID24_S1_NZ_JBDYRX010000001.1:668610-668664_length:55_mod0000 -M_T0_RID25_S0_NZ_JBDYSJ010000002.1:6311-6403_length:93_mod0000 -M_T0_RID25_S1_NC_029997.2:85189-85282_length:94_mod0000 -M_T0_RID25_S1_NC_034384.1:2318-2377_length:60_mod0000 -M_T0_RID25_S1_NZ_JBDYRX010000002.1:614807-614869_length:63_mod0000 -M_T0_RID25_S1_NZ_JBDYSJ010000004.1:88035-88153_length:119_mod0000 -M_T0_RID26_S0_NC_028491.1:86460-86530_length:71_mod0000 -M_T0_RID26_S0_NZ_JBDYSJ010000003.1:64065-64167_length:103_mod0000 -M_T0_RID26_S1_NZ_JBDYSJ010000002.1:180789-180849_length:61_mod0001 -M_T0_RID27_S0_NZ_JBDYRX010000002.1:879317-879417_length:101_mod0001 -M_T0_RID27_S0_NZ_JBDYSJ010000002.1:371147-371261_length:115_mod0000 -M_T0_RID27_S1_NC_024911.1:1404-1530_length:127_mod0000 -M_T0_RID27_S1_NC_034266.1:112117-112169_length:53_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000003.1:302019-302061_length:43_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000004.1:327071-327150_length:80_mod0001 -M_T0_RID28_S0_NC_027812.1:1778-1877_length:100_mod0000 -M_T0_RID28_S0_NC_028833.1:23931-24017_length:87_mod0000 -M_T0_RID28_S0_NC_034159.1:870-906_length:37_mod0000 -M_T0_RID28_S0_NZ_JBDYSJ010000003.1:260828-260864_length:37_mod0000 -M_T0_RID29_S0_NC_027137.1:5905-5940_length:36_mod0000 -M_T0_RID29_S0_NC_027208.1:2702-2783_length:82_mod0000 -M_T0_RID29_S0_NC_029996.1:60558-60653_length:96_mod0000 -M_T0_RID29_S0_NC_033722.1:167-248_length:82_mod0000 -M_T0_RID30_S0_NC_017977.1:8983-9015_length:33_mod0000 -M_T0_RID30_S0_NC_034219.1:4140-4199_length:60_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000001.1:753768-753819_length:52_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000002.1:441798-441831_length:34_mod0000 -M_T0_RID30_S0_NZ_JBDYSJ010000001.1:878513-878614_length:102_mod0000 -M_T0_RID30_S1_NC_028492.1:144-210_length:67_mod0000 -M_T0_RID30_S1_NZ_JBDYRX010000004.1:168829-168933_length:105_mod0000 -M_T0_RID30_S1_NZ_JBDYSJ010000002.1:584020-584104_length:85_mod0000 -M_T0_RID31_S0_NZ_JBDYSJ010000002.1:273852-273897_length:46_mod0000 -M_T0_RID31_S1_NC_031450.1:2281-2311_length:31_mod0000 -M_T0_RID31_S1_NZ_JBDYSJ010000002.1:454313-454400_length:88_mod0000 -M_T0_RID32_S0_NC_023442.1:31719-31785_length:67_mod0000 -M_T0_RID32_S1_NC_028133.1:1439-1562_length:124_mod0000 -M_T0_RID32_S1_NZ_JBDYSJ010000002.1:412312-412351_length:40_mod0000 -M_T0_RID33_S1_NC_034266.1:78437-78516_length:80_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000001.1:102672-102747_length:76_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000002.1:784464-784511_length:48_mod0000 -M_T0_RID33_S1_NZ_JBDYSJ010000003.1:324967-325032_length:66_mod0000 -M_T0_RID34_S0_NC_018457.1:737-780_length:44_mod0000 -M_T0_RID34_S0_NC_028253.1:2464-2519_length:56_mod0000 -M_T0_RID34_S0_NZ_JBDYRX010000003.1:19821-19946_length:126_mod0000 -M_T0_RID34_S1_NC_029255.1:103099-103196_length:98_mod0000 -M_T0_RID34_S1_NZ_JBDYRX010000001.1:214312-214398_length:87_mod0001 -M_T0_RID35_S0_NZ_JBDYRX010000001.1:286577-286647_length:71_mod0000 -M_T0_RID35_S0_NZ_JBDYRX010000002.1:303458-303514_length:57_mod0000 -M_T0_RID35_S1_NC_028374.1:16776-16870_length:95_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:363132-363178_length:47_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:829523-829581_length:59_mod0000 -M_T0_RID36_S0_NC_029311.1:99001-99097_length:97_mod0000 -M_T0_RID37_S0_NC_033620.1:94230-94306_length:77_mod0000 -M_T0_RID37_S0_NZ_JBDYLZ010000012.1:26095-26141_length:47_mod0000 -M_T0_RID37_S1_NC_029311.1:32048-32093_length:46_mod0000 -M_T0_RID37_S1_NZ_JBDYSJ010000001.1:902396-902441_length:46_mod0000 -M_T0_RID38_S0_NC_030691.1:6883-6932_length:50_mod0000 -M_T0_RID38_S1_NZ_JBDYRX010000004.1:200501-200575_length:75_mod0000 -M_T0_RID39_S1_NC_028136.1:1274-1340_length:67_mod0000 -M_T0_RID39_S1_NZ_JBDYSJ010000002.1:503066-503117_length:52_mod0000 -M_T0_RID40_S0_NC_030234.1:4344-4414_length:71_mod0000 -M_T0_RID41_S0_NC_031088.1:9201-9299_length:99_mod0000 -M_T0_RID41_S0_NZ_JBDYLZ010000009.1:31815-31852_length:38_mod0000 -M_T0_RID41_S1_NC_028244.1:5988-6042_length:55_mod0000 -M_T0_RID41_S1_NZ_JBDYLZ010000006.1:65238-65362_length:125_mod0000 -M_T0_RID41_S1_NZ_JBDYRX010000003.1:765215-765280_length:66_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:32817-32939_length:123_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:462782-462843_length:62_mod0000 -M_T0_RID43_S0_NZ_JBDYLZ010000008.1:49878-49973_length:96_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000001.1:889979-890062_length:84_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000004.1:406662-406696_length:35_mod0000 -M_T0_RID44_S1_NZ_JBDYLZ010000006.1:90744-90777_length:34_mod0000 -M_T0_RID45_S0_NC_027712.1:10734-10821_length:88_mod0000 -M_T0_RID45_S0_NC_029311.1:44548-44620_length:73_mod0000 -M_T0_RID45_S0_NC_030693.1:5273-5361_length:89_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000008.1:40421-40495_length:75_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000009.1:55082-55112_length:31_mod0000 -M_T0_RID45_S1_NC_028232.1:6596-6658_length:63_mod0000 -M_T0_RID46_S0_NZ_JBDYSJ010000003.1:168383-168513_length:131_mod0000 -M_T0_RID47_S0_NC_029932.1:1175-1250_length:76_mod0000 -M_T0_RID47_S1_NC_027633.1:3344-3412_length:69_mod0000 -M_T0_RID48_S0_NC_018174.1:5223-5261_length:39_mod0000 -M_T0_RID48_S0_NC_023443.1:462-562_length:101_mod0000 -M_T0_RID48_S0_NZ_JBDYRX010000002.1:697197-697270_length:74_mod0000 -M_T0_RID49_S0_NC_029309.1:6196-6271_length:76_mod0000 -M_T0_RID49_S0_NZ_JBDYRX010000002.1:627468-627514_length:47_mod0000 -M_T0_RID49_S1_NC_028375.1:6864-6975_length:112_mod0000 -M_T0_RID50_S0_NC_027634.1:1642-1737_length:96_mod0000 -M_T0_RID50_S0_NC_030117.1:58855-58929_length:75_mod0000 -M_T0_RID50_S0_NC_030397.1:2093-2139_length:47_mod0001 -M_T0_RID50_S0_NZ_JBDYRX010000002.1:579910-579949_length:40_mod0000 -M_T0_RID50_S1_NC_028099.1:106360-106431_length:72_mod0000 -M_T0_RID50_S1_NZ_JBDYLZ010000012.1:83521-83604_length:84_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:803598-803655_length:58_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:945690-945779_length:90_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000006.1:184353-184397_length:45_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000018.1:32304-32360_length:57_mod0000 -M_T0_RID51_S1_NZ_JBDYRX010000001.1:868994-869082_length:89_mod0000 -M_T0_RID51_S1_NZ_JBDYSJ010000003.1:168788-168850_length:63_mod0000 -M_T0_RID52_S0_NZ_JBDYRX010000002.1:889544-889674_length:131_mod0000 -M_T0_RID52_S1_NC_030801.1:2462-2542_length:81_mod0000 -M_T0_RID53_S0_NC_029053.1:3050-3132_length:83_mod0000 -M_T0_RID53_S0_NC_033792.1:955-1008_length:54_mod0000 -M_T0_RID53_S0_NZ_JBDYRX010000003.1:127692-127758_length:67_mod0000 -M_T0_RID53_S1_NC_027533.1:2013-2051_length:39_mod0000 -M_T0_RID53_S1_NC_031307.1:5253-5307_length:55_mod0000 -M_T0_RID54_S0_NC_031079.1:45-96_length:52_mod0000 -M_T0_RID54_S1_NC_027712.1:6686-6777_length:92_mod0000 -M_T0_RID54_S1_NC_029996.1:22662-22724_length:63_mod0000 -M_T0_RID55_S0_NC_030141.1:2102-2247_length:146_mod0000 -M_T0_RID55_S0_NC_031304.1:2692-2762_length:71_mod0000 -M_T0_RID55_S0_NC_033704.1:4049-4166_length:118_mod0000 -M_T0_RID55_S0_NZ_JBDYRX010000001.1:247013-247049_length:37_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:448811-448874_length:64_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:513869-513936_length:68_mod0000 -M_T0_RID56_S0_NC_027016.1:52570-52626_length:57_mod0000 -M_T0_RID56_S0_NC_031449.1:9465-9556_length:92_mod0000 -M_T0_RID56_S0_NZ_JBDYLZ010000007.1:245259-245319_length:61_mod0001 -M_T0_RID56_S1_NZ_JBDYLZ010000007.1:103507-103590_length:84_mod0000 -M_T0_RID57_S0_NC_018070.1:8325-8447_length:123_mod0000 -M_T0_RID57_S0_NC_027426.1:3804-3851_length:48_mod0000 -M_T0_RID57_S1_NC_028099.1:83564-83601_length:38_mod0000 -M_T0_RID58_S0_NC_027121.1:14888-14980_length:93_mod0000 -M_T0_RID58_S0_NC_029550.1:232-272_length:41_mod0000 -M_T0_RID58_S1_NZ_JBDYLZ010000015.1:60370-60453_length:84_mod0000 -M_T0_RID59_S0_NZ_JBDYLZ010000011.1:108912-108996_length:85_mod0000 -M_T0_RID59_S0_NZ_JBDYRX010000004.1:15220-15308_length:89_mod0000 -M_T0_RID60_S1_NC_027641.1:1140-1184_length:45_mod0000 -M_T0_RID60_S1_NC_029085.1:8080-8154_length:75_mod0001 -M_T0_RID60_S1_NZ_JBDYRX010000001.1:262196-262266_length:71_mod0000 -M_T0_RID60_S1_NZ_JBDYSJ010000002.1:87924-88000_length:77_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:191465-191498_length:34_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:569149-569214_length:66_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000003.1:457685-457761_length:77_mod0000 -M_T0_RID62_S0_NC_023303.1:251-301_length:51_mod0000 -M_T0_RID62_S0_NZ_JBDYRX010000001.1:304278-304333_length:56_mod0000 -M_T0_RID62_S1_NC_023427.1:835-900_length:66_mod0000 -M_T0_RID62_S1_NC_027016.1:54356-54406_length:51_mod0000 -M_T0_RID62_S1_NC_028133.1:2961-2996_length:36_mod0000 -M_T0_RID62_S1_NC_031083.1:3710-3834_length:125_mod0000 -M_T0_RID62_S1_NC_031463.1:8948-8994_length:47_mod0000 -M_T0_RID62_S1_NZ_JBDYRX010000003.1:182597-182668_length:72_mod0001 -M_T0_RID62_S1_NZ_JBDYSJ010000001.1:192588-192667_length:80_mod0001 -M_T0_RID63_S0_NC_028144.1:6011-6113_length:103_mod0000 -M_T0_RID63_S0_NC_030240.1:102727-102785_length:59_mod0000 -M_T0_RID63_S0_NC_033760.1:1443-1573_length:131_mod0000 -M_T0_RID63_S0_NZ_JBDYLZ010000020.1:7118-7208_length:91_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000002.1:745773-745875_length:103_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000003.1:142067-142124_length:58_mod0000 -M_T0_RID63_S0_NZ_JBDYSJ010000003.1:151524-151569_length:46_mod0000 -M_T0_RID63_S1_NC_031236.1:11052-11140_length:89_mod0001 -M_T0_RID64_S0_NC_030748.1:1054-1124_length:71_mod0000 -M_T0_RID64_S1_NC_031093.1:6116-6176_length:61_mod0000 -M_T0_RID66_S0_NZ_JBDYLZ010000015.1:96499-96580_length:82_mod0000 -M_T0_RID66_S0_NZ_JBDYSJ010000002.1:346193-346225_length:33_mod0000 -M_T0_RID66_S1_NC_031305.1:4622-4714_length:93_mod0000 -M_T0_RID66_S1_NZ_JBDYRX010000002.1:340389-340472_length:84_mod0000 -M_T0_RID67_S0_NC_028134.1:42-92_length:51_mod0000 -M_T0_RID67_S0_NC_030447.1:1980-2070_length:91_mod0000 -M_T0_RID67_S0_NZ_JBDYRX010000004.1:332043-332120_length:78_mod0000 -M_T0_RID67_S0_NZ_JBDYSJ010000003.1:241049-241147_length:99_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000001.1:247375-247406_length:32_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000002.1:355091-355166_length:76_mod0000 -M_T0_RID68_S1_NC_034266.1:8834-8941_length:108_mod0000 -M_T0_RID68_S1_NZ_JBDYLZ010000016.1:69565-69646_length:82_mod0000 -M_T0_RID69_S0_NC_028368.1:19515-19575_length:61_mod0000 -M_T0_RID69_S0_NC_034266.1:30444-30515_length:72_mod0000 -M_T0_RID69_S0_NZ_JBDYLZ010000013.1:100003-100090_length:88_mod0000 -M_T0_RID69_S1_NZ_JBDYLZ010000016.1:63861-63942_length:82_mod0000 -M_T0_RID70_S0_NC_018404.1:2315-2374_length:60_mod0000 -M_T0_RID70_S1_NC_027713.1:293-401_length:109_mod0000 -M_T0_RID70_S1_NC_033830.1:3068-3146_length:79_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000007.1:118774-118860_length:87_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000016.1:66813-66865_length:53_mod0000 -M_T0_RID71_S0_NC_033620.1:14671-14724_length:54_mod0000 -M_T0_RID71_S1_NC_029562.1:2435-2497_length:63_mod0000 -M_T0_RID72_S0_NC_033716.1:7859-7951_length:93_mod0000 -M_T0_RID72_S1_NC_030117.1:83819-83856_length:38_mod0000 -M_T0_RID72_S1_NZ_JBDYLZ010000008.1:123604-123689_length:86_mod0000 -M_T0_RID73_S0_NC_030115.1:6022-6140_length:119_mod0000 -M_T0_RID73_S0_NC_030229.1:2674-2768_length:95_mod0000 -M_T0_RID73_S0_NC_033733.1:4354-4441_length:88_mod0001 -M_T0_RID74_S0_NC_031093.1:8592-8666_length:75_mod0000 -M_T0_RID74_S0_NZ_JBDYSJ010000002.1:362489-362559_length:71_mod0000 -M_T0_RID74_S1_NC_029302.1:212-295_length:84_mod0000 -M_T0_RID75_S0_NZ_JBDYRX010000001.1:235615-235682_length:68_mod0000 -M_T0_RID75_S1_NC_030235.1:6658-6691_length:34_mod0000 -M_T0_RID75_S1_NZ_JBDYLZ010000022.1:8709-8767_length:59_mod0000 -M_T0_RID75_S1_NZ_JBDYRX010000003.1:478660-478720_length:61_mod0000 -M_T0_RID76_S0_NC_018070.1:8778-8882_length:105_mod0000 -M_T0_RID76_S0_NC_029255.1:61305-61383_length:79_mod0000 -M_T0_RID76_S1_NC_027428.1:2290-2358_length:69_mod0000 -M_T0_RID76_S1_NC_030200.1:88040-88083_length:44_mod0000 -M_T0_RID76_S1_NC_033720.1:158-194_length:37_mod0000 -M_T0_RID77_S1_NC_033730.1:7657-7785_length:129_mod0000 -M_T0_RID78_S0_NC_023442.1:36825-36879_length:55_mod0000 -M_T0_RID78_S0_NC_027016.1:111926-112014_length:89_mod0000 -M_T0_RID78_S0_NZ_JBDYRX010000003.1:310444-310522_length:79_mod0000 -M_T0_RID78_S1_NC_030871.1:4415-4481_length:67_mod0000 -M_T0_RID78_S1_NC_031220.1:5976-6009_length:34_mod0000 -M_T0_RID79_S0_NC_029997.2:83992-84041_length:50_mod0000 -M_T0_RID79_S0_NC_030240.1:97988-98049_length:62_mod0000 -M_T0_RID79_S1_NC_033792.1:2479-2556_length:78_mod0000 -M_T0_RID79_S1_NZ_JBDYRX010000003.1:341785-341851_length:67_mod0001 -M_T0_RID80_S1_NZ_JBDYLZ010000010.1:13735-13769_length:35_mod0000 -M_T0_RID80_S1_NZ_JBDYSJ010000001.1:511944-512037_length:94_mod0000 -M_T0_RID81_S1_NC_027923.1:15413-15450_length:38_mod0000 -M_T0_RID82_S0_NC_027916.2:67438-67522_length:85_mod0001 -M_T0_RID82_S0_NC_028398.1:2368-2442_length:75_mod0000 -M_T0_RID82_S0_NC_033779.1:2219-2288_length:70_mod0000 -M_T0_RID82_S0_NZ_JBDYLZ010000016.1:9019-9115_length:97_mod0000 -M_T0_RID82_S0_NZ_JBDYRX010000001.1:261558-261662_length:105_mod0001 -M_T0_RID82_S1_NC_027016.1:72621-72680_length:60_mod0000 -M_T0_RID82_S1_NC_027535.1:2160-2253_length:94_mod0000 -M_T0_RID83_S1_NC_030159.1:273-312_length:40_mod0000 -M_T0_RID83_S1_NZ_JBDYLZ010000007.1:155539-155585_length:47_mod0000 -M_T0_RID83_S1_NZ_JBDYRX010000002.1:263346-263422_length:77_mod0000 -M_T0_RID84_S0_NZ_JBDYRX010000003.1:240685-240765_length:81_mod0000 -M_T0_RID84_S1_NZ_JBDYRX010000003.1:51637-51745_length:109_mod0000 -M_T0_RID85_S0_NZ_JBDYRX010000002.1:107354-107402_length:49_mod0000 -M_T0_RID85_S1_NC_023297.1:177-263_length:87_mod0000 -M_T0_RID85_S1_NC_030201.1:3764-3811_length:48_mod0000 -M_T0_RID85_S1_NZ_JBDYRX010000002.1:35225-35277_length:53_mod0000 -M_T0_RID86_S1_NC_028137.1:1830-1905_length:76_mod0000 -M_T0_RID86_S1_NC_033828.1:2664-2773_length:110_mod0000 -M_T0_RID86_S1_NZ_JBDYSJ010000001.1:383616-383681_length:66_mod0000 -M_T0_RID87_S0_NC_027631.1:5088-5147_length:60_mod0000 -M_T0_RID87_S0_NZ_JBDYLZ010000008.1:117199-117277_length:79_mod0000 -M_T0_RID87_S1_NZ_JBDYRX010000002.1:176453-176540_length:88_mod0000 -M_T0_RID89_S0_NC_028814.1:25832-25905_length:74_mod0000 -M_T0_RID89_S0_NZ_JBDYLZ010000010.1:109306-109408_length:103_mod0000 -M_T0_RID89_S1_NC_029064.1:9889-9971_length:83_mod0000 -M_T0_RID91_S0_NC_029997.2:19677-19742_length:66_mod0000 -M_T0_RID91_S0_NZ_JBDYSJ010000002.1:541980-542048_length:69_mod0001 -M_T0_RID91_S1_NC_028636.1:131522-131574_length:53_mod0000 -M_T0_RID91_S1_NZ_JBDYLZ010000015.1:73113-73211_length:99_mod0000 -M_T0_RID91_S1_NZ_JBDYRX010000002.1:531098-531224_length:127_mod0000 -M_T0_RID91_S1_NZ_JBDYSJ010000001.1:75425-75512_length:88_mod0000 -M_T0_RID92_S0_NC_033847.1:907-971_length:65_mod0001 -M_T0_RID92_S0_NZ_JBDYRX010000001.1:204153-204204_length:52_mod0000 -M_T0_RID93_S0_NC_029131.1:6029-6095_length:67_mod0000 -M_T0_RID93_S1_NZ_JBDYRX010000002.1:30248-30359_length:112_mod0000 -M_T0_RID94_S0_NC_028142.1:627-700_length:74_mod0000 -M_T0_RID94_S0_NC_033702.1:1317-1400_length:84_mod0000 -M_T0_RID94_S0_NC_033717.1:1284-1386_length:103_mod0000 -M_T0_RID95_S0_NC_018072.1:2591-2635_length:45_mod0000 -M_T0_RID95_S0_NC_027136.1:2231-2280_length:50_mod0000 -M_T0_RID95_S0_NC_029996.1:90789-90865_length:77_mod0000 -M_T0_RID95_S0_NZ_JBDYRX010000002.1:319590-319635_length:46_mod0000 -M_T0_RID95_S1_NC_033620.1:5347-5437_length:91_mod0000 -M_T0_RID96_S0_NC_028636.1:10556-10617_length:62_mod0000 -M_T0_RID96_S1_NC_028143.1:314-390_length:77_mod0000 -M_T0_RID97_S1_NZ_JBDYRX010000001.1:866338-866401_length:64_mod0001 -M_T0_RID97_S1_NZ_JBDYRX010000003.1:178272-178304_length:33_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000013.1:5680-5725_length:46_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000028.1:866-932_length:67_mod0000 -M_T0_RID98_S1_NC_029996.1:10631-10716_length:86_mod0000 -M_T0_RID99_S0_NC_030838.1:2068-2122_length:55_mod0000 -M_T0_RID99_S0_NC_031248.1:3321-3367_length:47_mod0000 -M_T0_RID99_S1_NC_027916.2:30126-30210_length:85_mod0000 -M_T0_RID99_S1_NC_030240.1:40035-40122_length:88_mod0000 -M_T0_RID99_S1_NC_031336.1:14128-14251_length:124_mod0001 -M_T0_RID99_S1_NZ_JBDYSJ010000001.1:396202-396267_length:66_mod0000 -M_T0_RID100_S0_NC_028376.1:14572-14682_length:111_mod0000 -M_T0_RID100_S0_NC_030697.1:970-1055_length:86_mod0000 -M_T0_RID100_S0_NZ_JBDYRX010000002.1:758402-758505_length:104_mod0000 -M_T0_RID101_S0_NZ_JBDYSJ010000001.1:645109-645147_length:39_mod0000 -M_T0_RID102_S0_NC_029255.1:63250-63323_length:74_mod0000 -M_T0_RID102_S0_NZ_JBDYSJ010000001.1:237444-237513_length:70_mod0000 -M_T0_RID103_S0_NC_028476.1:713-824_length:112_mod0000 -M_T0_RID103_S1_NC_031314.1:1276-1385_length:110_mod0000 -M_T0_RID103_S1_NC_031463.1:18479-18581_length:103_mod0000 -M_T0_RID103_S1_NZ_JBDYRX010000003.1:535271-535363_length:93_mod0000 -M_T0_RID105_S0_NC_030118.1:8503-8572_length:70_mod0000 -M_T0_RID105_S1_NC_027712.1:9939-9971_length:33_mod0000 -M_T0_RID105_S1_NC_030472.1:4177-4227_length:51_mod0000 -M_T0_RID106_S1_NC_028382.1:483-531_length:49_mod0000 -M_T0_RID106_S1_NZ_JBDYLZ010000017.1:12627-12692_length:66_mod0000 -M_T0_RID106_S1_NZ_JBDYRX010000001.1:885175-885267_length:93_mod0000 -M_T0_RID106_S1_NZ_JBDYSJ010000001.1:754603-754673_length:71_mod0000 -M_T0_RID107_S0_NZ_JBDYRX010000002.1:887203-887264_length:62_mod0000 -M_T0_RID107_S1_NC_027016.1:87956-88044_length:89_mod0000 -M_T0_RID107_S1_NC_028478.1:299-392_length:94_mod0000 -M_T0_RID107_S1_NZ_JBDYRX010000003.1:166903-166964_length:62_mod0001 -M_T0_RID107_S1_NZ_JBDYSJ010000001.1:252763-252845_length:83_mod0000 -M_T0_RID108_S1_NC_033767.1:689-744_length:56_mod0000 -M_T0_RID108_S1_NZ_JBDYSJ010000003.1:468268-468339_length:72_mod0000 -M_T0_RID109_S0_NZ_JBDYRX010000001.1:988451-988536_length:86_mod0000 -M_T0_RID110_S1_NC_028099.1:36637-36726_length:90_mod0000 -M_T0_RID110_S1_NZ_JBDYLZ010000015.1:71842-71908_length:67_mod0000 -M_T0_RID111_S0_NC_030232.1:3068-3100_length:33_mod0000 -M_T0_RID111_S0_NZ_JBDYRX010000002.1:284375-284457_length:83_mod0000 -M_T0_RID111_S1_NC_028491.1:22651-22727_length:77_mod0000 -M_T0_RID112_S1_NZ_JBDYRX010000004.1:227206-227261_length:56_mod0000 -M_T0_RID112_S1_NZ_JBDYSJ010000003.1:186720-186750_length:31_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000008.1:103905-103950_length:46_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000017.1:43421-43530_length:110_mod0000 -M_T0_RID114_S0_NZ_JBDYSJ010000001.1:888974-889061_length:88_mod0000 -M_T0_RID114_S1_NC_028485.1:4265-4351_length:87_mod0000 -M_T0_RID114_S1_NC_030654.1:5564-5612_length:49_mod0000 -M_T0_RID114_S1_NC_033763.1:670-745_length:76_mod0000 -M_T0_RID114_S1_NZ_JBDYSJ010000001.1:20373-20432_length:60_mod0000 -M_T0_RID115_S0_NC_033781.1:4795-4906_length:112_mod0000 -M_T0_RID115_S1_NC_031236.1:618-674_length:57_mod0000 -M_T0_RID116_S0_NC_028833.1:24900-24930_length:31_mod0000 -M_T0_RID116_S0_NZ_JBDYSJ010000001.1:278209-278280_length:72_mod0000 -M_T0_RID117_S0_NC_028491.1:76819-76945_length:127_mod0000 -M_T0_RID117_S0_NC_028636.1:51360-51406_length:47_mod0000 -M_T0_RID117_S0_NZ_JBDYRX010000002.1:695385-695511_length:127_mod0000 -M_T0_RID117_S0_NZ_JBDYSJ010000004.1:214232-214301_length:70_mod0000 -M_T0_RID117_S1_NZ_JBDYSJ010000001.1:254125-254189_length:65_mod0000 -M_T0_RID118_S1_NC_017967.1:3728-3792_length:65_mod0000 -M_T0_RID118_S1_NZ_JBDYLZ010000012.1:104385-104434_length:50_mod0000 -M_T0_RID118_S1_NZ_JBDYRX010000003.1:569089-569158_length:70_mod0000 -M_T0_RID119_S0_NC_027138.1:1980-2027_length:48_mod0000 -M_T0_RID119_S0_NZ_JBDYRX010000001.1:479636-479698_length:63_mod0000 -M_T0_RID119_S1_NC_030750.1:2333-2363_length:31_mod0000 -M_T0_RID120_S0_NZ_JBDYRX010000004.1:143311-143407_length:97_mod0000 -M_T0_RID120_S0_NZ_JBDYSJ010000002.1:211897-211962_length:66_mod0000 -M_T0_RID120_S1_NC_029255.1:99346-99425_length:80_mod0000 -M_T0_RID120_S1_NZ_JBDYLZ010000008.1:182987-183039_length:53_mod0000 -M_T0_RID121_S1_NZ_JBDYRX010000003.1:22645-22773_length:129_mod0000 -M_T0_RID122_S0_NZ_JBDYSJ010000002.1:28060-28162_length:103_mod0000 -M_T0_RID122_S1_NZ_JBDYRX010000002.1:593335-593394_length:60_mod0000 -M_T0_RID123_S1_NC_029932.1:780-841_length:62_mod0000 -M_T0_RID123_S1_NZ_JBDYRX010000002.1:624572-624628_length:57_mod0000 -M_T0_RID123_S1_NZ_JBDYSJ010000003.1:205052-205133_length:82_mod0000 -M_T0_RID124_S0_NC_018105.1:1032-1078_length:47_mod0000 -M_T0_RID124_S0_NC_027016.1:37306-37377_length:72_mod0000 -M_T0_RID124_S0_NC_027430.1:2075-2124_length:50_mod0000 -M_T0_RID124_S0_NC_033751.1:1175-1283_length:109_mod0000 -M_T0_RID124_S0_NZ_JBDYLZ010000012.1:107683-107735_length:53_mod0000 -M_T0_RID124_S1_NC_029783.1:12839-12935_length:97_mod0000 -M_T0_RID125_S1_NC_024911.1:585-717_length:133_mod0000 -M_T0_RID125_S1_NZ_JBDYRX010000002.1:524061-524121_length:61_mod0000 -M_T0_RID126_S0_NZ_JBDYSJ010000003.1:204369-204435_length:67_mod0000 -M_T0_RID126_S1_NC_027136.1:6692-6786_length:95_mod0000 -M_T0_RID126_S1_NZ_JBDYLZ010000007.1:147969-148026_length:58_mod0000 -M_T0_RID126_S1_NZ_JBDYSJ010000001.1:849768-849826_length:59_mod0000 -M_T0_RID127_S0_NZ_JBDYLZ010000019.1:20624-20673_length:50_mod0000 -M_T0_RID127_S1_NC_033619.1:4029-4155_length:127_mod0000 -M_T0_RID127_S1_NZ_JBDYRX010000004.1:112527-112563_length:37_mod0000 -M_T0_RID128_S0_NC_033620.1:26172-26261_length:90_mod0000 -M_T0_RID128_S0_NZ_JBDYSJ010000001.1:127550-127596_length:47_mod0000 -M_T0_RID128_S1_NZ_JBDYLZ010000010.1:81225-81326_length:102_mod0000 -M_T0_RID129_S0_NC_028372.1:12347-12414_length:68_mod0001 -M_T0_RID129_S0_NC_030844.1:4967-5083_length:117_mod0001 -M_T0_RID129_S1_NZ_JBDYSJ010000001.1:451837-451880_length:44_mod0000 -M_T0_RID130_S0_NZ_JBDYSJ010000001.1:904477-904569_length:93_mod0000 -M_T0_RID130_S1_NC_030400.1:8920-8964_length:45_mod0000 -M_T0_RID131_S0_NC_030200.1:24540-24653_length:114_mod0000 -M_T0_RID131_S0_NZ_JBDYRX010000004.1:307376-307435_length:60_mod0001 -M_T0_RID131_S1_NZ_JBDYRX010000002.1:215925-215981_length:57_mod0000 -M_T0_RID132_S0_NC_029132.1:26524-26609_length:86_mod0000 -M_T0_RID132_S0_NZ_JBDYRX010000002.1:856095-856160_length:66_mod0000 -M_T0_RID132_S1_NC_028099.1:70003-70100_length:98_mod0000 -M_T0_RID132_S1_NC_028636.1:77454-77493_length:40_mod0000 -M_T0_RID133_S0_NC_027210.1:8798-8910_length:113_mod0000 -M_T0_RID133_S1_NZ_JBDYLZ010000014.1:82781-82835_length:55_mod0000 -M_T0_RID134_S0_NC_034266.1:203255-203287_length:33_mod0000 -M_T0_RID134_S1_NC_033705.1:7105-7262_length:158_mod0000 -M_T0_RID135_S0_NC_033733.1:6746-6806_length:61_mod0000 -M_T0_RID135_S1_NZ_JBDYSJ010000004.1:255279-255341_length:63_mod0000 -M_T0_RID136_S0_NZ_JBDYSJ010000001.1:562721-562768_length:48_mod0000 -M_T0_RID136_S1_NC_030200.1:80911-80976_length:66_mod0001 -M_T0_RID136_S1_NZ_JBDYLZ010000009.1:44314-44384_length:71_mod0000 -M_T0_RID136_S1_NZ_JBDYLZ010000018.1:9886-9961_length:76_mod0000 -M_T0_RID136_S1_NZ_JBDYRX010000001.1:825042-825123_length:82_mod0000 -M_T0_RID137_S0_NC_031083.1:11357-11420_length:64_mod0000 -M_T0_RID137_S0_NZ_JBDYSJ010000002.1:311215-311270_length:56_mod0000 -M_T0_RID137_S1_NC_034266.1:15288-15392_length:105_mod0000 -M_T0_RID137_S1_NZ_JBDYSJ010000002.1:109720-109762_length:43_mod0000 -M_T0_RID138_S0_NC_033730.1:4735-4793_length:59_mod0000 -M_T0_RID139_S0_NC_029076.1:5391-5472_length:82_mod0000 -M_T0_RID139_S0_NC_029131.1:3428-3518_length:91_mod0000 -M_T0_RID139_S1_NC_027128.1:7467-7524_length:58_mod0000 -M_T0_RID139_S1_NC_033730.1:8262-8350_length:89_mod0000 -M_T0_RID140_S0_NC_031216.1:8965-9047_length:83_mod0000 -M_T0_RID140_S1_NC_029996.1:128484-128577_length:94_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000007.1:238838-238873_length:36_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000015.1:16859-16896_length:38_mod0000 -M_T0_RID142_S0_NC_027916.2:139729-139809_length:81_mod0001 -M_T0_RID142_S0_NC_030873.1:562-633_length:72_mod0000 -M_T0_RID142_S0_NZ_JBDYSJ010000003.1:9947-10048_length:102_mod0001 -M_T0_RID144_S0_NC_030200.1:1026-1085_length:60_mod0001 -M_T0_RID144_S0_NZ_JBDYRX010000002.1:297802-297909_length:108_mod0000 -M_T0_RID145_S0_NZ_JBDYSJ010000001.1:690815-690908_length:94_mod0000 -M_T0_RID146_S0_NC_028636.1:8587-8640_length:54_mod0000 -M_T0_RID147_S0_NC_030839.1:401-442_length:42_mod0000 -M_T0_RID147_S1_NZ_JBDYRX010000002.1:330619-330694_length:76_mod0000 -M_T0_RID148_S1_NZ_JBDYRX010000002.1:14264-14309_length:46_mod0000 -M_T0_RID149_S0_NZ_JBDYSJ010000001.1:617340-617447_length:108_mod0000 -M_T0_RID149_S1_NC_028249.1:10239-10323_length:85_mod0000 -M_T0_RID149_S1_NZ_JBDYLZ010000008.1:120921-120959_length:39_mod0000 -M_T0_RID150_S1_NZ_JBDYRX010000004.1:384747-384794_length:48_mod0000 -M_T0_RID152_S1_NZ_JBDYRX010000004.1:353714-353802_length:89_mod0000 -M_T0_RID153_S0_NZ_JBDYRX010000003.1:52603-52715_length:113_mod0000 -M_T0_RID153_S1_NC_028364.1:137-249_length:113_mod0000 -M_T0_RID154_S0_NZ_JBDYRX010000003.1:602237-602274_length:38_mod0000 -M_T0_RID154_S1_NC_028386.1:1116-1181_length:66_mod0000 -M_T0_RID154_S1_NC_033620.1:12644-12716_length:73_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000002.1:675599-675679_length:81_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000003.1:514528-514581_length:54_mod0000 -M_T0_RID155_S0_NC_033701.1:9275-9317_length:43_mod0000 -M_T0_RID156_S1_NC_023295.1:2064-2141_length:78_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000006.1:281471-281567_length:97_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000011.1:132268-132312_length:45_mod0000 -M_T0_RID158_S1_NC_028241.1:531-607_length:77_mod0000 -M_T0_RID159_S0_NC_029311.1:69011-69045_length:35_mod0000 -M_T0_RID159_S0_NC_031216.1:6290-6405_length:116_mod0000 -M_T0_RID159_S0_NC_033620.1:32537-32621_length:85_mod0000 -M_T0_RID159_S0_NZ_JBDYSJ010000002.1:600959-600995_length:37_mod0000 -M_T0_RID161_S1_NC_030240.1:83741-83790_length:50_mod0000 -M_T0_RID162_S0_NZ_JBDYLZ010000008.1:5183-5216_length:34_mod0000 -M_T0_RID162_S1_NC_017862.1:7381-7452_length:72_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:584559-584609_length:51_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:726659-726738_length:80_mod0000 -M_T0_RID163_S0_NC_033620.1:156883-156969_length:87_mod0000 -M_T0_RID163_S1_NC_030275.1:100083-100169_length:87_mod0000 -M_T0_RID164_S0_NZ_JBDYLZ010000018.1:17968-18030_length:63_mod0000 -M_T0_RID164_S1_NC_033620.1:130668-130713_length:46_mod0000 -M_T0_RID164_S1_NZ_JBDYRX010000004.1:519479-519563_length:85_mod0000 -M_T0_RID165_S0_NC_027917.1:1959-2051_length:93_mod0000 -M_T0_RID166_S0_NZ_JBDYRX010000004.1:59696-59805_length:110_mod0000 -M_T0_RID167_S0_NZ_JBDYLZ010000007.1:38370-38443_length:74_mod0000 -M_T0_RID168_S0_NC_030225.1:5381-5465_length:85_mod0001 -M_T0_RID168_S0_NC_030236.1:5080-5154_length:75_mod0000 -M_T0_RID169_S0_NC_028263.1:913-994_length:82_mod0000 -M_T0_RID169_S0_NZ_JBDYLZ010000007.1:16953-17017_length:65_mod0000 -M_T0_RID169_S1_NC_017970.1:7200-7322_length:123_mod0000 -M_T0_RID169_S1_NC_027016.1:84360-84421_length:62_mod0000 -M_T0_RID169_S1_NC_031295.1:1211-1283_length:73_mod0001 -M_T0_RID170_S1_NZ_JBDYRX010000001.1:71554-71642_length:89_mod0000 -M_T0_RID171_S0_NC_023429.1:1938-1983_length:46_mod0000 -M_T0_RID171_S0_NZ_JBDYRX010000001.1:944221-944313_length:93_mod0001 -M_T0_RID171_S1_NC_028891.1:8612-8645_length:34_mod0000 -M_T0_RID172_S0_NC_031455.1:2261-2316_length:56_mod0000 -M_T0_RID172_S1_NC_028383.1:1536-1621_length:86_mod0000 -M_T0_RID172_S1_NC_031293.1:5209-5302_length:94_mod0000 -M_T0_RID172_S1_NZ_JBDYSJ010000002.1:22259-22312_length:54_mod0000 -M_T0_RID173_S0_NC_033710.1:8523-8561_length:39_mod0000 -M_T0_RID173_S0_NZ_JBDYRX010000004.1:391209-391337_length:129_mod0000 -M_T0_RID173_S1_NZ_JBDYLZ010000022.1:5769-5818_length:50_mod0000 -M_T0_RID173_S1_NZ_JBDYSJ010000001.1:629973-630049_length:77_mod0000 -M_T0_RID174_S1_NC_030158.1:2752-2787_length:36_mod0000 -M_T0_RID174_S1_NC_031339.1:433-463_length:31_mod0000 -M_T0_RID174_S1_NZ_JBDYLZ010000006.1:10668-10748_length:81_mod0000 -M_T0_RID175_S0_NZ_JBDYLZ010000018.1:25042-25131_length:90_mod0000 -M_T0_RID175_S1_NZ_JBDYSJ010000001.1:899529-899569_length:41_mod0000 -M_T0_RID176_S0_NC_030200.1:58204-58287_length:84_mod0000 -M_T0_RID176_S0_NZ_JBDYRX010000002.1:668726-668775_length:50_mod0000 -M_T0_RID176_S1_NZ_JBDYSJ010000003.1:471518-471566_length:49_mod0001 -M_T0_RID177_S1_NZ_JBDYRX010000002.1:466682-466753_length:72_mod0000 -M_T0_RID178_S0_NC_028099.1:31084-31207_length:124_mod0000 -M_T0_RID178_S0_NC_033620.1:149729-149799_length:71_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000001.1:853106-853172_length:67_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000002.1:203092-203185_length:94_mod0000 -M_T0_RID179_S0_NC_023442.1:39001-39088_length:88_mod0000 -M_T0_RID179_S0_NZ_JBDYRX010000004.1:52140-52225_length:86_mod0000 -M_T0_RID179_S0_NZ_JBDYSJ010000001.1:721050-721084_length:35_mod0001 -M_T0_RID180_S0_NZ_JBDYSJ010000002.1:534591-534638_length:48_mod0000 -M_T0_RID180_S1_NC_029801.1:1212-1290_length:79_mod0000 -M_T0_RID181_S0_NC_023420.2:1575-1682_length:108_mod0000 -M_T0_RID181_S0_NZ_JBDYSJ010000001.1:400625-400659_length:35_mod0000 -M_T0_RID181_S1_NZ_JBDYLZ010000022.1:10488-10567_length:80_mod0000 -M_T0_RID182_S1_NC_030115.1:4690-4735_length:46_mod0000 -M_T0_RID183_S0_NC_029996.1:43664-43722_length:59_mod0000 -M_T0_RID185_S1_NZ_JBDYRX010000003.1:308336-308406_length:71_mod0001 -M_T0_RID185_S1_NZ_JBDYRX010000004.1:191608-191699_length:92_mod0000 -M_T0_RID187_S0_NC_029132.1:3505-3621_length:117_mod0000 -M_T0_RID187_S1_NC_028833.1:12138-12185_length:48_mod0001 -M_T0_RID187_S1_NZ_JBDYLZ010000007.1:48250-48349_length:100_mod0000 -M_T0_RID187_S1_NZ_JBDYRX010000001.1:251442-251541_length:100_mod0000 -M_T0_RID188_S0_NC_033620.1:60461-60546_length:86_mod0000 -M_T0_RID188_S0_NC_033745.1:5844-5924_length:81_mod0000 -M_T0_RID188_S1_NC_030746.1:5743-5836_length:94_mod0000 -M_T0_RID188_S1_NZ_JBDYSJ010000001.1:693404-693463_length:60_mod0000 -M_T0_RID190_S0_NC_028099.1:110295-110391_length:97_mod0000 -M_T0_RID190_S0_NC_031463.1:15502-15572_length:71_mod0000 -M_T0_RID190_S0_NZ_JBDYSJ010000002.1:205146-205255_length:110_mod0000 -M_T0_RID190_S1_NC_031291.1:89-172_length:84_mod0000 -M_T0_RID190_S1_NZ_JBDYRX010000001.1:953429-953485_length:57_mod0001 -M_T0_RID191_S0_NC_028811.1:13630-13691_length:62_mod0000 -M_T0_RID191_S0_NC_029255.1:128444-128478_length:35_mod0000 -M_T0_RID191_S1_NC_027706.1:673-702_length:30_mod0000 -M_T0_RID192_S0_NC_030202.1:1974-2037_length:64_mod0000 -M_T0_RID192_S0_NZ_JBDYSJ010000002.1:499003-499042_length:40_mod0000 -M_T0_RID192_S1_NC_028266.1:2491-2562_length:72_mod0000 -M_T0_RID192_S1_NC_029935.1:3672-3749_length:78_mod0000 -M_T0_RID193_S0_NC_030796.1:1139-1218_length:80_mod0000 -M_T0_RID193_S0_NZ_JBDYLZ010000006.1:65091-65167_length:77_mod0000 -M_T0_RID193_S1_NC_029311.1:3962-4023_length:62_mod0000 -M_T0_RID193_S1_NC_029854.1:2071-2138_length:68_mod0001 -M_T0_RID193_S1_NZ_JBDYLZ010000018.1:32241-32282_length:42_mod0000 -M_T0_RID193_S1_NZ_JBDYSJ010000004.1:33272-33325_length:54_mod0000 -M_T0_RID194_S0_NZ_JBDYRX010000001.1:29953-30068_length:116_mod0000 -M_T0_RID194_S1_NC_027117.1:4-75_length:72_mod0000 -M_T0_RID194_S1_NZ_JBDYSJ010000002.1:458031-458124_length:94_mod0000 -M_T0_RID195_S0_NC_029126.1:5551-5630_length:80_mod0000 -M_T0_RID195_S0_NC_030117.1:78912-78948_length:37_mod0000 -M_T0_RID195_S0_NZ_JBDYLZ010000010.1:56983-57024_length:42_mod0000 -M_T0_RID196_S0_NC_028891.1:12640-12710_length:71_mod0000 -M_T0_RID196_S0_NZ_JBDYSJ010000001.1:166064-166125_length:62_mod0000 -M_T0_RID196_S1_NC_029306.1:173-274_length:102_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000001.1:85071-85115_length:45_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000003.1:358250-358311_length:62_mod0001 -M_T0_RID198_S1_NZ_JBDYLZ010000012.1:46495-46566_length:72_mod0000 -M_T0_RID198_S1_NZ_JBDYSJ010000001.1:185655-185715_length:61_mod0000 -M_T0_RID199_S0_NZ_JBDYRX010000001.1:904336-904396_length:61_mod0000 -M_T0_RID200_S1_NZ_JBDYRX010000001.1:660511-660552_length:42_mod0000 -M_T0_RID201_S0_NZ_JBDYLZ010000028.1:698-764_length:67_mod0000 -M_T0_RID201_S1_NZ_JBDYSJ010000001.1:587635-587727_length:93_mod0000 -M_T0_RID202_S0_NZ_JBDYLZ010000009.1:73121-73183_length:63_mod0000 -M_T0_RID203_S1_NC_027923.1:89467-89574_length:108_mod0000 -M_T0_RID203_S1_NC_028470.1:6286-6372_length:87_mod0000 -M_T0_RID204_S0_NZ_JBDYSJ010000003.1:424711-424783_length:73_mod0000 -M_T0_RID204_S1_NZ_JBDYLZ010000009.1:157953-158008_length:56_mod0000 -M_T0_RID205_S0_NC_028806.1:14973-15042_length:70_mod0001 -M_T0_RID205_S0_NC_031336.1:5585-5707_length:123_mod0000 -M_T0_RID205_S0_NC_033710.1:1140-1174_length:35_mod0001 -M_T0_RID205_S0_NC_034377.1:309-345_length:37_mod0000 -M_T0_RID205_S0_NZ_JBDYRX010000001.1:648020-648102_length:83_mod0000 -M_T0_RID206_S0_NZ_JBDYRX010000003.1:657781-657875_length:95_mod0000 -M_T0_RID206_S1_NZ_JBDYSJ010000002.1:507837-507900_length:64_mod0000 -M_T0_RID207_S0_NC_029782.1:2571-2655_length:85_mod0000 -M_T0_RID207_S0_NC_033756.1:9757-9804_length:48_mod0000 -M_T0_RID207_S1_NC_028470.1:3881-3944_length:64_mod0000 -M_T0_RID207_S1_NC_029111.1:391-425_length:35_mod0000 -M_T0_RID208_S1_NC_028137.1:3146-3238_length:93_mod0000 -M_T0_RID209_S1_NC_027016.1:200405-200534_length:130_mod0000 -M_T0_RID209_S1_NZ_JBDYRX010000003.1:693765-693849_length:85_mod0000 -M_T0_RID211_S0_NC_030749.1:1821-1921_length:101_mod0000 -M_T0_RID211_S0_NZ_JBDYSJ010000002.1:199161-199238_length:78_mod0000 -M_T0_RID212_S0_NC_028462.1:2849-2888_length:40_mod0000 -M_T0_RID212_S0_NC_031272.1:7400-7455_length:56_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:220611-220694_length:84_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:824198-824247_length:50_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000002.1:522607-522670_length:64_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000003.1:35532-35575_length:44_mod0000 -M_T0_RID213_S1_NC_027619.1:3998-4074_length:77_mod0000 -M_T0_RID214_S0_NC_017990.1:4036-4109_length:74_mod0000 -M_T0_RID214_S0_NZ_JBDYRX010000004.1:6306-6380_length:75_mod0000 -M_T0_RID214_S1_NZ_JBDYLZ010000016.1:26291-26346_length:56_mod0001 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:332282-332360_length:79_mod0000 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:457564-457597_length:34_mod0000 -M_T0_RID215_S1_NZ_JBDYRX010000004.1:547476-547541_length:66_mod0000 -M_T0_RID217_S0_NC_030922.1:6414-6531_length:118_mod0000 -M_T0_RID217_S0_NZ_JBDYRX010000001.1:366993-367094_length:102_mod0000 -M_T0_RID217_S1_NC_017970.1:8697-8737_length:41_mod0000 -M_T0_RID217_S1_NC_018482.1:2018-2099_length:82_mod0000 -M_T0_RID219_S0_NZ_JBDYLZ010000006.1:135272-135372_length:101_mod0001 -M_T0_RID219_S1_NZ_JBDYRX010000003.1:132173-132251_length:79_mod0000 -M_T0_RID220_S0_NC_033725.1:8661-8722_length:62_mod0000 -M_T0_RID220_S1_NZ_JBDYRX010000003.1:133141-133229_length:89_mod0000 -M_T0_RID221_S0_NZ_JBDYRX010000001.1:771011-771087_length:77_mod0000 -M_T0_RID222_S0_NC_037572.1:1818-1871_length:54_mod0000 -M_T0_RID222_S1_NC_028485.1:810-872_length:63_mod0000 -M_T0_RID222_S1_NC_030793.1:2889-2992_length:104_mod0000 -M_T0_RID222_S1_NZ_JBDYRX010000001.1:301419-301533_length:115_mod0001 -M_T0_RID223_S1_NC_033620.1:157690-157751_length:62_mod0000 -M_T0_RID224_S0_NC_017937.1:2859-2949_length:91_mod0000 -M_T0_RID224_S1_NC_028388.1:2224-2291_length:68_mod0001 -M_T0_RID224_S1_NC_033700.1:22817-22886_length:70_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000001.1:692859-692944_length:86_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000004.1:483631-483701_length:71_mod0000 -M_T0_RID225_S1_NC_029311.1:72416-72523_length:108_mod0000 -M_T0_RID225_S1_NC_030240.1:91908-91984_length:77_mod0000 -M_T0_RID226_S0_NZ_JBDYRX010000001.1:678003-678073_length:71_mod0000 -M_T0_RID226_S1_NZ_JBDYRX010000001.1:984964-985038_length:75_mod0000 -M_T0_RID227_S0_NC_028636.1:35420-35507_length:88_mod0000 -M_T0_RID227_S0_NZ_JBDYLZ010000014.1:18260-18351_length:92_mod0000 -M_T0_RID227_S1_NZ_JBDYLZ010000010.1:2424-2519_length:96_mod0000 -M_T0_RID229_S0_NZ_JBDYRX010000002.1:664717-664801_length:85_mod0000 -M_T0_RID230_S0_NC_033822.1:1869-1967_length:99_mod0000 -M_T0_RID230_S0_NZ_JBDYRX010000002.1:244562-244600_length:39_mod0000 -M_T0_RID231_S0_NC_034017.1:4341-4449_length:109_mod0000 -M_T0_RID231_S0_NZ_JBDYRX010000002.1:364966-365054_length:89_mod0000 -M_T0_RID231_S1_NZ_JBDYRX010000004.1:275949-276005_length:57_mod0001 -M_T0_RID233_S0_NC_030402.1:4056-4127_length:72_mod0000 -M_T0_RID234_S0_NZ_JBDYSJ010000001.1:910286-910315_length:30_mod0000 -M_T0_RID234_S1_NZ_JBDYSJ010000003.1:84105-84229_length:125_mod0000 -M_T0_RID235_S0_NC_029997.2:52965-53016_length:52_mod0000 -M_T0_RID235_S0_NZ_JBDYRX010000004.1:469577-469661_length:85_mod0000 -M_T0_RID235_S1_NC_029993.1:68-156_length:89_mod0000 -M_T0_RID236_S0_NC_027209.1:15-106_length:92_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000001.1:879200-879251_length:52_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000002.1:665177-665206_length:30_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:172535-172571_length:37_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:365370-365448_length:79_mod0000 -M_T0_RID237_S1_NZ_JBDYRX010000003.1:311400-311455_length:56_mod0000 -M_T0_RID237_S1_NZ_JBDYSJ010000001.1:341900-342051_length:152_mod0001 -M_T0_RID237_S1_NZ_JBDYSJ010000002.1:210078-210161_length:84_mod0000 -M_T0_RID239_S1_NZ_JBDYLZ010000008.1:60180-60243_length:64_mod0000 -M_T0_RID240_S0_NC_028376.1:8889-8978_length:90_mod0000 -M_T0_RID240_S0_NZ_JBDYLZ010000011.1:107039-107086_length:48_mod0000 -M_T0_RID240_S1_NC_029255.1:88189-88282_length:94_mod0000 -M_T0_RID242_S0_NC_031275.1:6726-6767_length:42_mod0000 -M_T0_RID242_S1_NZ_JBDYRX010000003.1:456427-456495_length:69_mod0000 -M_T0_RID243_S0_NC_038232.1:593-634_length:42_mod0000 -M_T0_RID244_S0_NZ_JBDYRX010000004.1:71169-71250_length:82_mod0000 -M_T0_RID244_S1_NC_031105.1:1094-1177_length:84_mod0000 -M_T0_RID244_S1_NZ_JBDYRX010000003.1:93344-93453_length:110_mod0000 -M_T0_RID245_S1_NC_027916.2:74440-74509_length:70_mod0000 -M_T0_RID246_S0_NZ_JBDYLZ010000007.1:253179-253255_length:77_mod0000 -M_T0_RID246_S0_NZ_JBDYRX010000003.1:373773-373844_length:72_mod0000 -M_T0_RID247_S1_NC_034240.1:6159-6240_length:82_mod0000 -M_T0_RID247_S1_NZ_JBDYLZ010000006.1:319402-319479_length:78_mod0000 -M_T0_RID248_S1_NZ_JBDYLZ010000021.1:15403-15484_length:82_mod0000 -M_T0_RID248_S1_NZ_JBDYSJ010000002.1:614316-614362_length:47_mod0000 -M_T0_RID249_S1_NZ_JBDYSJ010000002.1:599779-599834_length:56_mod0000 -M_T0_RID250_S0_NC_027916.2:147626-147747_length:122_mod0000 -M_T0_RID250_S0_NC_033620.1:26136-26203_length:68_mod0000 -M_T0_RID251_S1_NZ_JBDYRX010000003.1:388429-388516_length:88_mod0001 -M_T0_RID252_S0_NZ_JBDYRX010000003.1:533554-533659_length:106_mod0000 -M_T0_RID252_S0_NZ_JBDYSJ010000004.1:89796-89871_length:76_mod0000 -M_T0_RID254_S0_NC_029312.1:1320-1415_length:96_mod0000 -M_T0_RID254_S1_NC_033722.1:1513-1562_length:50_mod0000 -M_T0_RID254_S1_NZ_JBDYRX010000003.1:600746-600803_length:58_mod0000 -M_T0_RID255_S1_NZ_JBDYLZ010000009.1:84943-85024_length:82_mod0000 -M_T0_RID256_S0_NZ_JBDYRX010000002.1:72764-72831_length:68_mod0000 -M_T0_RID256_S1_NZ_JBDYSJ010000003.1:105583-105635_length:53_mod0001 -M_T0_RID257_S0_NC_029997.2:11591-11678_length:88_mod0000 -M_T0_RID257_S0_NZ_JBDYLZ010000007.1:42813-42887_length:75_mod0000 -M_T0_RID258_S0_NC_030151.1:5275-5349_length:75_mod0000 -M_T0_RID258_S1_NC_023442.1:46718-46759_length:42_mod0000 -M_T0_RID258_S1_NC_027641.1:2606-2691_length:86_mod0000 -M_T0_RID259_S0_NZ_JBDYRX010000001.1:515399-515441_length:43_mod0000 -M_T0_RID259_S1_NC_033710.1:2139-2199_length:61_mod0001 -M_T0_RID260_S0_NZ_JBDYRX010000004.1:304887-304994_length:108_mod0000 -M_T0_RID261_S0_NC_024913.1:363-436_length:74_mod0000 -M_T0_RID261_S1_NZ_JBDYSJ010000003.1:83891-83937_length:47_mod0000 -M_T0_RID262_S0_NC_028964.1:8465-8506_length:42_mod0000 -M_T0_RID262_S1_NC_028369.1:11507-11563_length:57_mod0000 -M_T0_RID263_S1_NZ_JBDYLZ010000007.1:59938-60023_length:86_mod0000 -M_T0_RID264_S1_NC_030240.1:10284-10380_length:97_mod0000 -M_T0_RID266_S0_NZ_JBDYRX010000003.1:575037-575078_length:42_mod0000 -M_T0_RID268_S0_NZ_JBDYRX010000001.1:768153-768245_length:93_mod0000 -M_T0_RID268_S0_NZ_JBDYSJ010000001.1:798703-798770_length:68_mod0000 -M_T0_RID270_S0_NC_029132.1:95722-95798_length:77_mod0000 -M_T0_RID270_S1_NZ_JBDYSJ010000004.1:222075-222158_length:84_mod0000 -M_T0_RID271_S0_NC_033620.1:162451-162504_length:54_mod0000 -M_T0_RID272_S0_NC_033620.1:33874-33960_length:87_mod0000 -M_T0_RID273_S1_NC_030744.1:7300-7340_length:41_mod0000 -M_T0_RID273_S1_NZ_JBDYRX010000002.1:841729-841840_length:112_mod0000 -M_T0_RID274_S1_NC_037571.1:1402-1475_length:74_mod0000 -M_T0_RID274_S1_NC_037615.1:1507-1556_length:50_mod0000 -M_T0_RID274_S1_NZ_JBDYRX010000002.1:803747-803830_length:84_mod0001 -M_T0_RID276_S0_NZ_JBDYSJ010000001.1:37440-37524_length:85_mod0000 -M_T0_RID276_S1_NZ_JBDYSJ010000003.1:418336-418453_length:118_mod0000 -M_T0_RID277_S1_NZ_JBDYLZ010000010.1:25227-25303_length:77_mod0000 -M_T0_RID277_S1_NZ_JBDYRX010000004.1:42366-42442_length:77_mod0000 -M_T0_RID280_S1_NC_029255.1:110657-110707_length:51_mod0000 -M_T0_RID280_S1_NZ_JBDYLZ010000007.1:148039-148124_length:86_mod0000 -M_T0_RID280_S1_NZ_JBDYSJ010000003.1:358558-358656_length:99_mod0000 -M_T0_RID281_S0_NZ_JBDYRX010000001.1:319973-320043_length:71_mod0000 -M_T0_RID281_S1_NC_033717.1:9058-9157_length:100_mod0000 -M_T0_RID281_S1_NZ_JBDYLZ010000009.1:175718-175802_length:85_mod0000 -M_T0_RID282_S0_NZ_JBDYRX010000002.1:378265-378345_length:81_mod0001 -M_T0_RID283_S1_NC_027016.1:6355-6413_length:59_mod0000 -M_T0_RID283_S1_NC_028230.1:391-510_length:120_mod0000 -M_T0_RID285_S1_NC_034376.1:1364-1410_length:47_mod0000 -M_T0_RID286_S1_NC_027918.1:6177-6259_length:83_mod0000 -M_T0_RID287_S0_NZ_JBDYRX010000003.1:370134-370205_length:72_mod0000 -M_T0_RID289_S0_NZ_JBDYRX010000001.1:744827-744955_length:129_mod0000 -M_T0_RID289_S1_NC_028259.1:3827-3878_length:52_mod0000 -M_T0_RID290_S0_NC_030240.1:45198-45233_length:36_mod0000 -M_T0_RID290_S0_NC_030691.1:1722-1773_length:52_mod0000 -M_T0_RID290_S1_NC_029133.1:4034-4132_length:99_mod0000 -M_T0_RID291_S1_NC_028981.1:5970-6046_length:77_mod0000 -M_T0_RID291_S1_NZ_JBDYSJ010000002.1:464139-464169_length:31_mod0000 -M_T0_RID293_S1_NC_030232.1:2260-2327_length:68_mod0000 -M_T0_RID295_S1_NC_027916.2:61867-61920_length:54_mod0000 -M_T0_RID295_S1_NC_028806.1:27530-27608_length:79_mod0000 -M_T0_RID296_S0_NZ_JBDYSJ010000001.1:184354-184410_length:57_mod0000 -M_T0_RID296_S1_NC_028867.1:5870-5944_length:75_mod0000 -M_T0_RID296_S1_NC_029034.2:6068-6170_length:103_mod0000 -M_T0_RID296_S1_NC_029575.1:1786-1824_length:39_mod0000 -M_T0_RID296_S1_NC_031313.1:8320-8423_length:104_mod0000 -M_T0_RID296_S1_NZ_JBDYRX010000001.1:732093-732144_length:52_mod0000 -M_T0_RID300_S0_NC_030870.1:888-963_length:76_mod0000 -M_T0_RID300_S1_NC_028239.1:12981-13075_length:95_mod0001 -M_T0_RID301_S0_NC_027016.1:47977-48089_length:113_mod0000 -M_T0_RID301_S0_NC_029997.2:77533-77588_length:56_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000001.1:795273-795348_length:76_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000003.1:723584-723651_length:68_mod0000 -M_T0_RID302_S1_NC_033820.1:4695-4770_length:76_mod0000 -M_T0_RID303_S0_NZ_JBDYSJ010000002.1:596456-596511_length:56_mod0000 -M_T0_RID303_S1_NZ_JBDYLZ010000013.1:92895-92926_length:32_mod0000 -M_T0_RID304_S0_NC_031463.1:20675-20751_length:77_mod0000 -M_T0_RID306_S0_NC_027916.2:96621-96699_length:79_mod0000 -M_T0_RID307_S0_NC_028266.1:10941-10980_length:40_mod0000 -M_T0_RID308_S1_NZ_JBDYLZ010000010.1:103191-103276_length:86_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:370261-370296_length:36_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:387786-387861_length:76_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000003.1:389721-389777_length:57_mod0000 -M_T0_RID309_S1_NC_026944.1:4310-4395_length:86_mod0000 -M_T0_RID309_S1_NZ_JBDYSJ010000001.1:151328-151382_length:55_mod0000 -M_T0_RID311_S0_NZ_JBDYLZ010000006.1:59717-59765_length:49_mod0000 -M_T0_RID311_S1_NZ_JBDYLZ010000023.1:5604-5703_length:100_mod0000 -M_T0_RID312_S1_NC_018382.1:3769-3816_length:48_mod0000 -M_T0_RID313_S1_NZ_JBDYRX010000002.1:139751-139865_length:115_mod0000 -M_T0_RID314_S0_NZ_JBDYSJ010000004.1:132522-132621_length:100_mod0000 -M_T0_RID315_S0_NC_033823.1:7820-7860_length:41_mod0000 -M_T0_RID317_S0_NC_034214.1:5951-5996_length:46_mod0000 -M_T0_RID317_S0_NZ_JBDYLZ010000015.1:71185-71277_length:93_mod0000 -M_T0_RID317_S0_NZ_JBDYRX010000004.1:174342-174382_length:41_mod0000 -M_T0_RID317_S1_NC_030293.1:5902-5968_length:67_mod0001 -M_T0_RID318_S0_NC_028814.1:27392-27476_length:85_mod0000 -M_T0_RID318_S0_NZ_JBDYRX010000001.1:771856-771930_length:75_mod0000 -M_T0_RID318_S1_NZ_JBDYLZ010000006.1:119310-119391_length:82_mod0000 -M_T0_RID319_S0_NC_034266.1:62140-62218_length:79_mod0000 -M_T0_RID319_S1_NC_028981.1:4292-4341_length:50_mod0000 -M_T0_RID319_S1_NC_031455.1:2498-2551_length:54_mod0000 -M_T0_RID319_S1_NZ_JBDYRX010000004.1:60929-61033_length:105_mod0000 -M_T0_RID322_S1_NZ_JBDYRX010000003.1:440227-440291_length:65_mod0000 -M_T0_RID323_S0_NC_030240.1:40893-40967_length:75_mod0000 -M_T0_RID323_S0_NZ_JBDYLZ010000007.1:249215-249268_length:54_mod0000 -M_T0_RID324_S0_NC_029311.1:87639-87764_length:126_mod0000 -M_T0_RID324_S0_NZ_JBDYSJ010000002.1:545609-545688_length:80_mod0000 -M_T0_RID324_S1_NZ_JBDYSJ010000003.1:210751-210786_length:36_mod0000 -M_T0_RID325_S1_NC_031240.1:7762-7813_length:52_mod0000 -M_T0_RID326_S0_NZ_JBDYLZ010000009.1:5470-5539_length:70_mod0000 -M_T0_RID328_S1_NZ_JBDYRX010000002.1:171169-171268_length:100_mod0000 -M_T0_RID329_S0_NZ_JBDYRX010000002.1:757356-757453_length:98_mod0000 -M_T0_RID329_S1_NZ_JBDYLZ010000008.1:68972-69065_length:94_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:680879-680974_length:96_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:706464-706551_length:88_mod0000 -M_T0_RID331_S0_NC_029255.1:77095-77131_length:37_mod0000 -M_T0_RID331_S0_NC_030240.1:62248-62311_length:64_mod0000 -M_T0_RID331_S1_NC_030126.1:1582-1653_length:72_mod0001 -M_T0_RID331_S1_NC_033707.1:5319-5406_length:88_mod0000 -M_T0_RID331_S1_NZ_JBDYLZ010000016.1:42739-42823_length:85_mod0000 -M_T0_RID332_S0_NZ_JBDYSJ010000004.1:35297-35358_length:62_mod0000 -M_T0_RID333_S0_NZ_JBDYLZ010000014.1:79014-79074_length:61_mod0000 -M_T0_RID333_S1_NC_027647.1:655-726_length:72_mod0000 -M_T0_RID333_S1_NC_033620.1:54726-54845_length:120_mod0000 -M_T0_RID334_S0_NZ_JBDYRX010000002.1:455003-455101_length:99_mod0000 -M_T0_RID335_S0_NZ_JBDYRX010000002.1:694573-694718_length:146_mod0000 -M_T0_RID335_S1_NZ_JBDYSJ010000001.1:102384-102461_length:78_mod0000 -M_T0_RID337_S0_NC_028368.1:13695-13792_length:98_mod0000 -M_T0_RID338_S0_NZ_JBDYRX010000001.1:578324-578379_length:56_mod0000 -M_T0_RID338_S1_NZ_JBDYRX010000003.1:471689-471760_length:72_mod0000 -M_T0_RID339_S1_NC_028362.1:1132-1236_length:105_mod0000 -M_T0_RID339_S1_NZ_JBDYRX010000003.1:626110-626150_length:41_mod0000 -M_T0_RID339_S1_NZ_JBDYSJ010000002.1:576422-576503_length:82_mod0000 -M_T0_RID340_S0_NC_028973.1:4682-4727_length:46_mod0000 -M_T0_RID340_S0_NC_029132.1:93532-93576_length:45_mod0000 -M_T0_RID341_S0_NC_030240.1:112206-112263_length:58_mod0000 -M_T0_RID341_S0_NC_034252.1:1229-1329_length:101_mod0000 -M_T0_RID342_S0_NZ_JBDYLZ010000011.1:111949-111982_length:34_mod0001 -M_T0_RID342_S1_NZ_JBDYLZ010000008.1:135318-135406_length:89_mod0001 -M_T0_RID343_S0_NC_029996.1:68953-69051_length:99_mod0000 -M_T0_RID344_S1_NC_030148.1:11118-11172_length:55_mod0000 -M_T0_RID345_S0_NZ_JBDYRX010000002.1:64932-64977_length:46_mod0000 -M_T0_RID346_S1_NZ_JBDYRX010000003.1:433612-433704_length:93_mod0000 -M_T0_RID347_S0_NC_036636.1:7712-7773_length:62_mod0000 -M_T0_RID347_S1_NZ_JBDYRX010000002.1:59074-59138_length:65_mod0000 -M_T0_RID347_S1_NZ_JBDYSJ010000003.1:117376-117430_length:55_mod0001 -M_T0_RID348_S0_NZ_JBDYRX010000001.1:1015831-1015930_length:100_mod0000 -M_T0_RID348_S1_NZ_JBDYRX010000001.1:141445-141557_length:113_mod0000 -M_T0_RID349_S0_NC_030391.1:4068-4155_length:88_mod0001 -M_T0_RID349_S0_NZ_JBDYRX010000001.1:226925-227009_length:85_mod0000 -M_T0_RID349_S1_NZ_JBDYRX010000003.1:358370-358434_length:65_mod0000 -M_T0_RID351_S0_NC_033753.1:4226-4317_length:92_mod0000 -M_T0_RID352_S1_NC_028259.1:56-127_length:72_mod0000 -M_T0_RID352_S1_NC_028395.1:155-248_length:94_mod0000 -M_T0_RID352_S1_NC_029931.1:9204-9241_length:38_mod0000 -M_T0_RID353_S0_NZ_JBDYLZ010000009.1:48165-48236_length:72_mod0000 -M_T0_RID354_S1_NZ_JBDYLZ010000012.1:45797-45922_length:126_mod0000 -M_T0_RID356_S0_NC_028378.1:3454-3530_length:77_mod0000 -M_T0_RID357_S0_NZ_JBDYRX010000002.1:120553-120591_length:39_mod0000 -M_T0_RID357_S1_NZ_JBDYSJ010000004.1:245908-245957_length:50_mod0000 -M_T0_RID358_S0_NC_029126.1:5901-5938_length:38_mod0000 -M_T0_RID358_S1_NC_028140.1:1554-1651_length:98_mod0000 -M_T0_RID358_S1_NZ_JBDYSJ010000002.1:580725-580785_length:61_mod0001 -M_T0_RID359_S0_NZ_JBDYRX010000001.1:601220-601298_length:79_mod0000 -M_T0_RID360_S0_NC_027916.2:77660-77740_length:81_mod0001 -M_T0_RID360_S0_NZ_JBDYLZ010000012.1:70482-70531_length:50_mod0000 -M_T0_RID360_S1_NC_017862.1:2881-2912_length:32_mod0000 -M_T0_RID360_S1_NC_028373.1:7802-7900_length:99_mod0000 -M_T0_RID361_S0_NZ_JBDYRX010000003.1:274684-274747_length:64_mod0000 -M_T0_RID362_S0_NC_029996.1:102820-102944_length:125_mod0001 -M_T0_RID362_S1_NC_027916.2:110368-110450_length:83_mod0000 -M_T0_RID362_S1_NZ_JBDYSJ010000002.1:480705-480765_length:61_mod0000 -M_T0_RID363_S0_NC_031089.1:6455-6543_length:89_mod0000 -M_T0_RID363_S0_NC_031218.1:1568-1623_length:56_mod0000 -M_T0_RID365_S1_NZ_JBDYSJ010000002.1:271975-272051_length:77_mod0000 -M_T0_RID366_S0_NZ_JBDYSJ010000001.1:487398-487484_length:87_mod0001 -M_T0_RID366_S1_NC_030843.1:4921-5005_length:85_mod0000 -M_T0_RID367_S0_NC_030127.1:2548-2589_length:42_mod0000 -M_T0_RID367_S0_NZ_JBDYLZ010000011.1:24860-24971_length:112_mod0000 -M_T0_RID367_S1_NZ_JBDYLZ010000006.1:96139-96201_length:63_mod0000 -M_T0_RID368_S0_NZ_JBDYSJ010000002.1:604782-604905_length:124_mod0001 -M_T0_RID369_S1_NC_031464.1:5161-5234_length:74_mod0000 -M_T0_RID370_S0_NC_027542.1:1019-1100_length:82_mod0000 -M_T0_RID371_S1_NC_028144.1:5011-5099_length:89_mod0000 -M_T0_RID371_S1_NZ_JBDYRX010000002.1:678499-678596_length:98_mod0000 -M_T0_RID372_S0_NZ_JBDYRX010000003.1:526040-526077_length:38_mod0000 -M_T0_RID372_S0_NZ_JBDYSJ010000002.1:283416-283463_length:48_mod0001 -M_T0_RID373_S0_NC_033705.1:55-95_length:41_mod0000 -M_T0_RID374_S0_NC_027016.1:151413-151449_length:37_mod0000 -M_T0_RID374_S0_NZ_JBDYSJ010000003.1:310288-310375_length:88_mod0000 -M_T0_RID374_S1_NZ_JBDYLZ010000012.1:57726-57851_length:126_mod0000 -M_T0_RID375_S0_NC_034377.1:6340-6385_length:46_mod0000 -M_T0_RID375_S1_NC_028099.1:112413-112504_length:92_mod0001 -M_T0_RID378_S0_NC_018448.1:5936-6007_length:72_mod0000 -M_T0_RID379_S1_NZ_JBDYRX010000001.1:727009-727109_length:101_mod0000 -M_T0_RID380_S0_NC_034253.1:5146-5187_length:42_mod0000 -M_T0_RID380_S1_NC_029905.1:2051-2094_length:44_mod0000 -M_T0_RID381_S0_NC_030240.1:103311-103373_length:63_mod0000 -M_T0_RID381_S0_NZ_JBDYLZ010000009.1:178104-178162_length:59_mod0000 -M_T0_RID382_S0_NC_027210.1:5895-5968_length:74_mod0000 -M_T0_RID382_S0_NC_029996.1:87376-87478_length:103_mod0000 -M_T0_RID382_S1_NC_027916.2:84236-84307_length:72_mod0000 -M_T0_RID383_S0_NZ_JBDYSJ010000001.1:683370-683456_length:87_mod0000 -M_T0_RID383_S1_NC_029132.1:79856-79920_length:65_mod0000 -M_T0_RID385_S0_NZ_JBDYLZ010000009.1:69071-69118_length:48_mod0000 -M_T0_RID386_S0_NC_034225.1:1556-1648_length:93_mod0000 -M_T0_RID387_S1_NC_028636.1:123682-123742_length:61_mod0000 -M_T0_RID388_S0_NZ_JBDYLZ010000008.1:71860-71983_length:124_mod0000 -M_T0_RID389_S0_NC_029051.1:9270-9318_length:49_mod0000 -M_T0_RID389_S0_NZ_JBDYLZ010000016.1:61192-61254_length:63_mod0000 -M_T0_RID390_S1_NC_028981.1:1738-1830_length:93_mod0000 -M_T0_RID391_S0_NC_028371.1:6428-6495_length:68_mod0000 -M_T0_RID391_S0_NZ_JBDYRX010000004.1:272450-272500_length:51_mod0000 -M_T0_RID391_S1_NZ_JBDYSJ010000002.1:543099-543205_length:107_mod0000 -M_T0_RID392_S0_NC_028970.1:5031-5099_length:69_mod0000 -M_T0_RID392_S1_NC_028824.1:19380-19469_length:90_mod0000 -M_T0_RID392_S1_NZ_JBDYLZ010000009.1:26519-26597_length:79_mod0000 -M_T0_RID393_S0_NZ_JBDYLZ010000015.1:66736-66802_length:67_mod0000 -M_T0_RID395_S0_NC_031304.1:4214-4304_length:91_mod0000 -M_T0_RID396_S0_NZ_JBDYSJ010000001.1:683444-683483_length:40_mod0000 -M_T0_RID397_S0_NC_028125.1:5157-5221_length:65_mod0000 -M_T0_RID398_S0_NC_028814.1:21296-21329_length:34_mod0000 -M_T0_RID398_S0_NZ_JBDYLZ010000008.1:89568-89611_length:44_mod0000 -M_T0_RID398_S1_NZ_JBDYRX010000003.1:160428-160514_length:87_mod0000 -M_T0_RID399_S1_NZ_JBDYRX010000002.1:383166-383266_length:101_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000006.1:321094-321166_length:73_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000017.1:46480-46536_length:57_mod0000 -M_T0_RID402_S0_NC_028491.1:36087-36159_length:73_mod0000 -M_T0_RID406_S0_NC_033720.1:8569-8637_length:69_mod0000 -M_T0_RID406_S0_NZ_JBDYSJ010000002.1:605544-605617_length:74_mod0000 -M_T0_RID406_S1_NC_033620.1:71763-71841_length:79_mod0000 -M_T0_RID407_S0_NC_028491.1:95220-95304_length:85_mod0000 -M_T0_RID407_S0_NZ_JBDYRX010000004.1:531865-531922_length:58_mod0000 -M_T0_RID408_S0_NZ_JBDYLZ010000006.1:20241-20331_length:91_mod0000 -M_T0_RID408_S1_NC_030391.1:1047-1152_length:106_mod0000 -M_T0_RID409_S1_NC_029904.1:2927-3013_length:87_mod0000 -M_T0_RID410_S0_NC_028369.1:7176-7240_length:65_mod0000 -M_T0_RID410_S1_NC_027923.1:107200-107294_length:95_mod0000 -M_T0_RID411_S1_NC_027916.2:12656-12743_length:88_mod0000 -M_T0_RID412_S0_NC_028362.1:1734-1810_length:77_mod0000 -M_T0_RID414_S0_NC_027646.1:3518-3556_length:39_mod0000 -M_T0_RID415_S1_NC_033703.1:4454-4536_length:83_mod0000 -M_T0_RID415_S1_NZ_JBDYRX010000004.1:398358-398416_length:59_mod0000 -M_T0_RID419_S0_NZ_JBDYSJ010000002.1:339543-339583_length:41_mod0000 -M_T0_RID420_S0_NC_029919.1:1092-1170_length:79_mod0000 -M_T0_RID420_S1_NC_029132.1:86139-86240_length:102_mod0000 -M_T0_RID421_S0_NZ_JBDYRX010000004.1:42510-42680_length:171_mod0001 -M_T0_RID421_S1_NC_028099.1:99392-99421_length:30_mod0000 -M_T0_RID422_S0_NC_028236.1:7738-7797_length:60_mod0000 -M_T0_RID422_S0_NZ_JBDYLZ010000014.1:21662-21716_length:55_mod0000 -M_T0_RID422_S0_NZ_JBDYSJ010000002.1:476168-476219_length:52_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:131159-131244_length:86_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:465551-465658_length:108_mod0000 -M_T0_RID424_S0_NC_029132.1:124479-124602_length:124_mod0000 -M_T0_RID424_S1_NZ_JBDYLZ010000006.1:180426-180481_length:56_mod0000 -M_T0_RID424_S1_NZ_JBDYSJ010000003.1:445372-445447_length:76_mod0000 -M_T0_RID425_S0_NZ_JBDYLZ010000006.1:11120-11222_length:103_mod0000 -M_T0_RID426_S1_NZ_JBDYRX010000002.1:460851-460904_length:54_mod0000 -M_T0_RID426_S1_NZ_JBDYSJ010000001.1:882579-882628_length:50_mod0000 -M_T0_RID427_S0_NZ_JBDYSJ010000001.1:460394-460459_length:66_mod0000 -M_T0_RID428_S1_NZ_JBDYLZ010000007.1:203593-203667_length:75_mod0000 -M_T0_RID432_S1_NZ_JBDYRX010000004.1:37215-37282_length:68_mod0000 -M_T0_RID433_S0_NC_028371.1:7751-7803_length:53_mod0000 -M_T0_RID433_S0_NZ_JBDYRX010000001.1:940205-940283_length:79_mod0000 -M_T0_RID434_S0_NZ_JBDYRX010000003.1:278075-278140_length:66_mod0000 -M_T0_RID435_S1_NC_031225.1:6315-6360_length:46_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000001.1:992235-992354_length:120_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000002.1:28179-28253_length:75_mod0000 -M_T0_RID436_S0_NZ_JBDYRX010000004.1:193926-194033_length:108_mod0000 -M_T0_RID438_S0_NZ_JBDYRX010000004.1:427488-427551_length:64_mod0000 -M_T0_RID441_S1_NC_028486.1:4288-4332_length:45_mod0000 -M_T0_RID441_S1_NC_031135.1:1215-1254_length:40_mod0000 -M_T0_RID441_S1_NC_033620.1:171185-171273_length:89_mod0000 -M_T0_RID441_S1_NZ_JBDYRX010000001.1:944430-944505_length:76_mod0000 -M_T0_RID442_S1_NZ_JBDYSJ010000001.1:795030-795132_length:103_mod0000 -M_T0_RID444_S1_NC_029927.1:739-780_length:42_mod0000 -M_T0_RID445_S0_NC_030400.1:9136-9237_length:102_mod0000 -M_T0_RID445_S1_NC_037578.1:3062-3107_length:46_mod0000 -M_T0_RID446_S0_NC_029996.1:10622-10695_length:74_mod0000 -M_T0_RID446_S1_NC_034266.1:27796-27894_length:99_mod0000 -M_T0_RID447_S1_NC_031259.1:1711-1781_length:71_mod0000 -M_T0_RID450_S0_NZ_JBDYRX010000003.1:719829-719908_length:80_mod0000 -M_T0_RID451_S0_NC_027214.1:8775-8830_length:56_mod0000 -M_T0_RID451_S0_NC_028367.1:5391-5502_length:112_mod0000 -M_T0_RID451_S1_NZ_JBDYRX010000002.1:31090-31200_length:111_mod0000 -M_T0_RID452_S1_NC_030205.1:1725-1812_length:88_mod0000 -M_T0_RID453_S0_NC_033761.1:8903-9009_length:107_mod0001 -M_T0_RID455_S0_NC_027799.1:284-375_length:92_mod0000 -M_T0_RID455_S1_NZ_JBDYLZ010000014.1:95838-95936_length:99_mod0000 -M_T0_RID455_S1_NZ_JBDYSJ010000002.1:210490-210557_length:68_mod0000 -M_T0_RID456_S0_NZ_JBDYLZ010000007.1:109571-109660_length:90_mod0000 -M_T0_RID456_S1_NC_030240.1:55430-55543_length:114_mod0000 -M_T0_RID457_S1_NZ_JBDYLZ010000009.1:123168-123262_length:95_mod0000 -M_T0_RID457_S1_NZ_JBDYSJ010000004.1:21364-21417_length:54_mod0000 -M_T0_RID458_S1_NC_034266.1:128171-128258_length:88_mod0000 -M_T0_RID458_S1_NZ_JBDYLZ010000008.1:129533-129587_length:55_mod0000 -M_T0_RID458_S1_NZ_JBDYRX010000002.1:29087-29147_length:61_mod0000 -M_T0_RID459_S0_NZ_JBDYRX010000001.1:1023086-1023182_length:97_mod0000 -M_T0_RID459_S1_NC_023442.1:114262-114356_length:95_mod0000 -M_T0_RID460_S0_NC_029052.1:1193-1273_length:81_mod0000 -M_T0_RID462_S1_NZ_JBDYRX010000001.1:1005315-1005420_length:106_mod0000 -M_T0_RID463_S0_NC_028372.1:9914-9999_length:86_mod0000 -M_T0_RID463_S1_NZ_JBDYSJ010000004.1:218365-218453_length:89_mod0000 -M_T0_RID465_S0_NZ_JBDYSJ010000001.1:787887-787945_length:59_mod0000 -M_T0_RID465_S1_NC_029311.1:1797-1831_length:35_mod0000 -M_T0_RID466_S0_NZ_JBDYRX010000003.1:730520-730588_length:69_mod0000 -M_T0_RID470_S1_NC_033820.1:3073-3102_length:30_mod0000 -M_T0_RID471_S1_NZ_JBDYLZ010000008.1:35202-35290_length:89_mod0000 -M_T0_RID472_S0_NZ_JBDYLZ010000011.1:10802-10846_length:45_mod0000 -M_T0_RID472_S1_NZ_JBDYRX010000001.1:652634-652707_length:74_mod0000 -M_T0_RID474_S0_NC_030225.1:5289-5336_length:48_mod0000 -M_T0_RID475_S0_NZ_JBDYLZ010000006.1:151548-151631_length:84_mod0000 -M_T0_RID475_S0_NZ_JBDYRX010000002.1:464041-464153_length:113_mod0000 -M_T0_RID476_S0_NZ_JBDYLZ010000015.1:62860-62918_length:59_mod0000 -M_T0_RID477_S0_NC_027214.1:4315-4391_length:77_mod0000 -M_T0_RID477_S0_NC_030231.1:4362-4445_length:84_mod0000 -M_T0_RID477_S1_NC_027926.1:5336-5385_length:50_mod0000 -M_T0_RID479_S0_NC_034240.1:10006-10105_length:100_mod0000 -M_T0_RID479_S0_NC_034377.1:6973-7006_length:34_mod0000 -M_T0_RID479_S1_NC_029309.1:1183-1291_length:109_mod0000 -M_T0_RID479_S1_NZ_JBDYRX010000004.1:294593-294685_length:93_mod0000 -M_T0_RID480_S0_NC_030148.1:14092-14146_length:55_mod0000 -M_T0_RID481_S1_NC_027920.1:4910-4956_length:47_mod0000 -M_T0_RID481_S1_NC_028252.1:1447-1525_length:79_mod0000 -M_T0_RID481_S1_NC_029038.1:3990-4034_length:45_mod0000 -M_T0_RID482_S0_NC_031287.1:3748-3826_length:79_mod0000 -M_T0_RID483_S0_NC_029311.1:111589-111673_length:85_mod0000 -M_T0_RID484_S0_NZ_JBDYRX010000001.1:874633-874662_length:30_mod0000 -M_T0_RID484_S1_NZ_JBDYRX010000002.1:457659-457735_length:77_mod0000 -M_T0_RID487_S0_NC_023339.1:3452-3542_length:91_mod0000 -M_T0_RID488_S1_NC_030800.1:3767-3843_length:77_mod0000 -M_T0_RID490_S1_NC_028249.1:6706-6755_length:50_mod0000 -M_T0_RID490_S1_NC_033815.1:382-420_length:39_mod0000 -M_T0_RID491_S0_NC_029549.1:1543-1601_length:59_mod0000 -M_T0_RID491_S1_NC_023442.1:106362-106456_length:95_mod0001 -M_T0_RID491_S1_NZ_JBDYSJ010000002.1:433503-433622_length:120_mod0000 -M_T0_RID492_S1_NC_017967.1:4737-4790_length:54_mod0000 -M_T0_RID497_S1_NC_028231.1:2435-2530_length:96_mod0000 -M_T0_RID498_S1_NC_028368.1:10324-10389_length:66_mod0000 -M_T0_RID498_S1_NC_031088.1:10285-10350_length:66_mod0000 -M_T0_RID499_S0_NZ_JBDYLZ010000012.1:63930-64011_length:82_mod0000 -M_T0_RID500_S0_NZ_JBDYSJ010000003.1:369722-369827_length:106_mod0000 -M_T0_RID501_S0_NC_034214.1:4534-4626_length:93_mod0000 -M_T0_RID503_S1_NZ_JBDYLZ010000014.1:65584-65643_length:60_mod0001 -M_T0_RID504_S0_NC_033727.1:6181-6283_length:103_mod0000 -M_T0_RID504_S0_NC_037572.1:353-481_length:129_mod0000 -M_T0_RID506_S0_NZ_JBDYSJ010000001.1:230782-230869_length:88_mod0000 -M_T0_RID506_S1_NZ_JBDYRX010000001.1:155361-155441_length:81_mod0000 -M_T0_RID507_S0_NZ_JBDYRX010000001.1:64196-64251_length:56_mod0001 -M_T0_RID507_S0_NZ_JBDYRX010000002.1:311911-312021_length:111_mod0000 -M_T0_RID508_S1_NC_028382.1:618-664_length:47_mod0000 -M_T0_RID509_S0_NZ_JBDYRX010000002.1:83623-83710_length:88_mod0000 -M_T0_RID509_S0_NZ_JBDYSJ010000002.1:32694-32813_length:120_mod0000 -M_T0_RID512_S0_NC_031301.1:7499-7600_length:102_mod0000 -M_T0_RID512_S0_NZ_JBDYSJ010000001.1:497297-497384_length:88_mod0001 -M_T0_RID512_S1_NC_023299.1:173-222_length:50_mod0000 -M_T0_RID514_S0_NC_028144.1:1039-1130_length:92_mod0000 -M_T0_RID515_S1_NC_028239.1:1870-1935_length:66_mod0000 -M_T0_RID516_S0_NC_028099.1:69736-69811_length:76_mod0000 -M_T0_RID518_S0_NZ_JBDYSJ010000002.1:172879-172954_length:76_mod0000 -M_T0_RID518_S1_NC_028374.1:22488-22593_length:106_mod0000 -M_T0_RID519_S0_NZ_JBDYSJ010000004.1:83804-83909_length:106_mod0000 -M_T0_RID519_S1_NC_023442.1:37132-37228_length:97_mod0000 -M_T0_RID520_S1_NC_033821.1:5336-5462_length:127_mod0000 -M_T0_RID521_S1_NC_028362.1:8323-8409_length:87_mod0000 -M_T0_RID521_S1_NC_033620.1:165922-166009_length:88_mod0000 -M_T0_RID526_S0_NZ_JBDYLZ010000008.1:191196-191301_length:106_mod0000 -M_T0_RID527_S0_NZ_JBDYRX010000001.1:664374-664450_length:77_mod0000 -M_T0_RID530_S1_NC_029255.1:118676-118738_length:63_mod0000 -M_T0_RID531_S0_NC_030240.1:18050-18083_length:34_mod0000 -M_T0_RID535_S0_NZ_JBDYRX010000003.1:273784-273814_length:31_mod0000 -M_T0_RID535_S0_NZ_JBDYSJ010000001.1:408974-409045_length:72_mod0000 -M_T0_RID536_S1_NZ_JBDYLZ010000007.1:187492-187559_length:68_mod0001 -M_T0_RID537_S0_NC_031106.1:5925-5990_length:66_mod0000 -M_T0_RID539_S0_NC_023442.1:25605-25715_length:111_mod0000 -M_T0_RID539_S0_NC_030922.1:6177-6250_length:74_mod0000 -M_T0_RID539_S1_NC_033732.1:488-545_length:58_mod0000 -M_T0_RID539_S1_NZ_JBDYRX010000003.1:428710-428748_length:39_mod0000 -M_T0_RID540_S1_NC_028636.1:8122-8203_length:82_mod0000 -M_T0_RID540_S1_NC_033777.1:478-533_length:56_mod0000 -M_T0_RID541_S0_NZ_JBDYLZ010000009.1:17788-17882_length:95_mod0000 -M_T0_RID543_S0_NZ_JBDYLZ010000006.1:137222-137319_length:98_mod0000 -M_T0_RID545_S1_NC_033620.1:141319-141407_length:89_mod0000 -M_T0_RID547_S0_NC_029901.1:2272-2382_length:111_mod0000 -M_T0_RID548_S0_NC_027916.2:50899-50962_length:64_mod0000 -M_T0_RID549_S0_NZ_JBDYRX010000003.1:184280-184329_length:50_mod0000 -M_T0_RID549_S1_NC_027016.1:166476-166540_length:65_mod0001 -M_T0_RID552_S0_NC_031244.1:259-371_length:113_mod0000 -M_T0_RID552_S1_NZ_JBDYSJ010000001.1:904809-904898_length:90_mod0000 -M_T0_RID555_S0_NC_029255.1:86976-87025_length:50_mod0000 -M_T0_RID555_S0_NC_033700.1:23881-23958_length:78_mod0000 -M_T0_RID555_S1_NZ_JBDYSJ010000003.1:459317-459387_length:71_mod0000 -M_T0_RID556_S0_NC_029800.1:2415-2467_length:53_mod0000 -M_T0_RID556_S0_NZ_JBDYRX010000003.1:269557-269627_length:71_mod0000 -M_T0_RID556_S1_NC_018151.1:436-524_length:89_mod0000 -M_T0_RID556_S1_NC_029997.2:2602-2635_length:34_mod0000 -M_T0_RID560_S0_NC_030691.1:8709-8769_length:61_mod0000 -M_T0_RID563_S0_NZ_JBDYSJ010000001.1:279557-279665_length:109_mod0000 -M_T0_RID563_S1_NC_029255.1:16285-16387_length:103_mod0000 -M_T0_RID563_S1_NC_030651.1:8044-8106_length:63_mod0000 -M_T0_RID564_S1_NC_030380.1:905-947_length:43_mod0000 -M_T0_RID566_S0_NZ_JBDYRX010000002.1:228758-228796_length:39_mod0000 -M_T0_RID566_S1_NC_027916.2:158878-158953_length:76_mod0000 -M_T0_RID568_S0_NC_033718.1:5028-5099_length:72_mod0000 -M_T0_RID569_S1_NZ_JBDYSJ010000002.1:4445-4500_length:56_mod0000 -M_T0_RID571_S1_NC_030200.1:53402-53457_length:56_mod0000 -M_T0_RID571_S1_NC_031291.1:6265-6343_length:79_mod0000 -M_T0_RID573_S0_NZ_JBDYSJ010000001.1:821929-821988_length:60_mod0000 -M_T0_RID573_S1_NZ_JBDYRX010000002.1:420333-420420_length:88_mod0000 -M_T0_RID578_S0_NC_028389.1:883-929_length:47_mod0000 -M_T0_RID578_S1_NC_027920.1:2737-2802_length:66_mod0000 -M_T0_RID578_S1_NZ_JBDYRX010000001.1:125147-125264_length:118_mod0000 -M_T0_RID579_S1_NC_028636.1:80919-81006_length:88_mod0000 -M_T0_RID579_S1_NZ_JBDYRX010000003.1:600760-600842_length:83_mod0000 -M_T0_RID579_S1_NZ_JBDYSJ010000001.1:621908-622008_length:101_mod0000 -M_T0_RID580_S0_NC_031236.1:9639-9701_length:63_mod0000 -M_T0_RID580_S0_NC_033620.1:115666-115748_length:83_mod0000 -M_T0_RID584_S1_NZ_JBDYRX010000003.1:30143-30232_length:90_mod0000 -M_T0_RID587_S1_NC_030236.1:1921-2018_length:98_mod0000 -M_T0_RID588_S0_NZ_JBDYRX010000004.1:487902-487980_length:79_mod0000 -M_T0_RID592_S0_NZ_JBDYRX010000004.1:290162-290207_length:46_mod0000 -M_T0_RID596_S0_NC_028491.1:22873-22918_length:46_mod0000 -M_T0_RID597_S0_NZ_JBDYRX010000004.1:248380-248414_length:35_mod0000 -M_T0_RID598_S0_NZ_JBDYLZ010000013.1:99135-99225_length:91_mod0000 -M_T0_RID598_S0_NZ_JBDYRX010000004.1:521129-521194_length:66_mod0000 -M_T0_RID598_S1_NC_027781.1:1542-1623_length:82_mod0000 -M_T0_RID598_S1_NC_033828.1:1452-1571_length:120_mod0000 -M_T0_RID599_S0_NZ_JBDYLZ010000018.1:17132-17215_length:84_mod0000 -M_T0_RID601_S1_NZ_JBDYRX010000004.1:64749-64831_length:83_mod0000 -M_T0_RID601_S1_NZ_JBDYSJ010000004.1:72990-73054_length:65_mod0000 -M_T0_RID603_S1_NZ_JBDYRX010000003.1:148174-148218_length:45_mod0000 -M_T0_RID606_S1_NZ_JBDYRX010000004.1:81494-81540_length:47_mod0000 -M_T0_RID608_S1_NZ_JBDYLZ010000006.1:54120-54159_length:40_mod0000 -M_T0_RID608_S1_NZ_JBDYSJ010000003.1:75571-75624_length:54_mod0000 -M_T0_RID609_S0_NZ_JBDYLZ010000017.1:21746-21833_length:88_mod0000 -M_T0_RID610_S1_NZ_JBDYRX010000004.1:416636-416711_length:76_mod0000 -M_T0_RID617_S1_NZ_JBDYLZ010000013.1:81956-82016_length:61_mod0000 -M_T0_RID618_S0_NZ_JBDYRX010000001.1:154047-154079_length:33_mod0000 -M_T0_RID619_S0_NZ_JBDYRX010000001.1:929162-929284_length:123_mod0000 -M_T0_RID620_S1_NZ_JBDYRX010000004.1:231083-231194_length:112_mod0000 -M_T0_RID622_S0_NC_029117.1:1274-1341_length:68_mod0000 -M_T0_RID625_S1_NZ_JBDYRX010000003.1:351246-351297_length:52_mod0000 -M_T0_RID626_S0_NZ_JBDYRX010000003.1:54224-54264_length:41_mod0000 -M_T0_RID627_S1_NZ_JBDYRX010000002.1:425465-425547_length:83_mod0000 -M_T0_RID629_S1_NC_028264.1:4326-4405_length:80_mod0000 -M_T0_RID630_S0_NZ_JBDYSJ010000002.1:388835-388868_length:34_mod0000 -M_T0_RID633_S1_NZ_JBDYRX010000003.1:253941-254012_length:72_mod0000 -M_T0_RID634_S1_NC_033815.1:2695-2865_length:171_mod0000 -M_T0_RID635_S1_NC_033700.1:17426-17511_length:86_mod0000 -M_T0_RID636_S0_NC_029086.1:7004-7042_length:39_mod0000 -M_T0_RID638_S1_NZ_JBDYSJ010000001.1:82298-82352_length:55_mod0000 -M_T0_RID640_S0_NC_033756.1:5658-5786_length:129_mod0001 -M_T0_RID641_S0_NC_027706.1:187-292_length:106_mod0000 -M_T0_RID642_S0_NC_034266.1:154137-154203_length:67_mod0000 -M_T0_RID642_S0_NZ_JBDYRX010000003.1:290122-290229_length:108_mod0000 -M_T0_RID643_S0_NC_017937.1:1077-1164_length:88_mod0000 -M_T0_RID643_S0_NZ_JBDYRX010000002.1:527817-527928_length:112_mod0000 -M_T0_RID645_S0_NC_030799.1:4650-4688_length:39_mod0000 -M_T0_RID645_S1_NZ_JBDYLZ010000008.1:186276-186348_length:73_mod0000 -M_T0_RID651_S1_NC_033733.1:2956-3039_length:84_mod0001 -M_T0_RID651_S1_NZ_JBDYRX010000001.1:479171-479229_length:59_mod0000 -M_T0_RID653_S1_NC_029311.1:77186-77261_length:76_mod0000 -M_T0_RID654_S0_NZ_JBDYSJ010000001.1:904727-904802_length:76_mod0000 -M_T0_RID655_S0_NZ_JBDYSJ010000001.1:482269-482365_length:97_mod0000 -M_T0_RID655_S1_NZ_JBDYRX010000002.1:520330-520420_length:91_mod0000 -M_T0_RID656_S0_NC_028259.1:1542-1591_length:50_mod0000 -M_T0_RID656_S0_NZ_JBDYLZ010000019.1:6097-6185_length:89_mod0000 -M_T0_RID660_S1_NC_034266.1:157401-157477_length:77_mod0000 -M_T0_RID664_S0_NC_027916.2:59946-59993_length:48_mod0000 -M_T0_RID664_S0_NZ_JBDYLZ010000015.1:82686-82741_length:56_mod0000 -M_T0_RID664_S0_NZ_JBDYSJ010000003.1:87421-87503_length:83_mod0000 -M_T0_RID668_S0_NZ_JBDYRX010000004.1:18573-18663_length:91_mod0000 -M_T0_RID670_S0_NC_027920.1:1301-1393_length:93_mod0000 -M_T0_RID673_S1_NC_033703.1:545-616_length:72_mod0000 -M_T0_RID673_S1_NZ_JBDYRX010000001.1:644803-644895_length:93_mod0000 -M_T0_RID679_S0_NZ_JBDYRX010000002.1:605076-605139_length:64_mod0000 -M_T0_RID679_S1_NC_033703.1:1306-1364_length:59_mod0000 -M_T0_RID680_S0_NZ_JBDYRX010000002.1:632837-632879_length:43_mod0000 -M_T0_RID681_S1_NZ_JBDYSJ010000002.1:496144-496188_length:45_mod0000 -M_T0_RID682_S0_NZ_JBDYSJ010000001.1:116469-116509_length:41_mod0000 -M_T0_RID683_S0_NZ_JBDYRX010000001.1:675311-675352_length:42_mod0000 -M_T0_RID683_S0_NZ_JBDYSJ010000004.1:71365-71456_length:92_mod0000 -M_T0_RID683_S1_NC_029255.1:7610-7675_length:66_mod0000 -M_T0_RID686_S0_NC_027429.1:2932-2966_length:35_mod0000 -M_T0_RID686_S1_NC_027923.1:107955-107999_length:45_mod0000 -M_T0_RID686_S1_NC_029132.1:95050-95160_length:111_mod0000 -M_T0_RID689_S1_NZ_JBDYSJ010000004.1:138231-138318_length:88_mod0000 -M_T0_RID691_S1_NC_033710.1:3870-3926_length:57_mod0000 -M_T0_RID692_S1_NC_027531.1:1508-1612_length:105_mod0000 -M_T0_RID695_S0_NC_030200.1:124072-124139_length:68_mod0000 -M_T0_RID697_S0_NC_028921.1:5390-5470_length:81_mod0000 -M_T0_RID699_S0_NC_031083.1:4910-4975_length:66_mod0000 -M_T0_RID699_S1_NZ_JBDYLZ010000010.1:101894-101946_length:53_mod0000 -M_T0_RID700_S1_NZ_JBDYSJ010000001.1:915360-915453_length:94_mod0000 -M_T0_RID702_S1_NC_028099.1:63829-63929_length:101_mod0000 -M_T0_RID706_S0_NC_027210.1:7432-7505_length:74_mod0000 -M_T0_RID707_S1_NZ_JBDYRX010000002.1:367432-367522_length:91_mod0001 -M_T0_RID707_S1_NZ_JBDYSJ010000004.1:260063-260128_length:66_mod0000 -M_T0_RID709_S1_NZ_JBDYRX010000003.1:29327-29484_length:158_mod0000 -M_T0_RID710_S1_NC_033720.1:7987-8089_length:103_mod0000 -M_T0_RID711_S0_NZ_JBDYLZ010000006.1:173182-173278_length:97_mod0000 -M_T0_RID711_S1_NC_033700.1:20537-20567_length:31_mod0000 -M_T0_RID711_S1_NZ_JBDYSJ010000001.1:181184-181271_length:88_mod0000 -M_T0_RID714_S0_NC_037612.1:3005-3122_length:118_mod0000 -M_T0_RID715_S0_NC_027788.1:468-551_length:84_mod0000 -M_T0_RID715_S1_NZ_JBDYLZ010000006.1:219162-219260_length:99_mod0000 -M_T0_RID717_S0_NC_030654.1:1669-1721_length:53_mod0000 -M_T0_RID719_S1_NZ_JBDYSJ010000001.1:826609-826678_length:70_mod0000 -M_T0_RID722_S1_NC_027923.1:41169-41259_length:91_mod0001 -M_T0_RID727_S0_NC_029997.2:28478-28523_length:46_mod0000 -M_T0_RID728_S0_NZ_JBDYRX010000002.1:879157-879230_length:74_mod0000 -M_T0_RID729_S1_NZ_JBDYLZ010000008.1:194207-194253_length:47_mod0000 -M_T0_RID731_S1_NC_030117.1:17286-17318_length:33_mod0000 -M_T0_RID736_S0_NZ_JBDYRX010000001.1:178466-178588_length:123_mod0000 -M_T0_RID737_S0_NC_028491.1:18226-18284_length:59_mod0000 -M_T0_RID739_S1_NZ_JBDYLZ010000011.1:127333-127376_length:44_mod0000 -M_T0_RID743_S0_NC_037573.1:1169-1247_length:79_mod0000 -M_T0_RID747_S1_NZ_JBDYRX010000002.1:430138-430204_length:67_mod0000 -M_T0_RID749_S1_NZ_JBDYRX010000003.1:71924-71986_length:63_mod0000 -M_T0_RID752_S0_NC_031336.1:9006-9046_length:41_mod0000 -M_T0_RID753_S0_NZ_JBDYSJ010000003.1:446526-446575_length:50_mod0000 -M_T0_RID757_S0_NC_028136.1:1312-1355_length:44_mod0000 -M_T0_RID757_S1_NC_027016.1:202899-202969_length:71_mod0000 -M_T0_RID757_S1_NZ_JBDYRX010000004.1:461576-461693_length:118_mod0000 -M_T0_RID759_S1_NC_029691.1:3622-3733_length:112_mod0000 -M_T0_RID763_S1_NC_027916.2:99012-99086_length:75_mod0000 -M_T0_RID763_S1_NC_028265.1:10302-10344_length:43_mod0000 -M_T0_RID763_S1_NC_030798.1:7132-7233_length:102_mod0000 -M_T0_RID763_S1_NZ_JBDYLZ010000015.1:37189-37249_length:61_mod0000 -M_T0_RID765_S0_NC_028261.1:4356-4443_length:88_mod0000 -M_T0_RID767_S1_NC_027916.2:86943-87045_length:103_mod0000 -M_T0_RID768_S0_NC_028491.1:2854-2933_length:80_mod0000 -M_T0_RID768_S0_NC_030200.1:40203-40312_length:110_mod0000 -M_T0_RID771_S0_NZ_JBDYLZ010000019.1:13804-13871_length:68_mod0000 -M_T0_RID778_S1_NC_031275.1:5153-5201_length:49_mod0000 -M_T0_RID781_S1_NZ_JBDYRX010000003.1:540287-540355_length:69_mod0000 -M_T0_RID783_S1_NZ_JBDYLZ010000010.1:89260-89349_length:90_mod0000 -M_T0_RID785_S1_NC_027199.1:11719-11818_length:100_mod0000 -M_T0_RID786_S1_NZ_JBDYLZ010000008.1:173777-173859_length:83_mod0000 -M_T0_RID788_S0_NC_030922.1:1394-1483_length:90_mod0000 -M_T0_RID793_S0_NZ_JBDYRX010000003.1:539904-539954_length:51_mod0001 -M_T0_RID797_S1_NZ_JBDYRX010000004.1:414620-414694_length:75_mod0000 -M_T0_RID807_S1_NC_030117.1:45331-45378_length:48_mod0000 -M_T0_RID810_S0_NC_028491.1:85062-85136_length:75_mod0001 -M_T0_RID811_S1_NC_030697.1:295-351_length:57_mod0000 -M_T0_RID813_S1_NC_027016.1:91244-91325_length:82_mod0000 -M_T0_RID817_S1_NC_030240.1:108663-108730_length:68_mod0001 -M_T0_RID823_S0_NC_033620.1:158427-158465_length:39_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000003.1:241332-241406_length:75_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000004.1:228843-228928_length:86_mod0000 -M_T0_RID827_S0_NZ_JBDYSJ010000004.1:239871-239973_length:103_mod0000 -M_T0_RID832_S0_NZ_JBDYLZ010000015.1:88774-88854_length:81_mod0000 -M_T0_RID833_S0_NZ_JBDYSJ010000001.1:590978-591039_length:62_mod0000 -M_T0_RID837_S1_NZ_JBDYRX010000001.1:656888-656964_length:77_mod0000 -M_T0_RID840_S0_NC_028396.1:529-621_length:93_mod0000 -M_T0_RID844_S1_NZ_JBDYLZ010000007.1:237741-237786_length:46_mod0000 -M_T0_RID847_S0_NZ_JBDYRX010000003.1:703429-703507_length:79_mod0000 -M_T0_RID852_S0_NC_030240.1:105292-105367_length:76_mod0000 -M_T0_RID856_S0_NZ_JBDYRX010000003.1:28070-28132_length:63_mod0000 -M_T0_RID856_S1_NC_027644.1:3712-3804_length:93_mod0000 -M_T0_RID858_S0_NZ_JBDYSJ010000003.1:197400-197485_length:86_mod0000 -M_T0_RID858_S1_NZ_JBDYSJ010000004.1:175908-175948_length:41_mod0000 -M_T0_RID859_S0_NC_033777.1:2010-2066_length:57_mod0000 -M_T0_RID862_S1_NC_030799.1:1806-1881_length:76_mod0000 -M_T0_RID865_S1_NZ_JBDYSJ010000002.1:326035-326087_length:53_mod0000 -M_T0_RID873_S1_NC_028119.1:2502-2583_length:82_mod0000 -M_T0_RID880_S0_NC_033620.1:55069-55148_length:80_mod0000 -M_T0_RID882_S0_NZ_JBDYRX010000002.1:484332-484416_length:85_mod0000 -M_T0_RID882_S1_NC_034266.1:103121-103153_length:33_mod0000 -M_T0_RID885_S0_NZ_JBDYRX010000003.1:244205-244252_length:48_mod0000 -M_T0_RID885_S1_NC_036636.1:5051-5143_length:93_mod0000 -M_T0_RID887_S0_NC_029132.1:58239-58309_length:71_mod0000 -M_T0_RID895_S1_NZ_JBDYRX010000004.1:290403-290535_length:133_mod0000 -M_T0_RID900_S0_NZ_JBDYRX010000003.1:442650-442708_length:59_mod0000 -M_T0_RID903_S0_NC_029994.1:1129-1161_length:33_mod0000 -M_T0_RID910_S1_NC_030801.1:531-591_length:61_mod0000 -M_T0_RID913_S1_NZ_JBDYSJ010000001.1:289314-289350_length:37_mod0000 -M_T0_RID923_S1_NC_028374.1:1835-1919_length:85_mod0000 -M_T0_RID930_S0_NC_033727.1:5848-5935_length:88_mod0000 -M_T0_RID941_S0_NZ_JBDYLZ010000020.1:17961-18008_length:48_mod0000 -M_T0_RID951_S0_NZ_JBDYLZ010000007.1:258088-258169_length:82_mod0000 -M_T0_RID960_S1_NZ_JBDYRX010000001.1:365497-365549_length:53_mod0000 -M_T0_RID963_S0_NZ_JBDYSJ010000002.1:471116-471242_length:127_mod0000 -M_T0_RID967_S0_NC_028145.1:2423-2491_length:69_mod0000 -M_T0_RID969_S1_NC_027917.1:3392-3477_length:86_mod0000 -M_T0_RID973_S1_NC_028243.1:233-298_length:66_mod0000 -M_T0_RID975_S0_NZ_JBDYLZ010000006.1:262785-262833_length:49_mod0000 -M_T0_RID977_S0_NC_029311.1:110890-110930_length:41_mod0000 -M_T0_RID978_S1_NC_033707.1:4471-4569_length:99_mod0000 -M_T0_RID978_S1_NZ_JBDYLZ010000011.1:12262-12308_length:47_mod0000 -M_T0_RID987_S1_NZ_JBDYRX010000002.1:268856-268924_length:69_mod0000 -M_T0_RID993_S0_NZ_JBDYSJ010000002.1:495946-496025_length:80_mod0000 -M_T0_RID997_S0_NC_029303.1:1692-1771_length:80_mod0000 -M_T0_RID1003_S0_NZ_JBDYSJ010000001.1:678727-678783_length:57_mod0000 -M_T0_RID1022_S1_NC_030746.1:3635-3726_length:92_mod0000 -M_T0_RID1023_S1_NZ_JBDYLZ010000006.1:264893-265013_length:121_mod0000 -M_T0_RID1048_S0_NZ_JBDYLZ010000008.1:126930-127042_length:113_mod0000 -M_T0_RID1070_S0_NZ_JBDYRX010000003.1:112054-112158_length:105_mod0000 diff --git a/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_extract.py b/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_extract.py deleted file mode 100644 index aa089a3..0000000 --- a/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_extract.py +++ /dev/null @@ -1,60 +0,0 @@ -""" -Rule test code for unit testing of rules generated with Snakemake 9.24.0. -""" - -import os -import sys -import shutil -import tempfile -from pathlib import Path -from subprocess import check_output - -sys.path.insert(0, os.path.dirname(__file__)) - - -def test_prefilter_reads_extract(conda_prefix): - - with tempfile.TemporaryDirectory() as tmpdir: - workdir = Path(tmpdir) / "workdir" - config_path = Path(".tests/unit/prefilter_reads_extract/config") - data_path = Path(".tests/unit/prefilter_reads_extract/data") - expected_path = Path(".tests/unit/prefilter_reads_extract/expected") - - # Copy config to the temporary workdir. - shutil.copytree(config_path, workdir) - - # Copy data to the temporary workdir. - shutil.copytree(data_path, workdir, dirs_exist_ok=True) - - # Run the test job. - check_output( - [ - "python", - "-m", - "snakemake", - "results/reads/prefilter/extract/Lib_LVsim1_collapsed.fastq.gz", - "--snakefile", - "../../workflow/Snakefile", - "-f", - "--notemp", - "--show-failed-logs", - "-j1", - "--target-files-omit-workdir-adjustment", - "--allowed-rules", - "prefilter_reads_extract", - "--configfile", - "config/config.yaml", - "--software-deployment-method", - "conda", - "--directory", - workdir, - ] - + conda_prefix - ) - - # Check the output byte by byte using cmp/zmp/bzcmp/xzcmp. - # To modify this behavior, you can inherit from common.OutputChecker in here - # and overwrite the method `compare_files(generated_file, expected_file), - # also see common.py. - import common - common.OutputChecker(data_path, expected_path, workdir).check() diff --git a/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_merge.py b/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_merge.py deleted file mode 100644 index 2983b14..0000000 --- a/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_merge.py +++ /dev/null @@ -1,60 +0,0 @@ -""" -Rule test code for unit testing of rules generated with Snakemake 9.24.0. -""" - -import os -import sys -import shutil -import tempfile -from pathlib import Path -from subprocess import check_output - -sys.path.insert(0, os.path.dirname(__file__)) - - -def test_prefilter_reads_merge(conda_prefix): - - with tempfile.TemporaryDirectory() as tmpdir: - workdir = Path(tmpdir) / "workdir" - config_path = Path(".tests/unit/prefilter_reads_merge/config") - data_path = Path(".tests/unit/prefilter_reads_merge/data") - expected_path = Path(".tests/unit/prefilter_reads_merge/expected") - - # Copy config to the temporary workdir. - shutil.copytree(config_path, workdir) - - # Copy data to the temporary workdir. - shutil.copytree(data_path, workdir, dirs_exist_ok=True) - - # Run the test job. - check_output( - [ - "python", - "-m", - "snakemake", - "temp/reads/prefilter/merge/Lib_LVsim1_collapsed.read_ids", - "--snakefile", - "../../workflow/Snakefile", - "-f", - "--notemp", - "--show-failed-logs", - "-j1", - "--target-files-omit-workdir-adjustment", - "--allowed-rules", - "prefilter_reads_merge", - "--configfile", - "config/config.yaml", - "--software-deployment-method", - "conda", - "--directory", - workdir, - ] - + conda_prefix - ) - - # Check the output byte by byte using cmp/zmp/bzcmp/xzcmp. - # To modify this behavior, you can inherit from common.OutputChecker in here - # and overwrite the method `compare_files(generated_file, expected_file), - # also see common.py. - import common - common.OutputChecker(data_path, expected_path, workdir).check() diff --git a/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_taxonomy.py b/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_taxonomy.py deleted file mode 100644 index 7a46c47..0000000 --- a/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_taxonomy.py +++ /dev/null @@ -1,60 +0,0 @@ -""" -Rule test code for unit testing of rules generated with Snakemake 9.24.0. -""" - -import os -import sys -import shutil -import tempfile -from pathlib import Path -from subprocess import check_output - -sys.path.insert(0, os.path.dirname(__file__)) - - -def test_prefilter_reads_taxonomy(conda_prefix): - - with tempfile.TemporaryDirectory() as tmpdir: - workdir = Path(tmpdir) / "workdir" - config_path = Path(".tests/unit/prefilter_reads_taxonomy/config") - data_path = Path(".tests/unit/prefilter_reads_taxonomy/data") - expected_path = Path(".tests/unit/prefilter_reads_taxonomy/expected") - - # Copy config to the temporary workdir. - shutil.copytree(config_path, workdir) - - # Copy data to the temporary workdir. - shutil.copytree(data_path, workdir, dirs_exist_ok=True) - - # Run the test job. - check_output( - [ - "python", - "-m", - "snakemake", - "temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids", - "--snakefile", - "../../workflow/Snakefile", - "-f", - "--notemp", - "--show-failed-logs", - "-j1", - "--target-files-omit-workdir-adjustment", - "--allowed-rules", - "prefilter_reads_taxonomy", - "--configfile", - "config/config.yaml", - "--software-deployment-method", - "conda", - "--directory", - workdir, - ] - + conda_prefix - ) - - # Check the output byte by byte using cmp/zmp/bzcmp/xzcmp. - # To modify this behavior, you can inherit from common.OutputChecker in here - # and overwrite the method `compare_files(generated_file, expected_file), - # also see common.py. - import common - common.OutputChecker(data_path, expected_path, workdir).check() diff --git a/examples/euk_prok_virus/config/config.yaml b/examples/euk_prok_virus/config/config.yaml index ae3df34..8dfa2ba 100644 --- a/examples/euk_prok_virus/config/config.yaml +++ b/examples/euk_prok_virus/config/config.yaml @@ -41,9 +41,7 @@ derep: ############# ### ALIGN ### ############# -prefilter: - taxa: "Bacteria,Archaea,Viruses" - +taxon: taxonomy: nodes: "data/taxdump/nodes.dmp" names: "data/taxdump/names.dmp" @@ -52,7 +50,7 @@ prefilter: prok: n_shards: 2 path: "data/prok.{n_shard}-of-2.fas.gz" - map: + map: &map_prok_bowtie2 tool: bowtie2 params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal -N 1" bt2l: False @@ -61,43 +59,12 @@ prefilter: n_shards: 1 path: "data/virus.1-of-1.fas.gz" map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False + <<: *map_prok_bowtie2 acc2taxid: "data/virus.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 25 --weight_type 1 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2" - - -euk: - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: mitoch: n_shards: 1 path: "data/mitoch.1-of-1.fas.gz" - map: + map: &map_euk_bowtie2 tool: bowtie2 params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" bt2l: False @@ -106,9 +73,7 @@ euk: n_shards: 1 path: "data/plastid.1-of-1.fas.gz" map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False + <<: *map_prok_bowtie2 acc2taxid: "data/plastid.acc2taxid.gz" filter: diff --git a/examples/euk_prok_virus/dag.svg b/examples/euk_prok_virus/dag.svg index 876bf67..28bd6c7 100644 --- a/examples/euk_prok_virus/dag.svg +++ b/examples/euk_prok_virus/dag.svg @@ -1,2348 +1,1896 @@ - - - + + snakemake_dag - + 0 - -multiqc_taxon_upload + +multiqc_taxon_upload 1 - -multiqc_taxon + +multiqc_taxon 1->0 - - + + 2 - -trim_fastqc_raw + +trim_fastqc_raw - + 2->1 - - + + 3 - -trim_get_fastq_raw -lane: L001 -library: LVsim2 -read_type_raw: R2 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim1 +read_type_raw: R2 +sample: Lib - + 3->2 - - + + - - -15 - -trim_adapterremoval_fastq_pe + + +16 + +trim_adapterremoval_fastq_pe - - -3->15 - - + + +3->16 + + 4 - -trim_fastqc_raw + +trim_fastqc_raw - + 4->1 - - + + 5 - -trim_get_fastq_raw -lane: L002 -library: LVsim1 -read_type_raw: R1 -sample: Lib + +trim_get_fastq_raw +lane: L002 +library: LVsim1 +read_type_raw: R1 +sample: Lib - + 5->4 - - + + 14 - -trim_adapterremoval_fastq_pe + +trim_adapterremoval_fastq_pe - + 5->14 - - + + 6 - -trim_fastqc_raw + +trim_fastqc_raw - + 6->1 - - + + 7 - -trim_get_fastq_raw -lane: L001 -library: LVsim1 -read_type_raw: R2 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim1 +read_type_raw: R1 +sample: Lib - + 7->6 - - - - - -16 - -trim_adapterremoval_fastq_pe + + - + 7->16 - - + + 8 - -trim_fastqc_raw + +trim_fastqc_raw - + 8->1 - - + + 9 - -trim_get_fastq_raw -lane: L001 -library: LVsim1 -read_type_raw: R1 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim2 +read_type_raw: R1 +sample: Lib - + 9->8 - - + + - - -9->16 - - + + +15 + +trim_adapterremoval_fastq_pe + + + +9->15 + + 10 - -trim_fastqc_raw + +trim_fastqc_raw - + 10->1 - - + + 11 - -trim_get_fastq_raw -lane: L001 -library: LVsim2 -read_type_raw: R1 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim2 +read_type_raw: R2 +sample: Lib - + 11->10 - - + + - + 11->15 - - + + 12 - -trim_fastqc_raw + +trim_fastqc_raw - + 12->1 - - + + 13 - -trim_get_fastq_raw -lane: L002 -library: LVsim1 -read_type_raw: R2 -sample: Lib + +trim_get_fastq_raw +lane: L002 +library: LVsim1 +read_type_raw: R2 +sample: Lib - + 13->12 - - + + - + 13->14 - - + + - + 14->1 - - + + - - -20 - -trim_fastqc_trim -read_type_trim: collapsedtrunc + + +17 + +trim_fastqc_trim +read_type_trim: R1 - - -14->20 - - + + +14->17 + + - - -21 - -trim_fastqc_trim -read_type_trim: collapsed + + +18 + +trim_fastqc_trim +read_type_trim: collapsedtrunc - - -14->21 - - + + +14->18 + + - - -23 - -trim_fastqc_trim -read_type_trim: R2 + + +28 + +trim_fastqc_trim +read_type_trim: collapsed - - -14->23 - - + + +14->28 + + - - -24 - -trim_fastqc_trim -read_type_trim: R1 + + +29 + +trim_fastqc_trim +read_type_trim: R2 - - -14->24 - - + + +14->29 + + - - -26 - -trim_fastqc_trim -read_type_trim: singleton + + +30 + +trim_fastqc_trim +read_type_trim: singleton - - -14->26 - - + + +14->30 + + 33 - -derep_merge_lanes -read_type_trim: collapsed + +derep_merge_lanes +read_type_trim: collapsed - + 14->33 - - + + - + 15->1 - - - - - -17 - -trim_fastqc_trim -read_type_trim: collapsed - - - -15->17 - - + + 19 - -trim_fastqc_trim -read_type_trim: R2 + +trim_fastqc_trim +read_type_trim: R1 - + 15->19 - - + + - - -22 - -trim_fastqc_trim -read_type_trim: collapsedtrunc + + +20 + +trim_fastqc_trim +read_type_trim: R2 - - -15->22 - - + + +15->20 + + - - -29 - -trim_fastqc_trim -read_type_trim: singleton + + +23 + +trim_fastqc_trim +read_type_trim: collapsed - - -15->29 - - + + +15->23 + + + + + +25 + +trim_fastqc_trim +read_type_trim: singleton + + + +15->25 + + 31 - -trim_fastqc_trim -read_type_trim: R1 + +trim_fastqc_trim +read_type_trim: collapsedtrunc - + 15->31 - - + + 35 - -derep_merge_lanes -read_type_trim: collapsed + +derep_merge_lanes +read_type_trim: collapsed - + 15->35 - - + + - + 16->1 - - + + - - -18 - -trim_fastqc_trim -read_type_trim: R1 + + +21 + +trim_fastqc_trim +read_type_trim: collapsedtrunc - - -16->18 - - + + +16->21 + + - - -25 - -trim_fastqc_trim -read_type_trim: R2 + + +22 + +trim_fastqc_trim +read_type_trim: R1 - - -16->25 - - + + +16->22 + + + + + +24 + +trim_fastqc_trim +read_type_trim: singleton + + + +16->24 + + + + + +26 + +trim_fastqc_trim +read_type_trim: R2 + + + +16->26 + + 27 - -trim_fastqc_trim -read_type_trim: collapsedtrunc + +trim_fastqc_trim +read_type_trim: collapsed - + 16->27 - - - - - -28 - -trim_fastqc_trim -read_type_trim: singleton - - - -16->28 - - - - - -30 - -trim_fastqc_trim -read_type_trim: collapsed - - - -16->30 - - + + - + 16->33 - - + + - + 17->1 - - + + - + 18->1 - - + + - + 19->1 - - + + - + 20->1 - - + + - + 21->1 - - + + - + 22->1 - - + + - + 23->1 - - + + - + 24->1 - - + + - + 25->1 - - + + - + 26->1 - - + + - + 27->1 - - + + - + 28->1 - - + + - + 29->1 - - + + - + 30->1 - - + + - + 31->1 - - + + 32 - -derep_fastqc -tool: merge_lanes + +derep_fastqc +tool: merge_lanes - + 32->1 - - + + - + 33->32 - - + + - - -39 - -derep_nonpareil_infer -tool: merge_lanes + + +37 + +derep_nonpareil_infer +tool: merge_lanes - - -33->39 - - + + +33->37 + + 41 - -derep_seqkit + +derep_seqkit - + 33->41 - - + + 34 - -derep_fastqc -tool: merge_lanes + +derep_fastqc +tool: merge_lanes - + 34->1 - - + + - + 35->34 - - + + - - -37 - -derep_nonpareil_infer -tool: merge_lanes + + +39 + +derep_nonpareil_infer +tool: merge_lanes - - -35->37 - - + + +35->39 + + 43 - -derep_seqkit + +derep_seqkit - + 35->43 - - + + 36 - -derep_nonpareil_plot + +derep_nonpareil_plot - + 36->1 - - + + - + 37->36 - - + + 38 - -derep_nonpareil_plot + +derep_nonpareil_plot - + 38->1 - - + + - + 39->38 - - + + 40 - -derep_fastqc -tool: derep + +derep_fastqc +tool: derep - + 40->1 - - + + - + 41->40 - - + + 47 - -derep_low_complexity + +derep_low_complexity - + 41->47 - - + + 42 - -derep_fastqc -tool: derep + +derep_fastqc +tool: derep - + 42->1 - - + + - + 43->42 - - + + 45 - -derep_low_complexity + +derep_low_complexity - + 43->45 - - + + 44 - -derep_fastqc -tool: low_complexity + +derep_fastqc +tool: low_complexity - + 44->1 - - + + - + 45->44 - - + + - - -67 - -prefilter_reads_extract + + +48 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: mitoch +tot_shards: 1 + + + +45->48 + + - - -45->67 - - + + +50 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: prok +tot_shards: 2 + + + +45->50 + + - - -73 - -taxon_prefilter_shard_bowtie2 -n_shard: 1 -read_type_map: collapsed -ref: virus -tot_shards: 1 - - - -45->73 - - + + +51 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: plastid +tot_shards: 1 + + + +45->51 + + - - -76 - -taxon_prefilter_shard_bowtie2 -n_shard: 2 -read_type_map: collapsed -ref: prok -tot_shards: 2 - - - -45->76 - - + + +52 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: virus +tot_shards: 1 + + + +45->52 + + - - -78 - -taxon_prefilter_shard_bowtie2 -n_shard: 1 -read_type_map: collapsed -ref: prok -tot_shards: 2 - - - -45->78 - - - - - -129 - -taxon_prefilter_shard_saturated_reads_extract - - - -45->129 - - - - - -133 - -taxon_shard_saturated_reads_extract - - - -45->133 - - + + +56 + +taxon_shard_bowtie2 +n_shard: 2 +read_type_map: collapsed +ref: prok +tot_shards: 2 + + + +45->56 + + + + + +105 + +taxon_shard_saturated_reads_extract + + + +45->105 + + 46 - -derep_fastqc -tool: low_complexity + +derep_fastqc +tool: low_complexity - + 46->1 - - + + - + 47->46 - - + + 49 - -prefilter_reads_extract + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: virus +tot_shards: 1 - + 47->49 - - + + + + + +53 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: plastid +tot_shards: 1 + + + +47->53 + + + + + +54 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: mitoch +tot_shards: 1 + + + +47->54 + + 55 - -taxon_prefilter_shard_bowtie2 -n_shard: 1 -read_type_map: collapsed -ref: virus -tot_shards: 1 + +taxon_shard_bowtie2 +n_shard: 2 +read_type_map: collapsed +ref: prok +tot_shards: 2 - + 47->55 - - + + - - -58 - -taxon_prefilter_shard_bowtie2 -n_shard: 2 -read_type_map: collapsed -ref: prok -tot_shards: 2 - - - -47->58 - - + + +57 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: prok +tot_shards: 2 + + + +47->57 + + - - -60 - -taxon_prefilter_shard_bowtie2 -n_shard: 1 -read_type_map: collapsed -ref: prok -tot_shards: 2 - - - -47->60 - - - - - -128 - -taxon_prefilter_shard_saturated_reads_extract - - - -47->128 - - - - - -132 - -taxon_shard_saturated_reads_extract - - - -47->132 - - + + +104 + +taxon_shard_saturated_reads_extract - - -48 - -prefilter_fastqc + + +47->104 + + - + 48->1 - - + + - - -49->48 - - + + +82 + +taxon_shard_count_alns - - -96 - -taxon_shard_bowtie2 -n_shard: 1 -ref: mitoch -tot_shards: 1 + + +48->82 + + - - -49->96 - - + + +87 + +taxon_shard_saturated_reads_remove - - -99 - -taxon_shard_bowtie2 -n_shard: 1 -ref: plastid -tot_shards: 1 + + +48->87 + + - - -49->99 - - + + +49->1 + + - - -50 - -prefilter_reads_merge + + +67 + +taxon_shard_count_alns - - -50->49 - - + + +49->67 + + - - -51 - -prefilter_reads_taxonomy + + +75 + +taxon_shard_saturated_reads_remove - - -51->50 - - + + +49->75 + + - - -52 - -taxon_prefilter_align_merge + + +50->1 + + - - -52->51 - - + + +79 + +taxon_shard_saturated_reads_remove + + + +50->79 + + + + + +83 + +taxon_shard_count_alns + + + +50->83 + + + + + +51->1 + + 84 - -taxon_prefilter_align_samtools_stats + +taxon_shard_count_alns - - -52->84 - - - - - -87 - -taxon_prefilter_align_sort_taxon - - - -52->87 - - + + +51->84 + + 91 - -taxon_prefilter_metadmg_lca + +taxon_shard_saturated_reads_remove - - -52->91 - - - - - -130 - -taxon_prefilter_metadmg_damage - - - -52->130 - - + + +51->91 + + - - -53 - -taxon_prefilter_shard_unicorn_refstats + + +52->1 + + - - -53->52 - - + + +85 + +taxon_shard_count_alns - - -54 - -taxon_prefilter_shard_saturated_reads_remove + + +52->85 + + - - -54->53 - - + + +93 + +taxon_shard_saturated_reads_remove - - -55->1 - - + + +52->93 + + - - -55->54 - - + + +53->1 + + - - -61 - -taxon_prefilter_shard_count_alns + + +66 + +taxon_shard_count_alns - + + +53->66 + + + + + +73 + +taxon_shard_saturated_reads_remove + + -55->61 - - +53->73 + + - - -56 - -taxon_prefilter_shard_saturated_reads_filter + + +54->1 + + - - -56->50 - - + + +64 + +taxon_shard_count_alns - - -56->54 - - + + +54->64 + + + + + +69 + +taxon_shard_saturated_reads_remove + + + +54->69 + + + + + +55->1 + + 63 - -taxon_prefilter_shard_saturated_reads_remove + +taxon_shard_count_alns - - -56->63 - - + + +55->63 + + + + + +71 + +taxon_shard_saturated_reads_remove + + + +55->71 + + + + + +56->1 + + + + + +81 + +taxon_shard_count_alns + + + +56->81 + + + + + +89 + +taxon_shard_saturated_reads_remove + + + +56->89 + + + + + +57->1 + + + + + +61 + +taxon_shard_saturated_reads_remove + + + +57->61 + + 65 - -taxon_prefilter_shard_saturated_reads_remove - - - -56->65 - - + +taxon_shard_count_alns - - -56->128 - - - - - -57 - -taxon_prefilter_shard_count_alns + + +57->65 + + - - -57->56 - - + + +58 + +taxon_align_samtools_stats - + 58->1 - - - - - -58->57 - - - - - -58->63 - - + + 59 - -taxon_prefilter_shard_count_alns + +taxon_align_merge - - -59->56 - - + + +59->58 + + - - -60->1 - - + + +95 + +taxon_align_sort_taxon + + + +59->95 + + + + + +99 + +taxon_metadmg_lca + + + +59->99 + + + + + +106 + +taxon_metadmg_damage + + + +59->106 + + + + + +60 + +taxon_shard_unicorn_refstats - + 60->59 - - - - - -60->65 - - + + - - -61->56 - - + + +61->60 + + 62 - -taxon_prefilter_shard_unicorn_refstats + +taxon_shard_saturated_reads_filter - - -62->52 - - + + +62->61 + + - - -63->62 - - + + +62->69 + + - - -64 - -taxon_prefilter_shard_unicorn_refstats + + +62->71 + + - - -64->52 - - + + +62->73 + + - + -65->64 - - +62->75 + + - - -66 - -prefilter_fastqc - - - -66->1 - - + + +62->104 + + - - -67->66 - - + + +63->62 + + - - -97 - -taxon_shard_bowtie2 -n_shard: 1 -ref: mitoch -tot_shards: 1 + + +64->62 + + - - -67->97 - - + + +65->62 + + - - -98 - -taxon_shard_bowtie2 -n_shard: 1 -ref: plastid -tot_shards: 1 + + +66->62 + + - - -67->98 - - + + +67->62 + + 68 - -prefilter_reads_merge - - - -68->67 - - + +taxon_shard_unicorn_refstats - - -69 - -prefilter_reads_taxonomy + + +68->59 + + - + 69->68 - - + + 70 - -taxon_prefilter_align_merge - - - -70->69 - - - - - -85 - -taxon_prefilter_align_samtools_stats - - - -70->85 - - - - - -89 - -taxon_prefilter_align_sort_taxon - - - -70->89 - - - - - -93 - -taxon_prefilter_metadmg_lca - - - -70->93 - - - - - -131 - -taxon_prefilter_metadmg_damage - - - -70->131 - - + +taxon_shard_unicorn_refstats - - -71 - -taxon_prefilter_shard_unicorn_refstats + + +70->59 + + - + 71->70 - - + + 72 - -taxon_prefilter_shard_saturated_reads_remove - - - -72->71 - - + +taxon_shard_unicorn_refstats - - -73->1 - - + + +72->59 + + - + 73->72 - - - - - -79 - -taxon_prefilter_shard_count_alns - - - -73->79 - - + + 74 - -taxon_prefilter_shard_saturated_reads_filter - - - -74->68 - - - - - -74->72 - - - - - -81 - -taxon_prefilter_shard_saturated_reads_remove - - - -74->81 - - - - - -83 - -taxon_prefilter_shard_saturated_reads_remove - - - -74->83 - - - - - -74->129 - - + +taxon_shard_unicorn_refstats - - -75 - -taxon_prefilter_shard_count_alns + + +74->59 + + - + 75->74 - - + + + + + +76 + +taxon_align_samtools_stats - + 76->1 - - - - - -76->75 - - - - - -76->81 - - + + 77 - -taxon_prefilter_shard_count_alns + +taxon_align_merge - - -77->74 - - + + +77->76 + + - - -78->1 - - + + +97 + +taxon_align_sort_taxon + + + +77->97 + + + + + +101 + +taxon_metadmg_lca + + + +77->101 + + + + + +107 + +taxon_metadmg_damage + + + +77->107 + + + + + +78 + +taxon_shard_unicorn_refstats - + 78->77 - - + + - - -78->83 - - - - - -79->74 - - + + +79->78 + + 80 - -taxon_prefilter_shard_unicorn_refstats + +taxon_shard_saturated_reads_filter - - -80->70 - - + + +80->79 + + + + + +80->87 + + + + + +80->89 + + + + + +80->91 + + + + + +80->93 + + + + + +80->105 + + - + 81->80 - - - - - -82 - -taxon_prefilter_shard_unicorn_refstats + + - + -82->70 - - +82->80 + + - - -83->82 - - + + +83->80 + + - - -84->1 - - + + +84->80 + + - - -85->1 - - + + +85->80 + + 86 - -taxon_prefilter_align_unicorn_taxstats + +taxon_shard_unicorn_refstats - - -86->1 - - + + +86->77 + + - + 87->86 - - + + 88 - -taxon_prefilter_align_unicorn_taxstats + +taxon_shard_unicorn_refstats - - -88->1 - - + + +88->77 + + - + 89->88 - - + + 90 - -taxon_prefilter_metadmg_dfit + +taxon_shard_unicorn_refstats - - -90->1 - - - - - -94 - -taxon_prefilter_metadmg_aggregate - - - -90->94 - - + + +90->77 + + - + 91->90 - - - - - -91->94 - - + + 92 - -taxon_prefilter_metadmg_dfit - - - -92->1 - - - - - -95 - -taxon_prefilter_metadmg_aggregate + +taxon_shard_unicorn_refstats - - -92->95 - - + + +92->77 + + - + 93->92 - - - - - -93->95 - - + + - - -94->0 - - + + +94 + +taxon_align_unicorn_taxstats - + 94->1 - - + + - - -95->0 - - + + +95->94 + + - - -95->1 - - + + +96 + +taxon_align_unicorn_taxstats - + 96->1 - - + + - - -103 - -taxon_shard_saturated_reads_remove + + +97->96 + + - - -96->103 - - + + +98 + +taxon_metadmg_dfit - - -106 - -taxon_shard_count_alns + + +98->1 + + - - -96->106 - - + + +102 + +taxon_metadmg_aggregate - - -97->1 - - - - - -112 - -taxon_shard_saturated_reads_remove - - - -97->112 - - - - - -115 - -taxon_shard_count_alns - - - -97->115 - - + + +98->102 + + - - -98->1 - - - - - -114 - -taxon_shard_count_alns - - - -98->114 - - - - - -117 - -taxon_shard_saturated_reads_remove - - - -98->117 - - - - - -99->1 - - + + +99->98 + + - - -105 - -taxon_shard_count_alns - - - -99->105 - - - - - -108 - -taxon_shard_saturated_reads_remove - - - -99->108 - - + + +99->102 + + 100 - -taxon_align_samtools_stats + +taxon_metadmg_dfit - + 100->1 - - + + - - -101 - -taxon_align_merge + + +103 + +taxon_metadmg_aggregate + + + +100->103 + + - + 101->100 - - - - - -119 - -taxon_align_sort_taxon - - - -101->119 - - - - - -123 - -taxon_metadmg_lca - - - -101->123 - - - - - -134 - -taxon_metadmg_damage - - - -101->134 - - - - - -102 - -taxon_shard_unicorn_refstats - - - -102->101 - - - - - -103->102 - - + + - - -104 - -taxon_shard_saturated_reads_filter - - - -104->103 - - - - - -104->108 - - - - - -104->132 - - - - - -105->104 - - - - - -106->104 - - + + +101->103 + + - - -107 - -taxon_shard_unicorn_refstats - - - -107->101 - - - - - -108->107 - - - - - -109 - -taxon_align_samtools_stats - - - -109->1 - - - - - -110 - -taxon_align_merge - - - -110->109 - - - - - -121 - -taxon_align_sort_taxon - - - -110->121 - - - - - -125 - -taxon_metadmg_lca - - - -110->125 - - - - - -135 - -taxon_metadmg_damage - - - -110->135 - - - - - -111 - -taxon_shard_unicorn_refstats - - - -111->110 - - - - - -112->111 - - - - - -113 - -taxon_shard_saturated_reads_filter - - - -113->112 - - - - - -113->117 - - - - - -113->133 - - - - - -114->113 - - - - - -115->113 - - - - - -116 - -taxon_shard_unicorn_refstats - - - -116->110 - - - - - -117->116 - - - - - -118 - -taxon_align_unicorn_taxstats - - - -118->1 - - - - - -119->118 - - - - - -120 - -taxon_align_unicorn_taxstats - - - -120->1 - - - - - -121->120 - - - - - -122 - -taxon_metadmg_dfit - - - -122->1 - - - - - -126 - -taxon_metadmg_aggregate - - - -122->126 - - - - - -123->122 - - - - - -123->126 - - - - - -124 - -taxon_metadmg_dfit - - - -124->1 - - - - - -127 - -taxon_metadmg_aggregate - - - -124->127 - - - - - -125->124 - - - - - -125->127 - - - - - -126->0 - - + + +102->0 + + - - -126->1 - - + + +102->1 + + - - -127->0 - - + + +103->0 + + - - -127->1 - - + + +103->1 + + - + -128->0 - - +104->0 + + - + -129->0 - - +105->0 + + - + -130->0 - - +106->0 + + - + -131->0 - - - - - -132->0 - - - - - -133->0 - - - - - -134->0 - - - - - -135->0 - - +107->0 + + diff --git a/examples/euk_prok_virus/filegraph.svg b/examples/euk_prok_virus/filegraph.svg index 4eb65e6..2549712 100644 --- a/examples/euk_prok_virus/filegraph.svg +++ b/examples/euk_prok_virus/filegraph.svg @@ -1,1357 +1,826 @@ - - - + + snakemake_dag - + 0 -multiqc_taxon_upload - -↪ input - -reports/multiqc.taxon.html -reports/multiqc_data.taxon.zip -reports/multiqc_data.taxon.zip -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/prefilter_reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/prefilter_reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/prefilter_reads/saturated/Lib_LVsim2_collapsed.fastq.gz -results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/reads/saturated/Lib_LVsim2_collapsed.fastq.gz -stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/metadmg/damage/Lib_LVsim2_collapsed.stat.gz -stats/prefilter_metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/prefilter_metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/prefilter_metadmg/damage/Lib_LVsim2_collapsed.stat.gz - -output → - -stats/reports/multiqc_taxon.upload.flag - - - +multiqc_taxon_upload + +↪ input + +reports/multiqc.taxon.html +reports/multiqc_data.taxon.zip +reports/multiqc_data.taxon.zip +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz +results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz +results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz +results/reads/saturated/Lib_LVsim2_collapsed.fastq.gz +stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz +stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz +stats/metadmg/damage/Lib_LVsim2_collapsed.stat.gz + +output → + +stats/reports/multiqc_taxon.upload.flag + + + 1 -multiqc_taxon - -↪ input - -/maps/projects/caeg/people/lnc113/workflows/aeDNA/aeDNA/workflow/resources/multiqc_config.yaml -logs/prefilter_shards/bowtie2/Lib_LVsim1_collapsed.prok.1-of-2.log -logs/prefilter_shards/bowtie2/Lib_LVsim1_collapsed.prok.2-of-2.log -logs/prefilter_shards/bowtie2/Lib_LVsim1_collapsed.virus.1-of-1.log -logs/prefilter_shards/bowtie2/Lib_LVsim2_collapsed.prok.1-of-2.log -logs/prefilter_shards/bowtie2/Lib_LVsim2_collapsed.prok.2-of-2.log -logs/prefilter_shards/bowtie2/Lib_LVsim2_collapsed.virus.1-of-1.log -logs/shards/bowtie2/Lib_LVsim1_collapsed.mitoch.1-of-1.log -logs/shards/bowtie2/Lib_LVsim1_collapsed.plastid.1-of-1.log -logs/shards/bowtie2/Lib_LVsim2_collapsed.mitoch.1-of-1.log -logs/shards/bowtie2/Lib_LVsim2_collapsed.plastid.1-of-1.log -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/prefilter_metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/prefilter_metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/prefilter_metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz -stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt -stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt -stats/aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv -stats/aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv -stats/aligns/unicorn/taxstats/Lib_LVsim2_collapsed.tsv -stats/prefilter_aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools/stats/Lib_LVsim2_collapsed.txt -stats/prefilter_aligns/samtools/stats/Lib_LVsim2_collapsed.txt -stats/prefilter_aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv -stats/prefilter_aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv -stats/prefilter_aligns/unicorn/taxstats/Lib_LVsim2_collapsed.tsv -stats/reads/fastqc/derep/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/derep/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/low_complexity/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/low_complexity/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/merge_lanes/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/merge_lanes/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/prefilter/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/prefilter/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/prefilter/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L001_R1.html -stats/reads/fastqc/raw/Lib_LVsim1_L001_R1_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L001_R2.html -stats/reads/fastqc/raw/Lib_LVsim1_L001_R2_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L002_R1.html -stats/reads/fastqc/raw/Lib_LVsim1_L002_R1_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L002_R2.html -stats/reads/fastqc/raw/Lib_LVsim1_L002_R2_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim2_L001_R1.html -stats/reads/fastqc/raw/Lib_LVsim2_L001_R1_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim2_L001_R2.html -stats/reads/fastqc/raw/Lib_LVsim2_L001_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_R1.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_R1_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_R2.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_R1.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_R1_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_R2.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_R1.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_R1_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_R2.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton_fastqc.zip -stats/reads/nonpareil/merge_lanes/Lib_LVsim1_collapsed.json -stats/reads/nonpareil/merge_lanes/Lib_LVsim2_collapsed.json -stats/reads/trim/Lib_LVsim1_L001_pe.settings -stats/reads/trim/Lib_LVsim1_L002_pe.settings -stats/reads/trim/Lib_LVsim2_L001_pe.settings - -output → - -reports/multiqc.taxon.html -reports/multiqc_data.taxon.zip - - - +multiqc_taxon + +↪ input + +/maps/projects/caeg/people/lnc113/workflows/aeDNA/aeDNA/workflow/resources/multiqc_config.yaml +logs/shards/bowtie2/Lib_LVsim1_collapsed.mitoch.1-of-1.log +logs/shards/bowtie2/Lib_LVsim1_collapsed.plastid.1-of-1.log +logs/shards/bowtie2/Lib_LVsim1_collapsed.prok.1-of-2.log +logs/shards/bowtie2/Lib_LVsim1_collapsed.prok.2-of-2.log +logs/shards/bowtie2/Lib_LVsim1_collapsed.virus.1-of-1.log +logs/shards/bowtie2/Lib_LVsim2_collapsed.mitoch.1-of-1.log +logs/shards/bowtie2/Lib_LVsim2_collapsed.plastid.1-of-1.log +logs/shards/bowtie2/Lib_LVsim2_collapsed.prok.1-of-2.log +logs/shards/bowtie2/Lib_LVsim2_collapsed.prok.2-of-2.log +logs/shards/bowtie2/Lib_LVsim2_collapsed.virus.1-of-1.log +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz +results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz +results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz +results/metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv +stats/aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv +stats/aligns/unicorn/taxstats/Lib_LVsim2_collapsed.tsv +stats/reads/fastqc/derep/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/derep/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/low_complexity/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/low_complexity/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/merge_lanes/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/merge_lanes/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L001_R1.html +stats/reads/fastqc/raw/Lib_LVsim1_L001_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L001_R2.html +stats/reads/fastqc/raw/Lib_LVsim1_L001_R2_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L002_R1.html +stats/reads/fastqc/raw/Lib_LVsim1_L002_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L002_R2.html +stats/reads/fastqc/raw/Lib_LVsim1_L002_R2_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim2_L001_R1.html +stats/reads/fastqc/raw/Lib_LVsim2_L001_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim2_L001_R2.html +stats/reads/fastqc/raw/Lib_LVsim2_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_R1.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_R2.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_R1.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_R2.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_R1.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_R2.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton_fastqc.zip +stats/reads/nonpareil/merge_lanes/Lib_LVsim1_collapsed.json +stats/reads/nonpareil/merge_lanes/Lib_LVsim2_collapsed.json +stats/reads/trim/Lib_LVsim1_L001_pe.settings +stats/reads/trim/Lib_LVsim1_L002_pe.settings +stats/reads/trim/Lib_LVsim2_L001_pe.settings + +output → + +reports/multiqc.taxon.html +reports/multiqc_data.taxon.zip + + + - + 1->0 - - + + 2 -trim_fastqc_raw - -↪ input - -results/reads/raw/{sample}_{library}_{lane}_{read_type_raw}.fastq.gz - -output → - -stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.html -stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}_fastqc.zip - - - +trim_fastqc_raw + +↪ input + +results/reads/raw/{sample}_{library}_{lane}_{read_type_raw}.fastq.gz + +output → + +stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.html +stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}_fastqc.zip + + + - + 2->1 - - + + 3 -trim_get_fastq_raw - -↪ input - -<input function> - -output → - -results/reads/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.fastq.gz - - - +trim_get_fastq_raw + +↪ input + +<input function> + +output → + +results/reads/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.fastq.gz + + + - + 3->2 - - + + 4 -trim_adapterremoval_fastq_pe - -↪ input - -<input function> - -output → - -results/reads/trim/{sample}_{library}_{lane}_R1.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_R2.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_collapsed.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_collapsedtrunc.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_discarded.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_singleton.fastq.gz -stats/reads/trim/{sample}_{library}_{lane}_pe.settings - - - +trim_adapterremoval_fastq_pe + +↪ input + +<input function> + +output → + +results/reads/trim/{sample}_{library}_{lane}_R1.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_R2.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_collapsed.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_collapsedtrunc.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_discarded.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_singleton.fastq.gz +stats/reads/trim/{sample}_{library}_{lane}_pe.settings + + + - + 3->4 - - + + 4->1 - - + + 5 -trim_fastqc_trim - -↪ input - -results/reads/trim/{sample}_{library}_{lane}_{read_type_trim}.fastq.gz - -output → - -stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,collapsed|R2|R1|singleton|collapsedtrunc}.html -stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,collapsed|R2|R1|singleton|collapsedtrunc}_fastqc.zip - - - +trim_fastqc_trim + +↪ input + +results/reads/trim/{sample}_{library}_{lane}_{read_type_trim}.fastq.gz + +output → + +stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,singleton|collapsed|collapsedtrunc|R2|R1}.html +stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,singleton|collapsed|collapsedtrunc|R2|R1}_fastqc.zip + + + - + 4->5 - - + + 7 -derep_merge_lanes - -↪ input - -<input function> - -output → - -temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz - - - +derep_merge_lanes + +↪ input + +<input function> + +output → + +temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz + + + - + 4->7 - - + + - + 5->1 - - + + 6 -derep_fastqc - -↪ input - -<input function> - -output → - -stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}.html -stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}_fastqc.zip - - - +derep_fastqc + +↪ input + +<input function> + +output → + +stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}.html +stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}_fastqc.zip + + + - + 6->1 - - + + - + 7->6 - - + + 9 -derep_nonpareil_infer - -↪ input - -<input function> - -output → - -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.log -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npa -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npc -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo - - - +derep_nonpareil_infer + +↪ input + +<input function> + +output → + +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.log +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npa +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npc +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo + + + - + 7->9 - - + + 10 -derep_seqkit - -↪ input - -temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz - -output → - -stats/reads/derep/{sample}_{library}_{read_type_trim}.dup.tsv -temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz - - - +derep_seqkit + +↪ input + +temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz + +output → + +stats/reads/derep/{sample}_{library}_{read_type_trim}.dup.tsv +temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz + + + - + 7->10 - - + + 8 -derep_nonpareil_plot - -↪ input - -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo - -output → - -reports/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.pdf -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.json -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.tsv - - - +derep_nonpareil_plot + +↪ input + +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo + +output → + +reports/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.pdf +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.json +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.tsv + + + - + 8->1 - - + + - + 9->8 - - + + - + 10->6 - - + + 11 -derep_low_complexity - -↪ input - -temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz - -output → - -results/reads/low_complexity/{sample}_{library}_{read_type_trim}.fastq.gz -stats/reads/low_complexity/{sample}_{library}_{read_type_trim}.txt -temp/reads/low_complexity/{sample}_{library}_{read_type_trim}.discarded.fastq.gz - - - +derep_low_complexity + +↪ input + +temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz + +output → + +results/reads/low_complexity/{sample}_{library}_{read_type_trim}.fastq.gz +stats/reads/low_complexity/{sample}_{library}_{read_type_trim}.txt +temp/reads/low_complexity/{sample}_{library}_{read_type_trim}.discarded.fastq.gz + + + - + 10->11 - - + + - + 11->6 - - - - - -13 -prefilter_reads_extract - -↪ input - -<input function> -temp/reads/prefilter/merge/{sample}_{library}_{read_type_map}.read_ids - -output → - -results/reads/prefilter/extract/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.fastq.gz - - - - - - -11->13 - - - - - -19 -taxon_prefilter_shard_bowtie2 - -↪ input - -<input function> -<input function> - -output → - -temp/prefilter_shards/bowtie2/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -11->19 - - - - - -40 -taxon_prefilter_shard_saturated_reads_extract - -↪ input - -<input function> -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -results/prefilter_reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz - - - - - - -11->40 - - - - - -42 -taxon_shard_saturated_reads_extract - -↪ input - -<input function> -temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -results/reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz - - - - - - -11->42 - - + + 12 -prefilter_fastqc - -↪ input - -results/reads/prefilter/extract/{sample}_{library}_{read_type_map}.fastq.gz - -output → - -stats/reads/fastqc/prefilter/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.html -stats/reads/fastqc/prefilter/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}_fastqc.zip - - - +taxon_shard_bowtie2 + +↪ input + +<input function> +<input function> + +output → + +temp/shards/bowtie2/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +11->12 + + + + + +24 +taxon_shard_saturated_reads_extract + +↪ input + +<input function> +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv + +output → + +results/reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz + + + + + + +11->24 + + - + 12->1 - - + + - - -13->12 - - - - - -28 -taxon_shard_bowtie2 - -↪ input - -<input function> -<input function> - -output → - -temp/shards/bowtie2/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -13->28 - - + + +16 +taxon_shard_saturated_reads_remove + +↪ input + +<input function> +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv + +output → + +temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +12->16 + + + + + +18 +taxon_shard_count_alns + +↪ input + +<input function> + +output → + +temp/shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv + + + + + + +12->18 + + + + + +13 +taxon_align_samtools_stats + +↪ input + +results/aligns/merge/{sample}_{library}_{read_type_map}.bam + +output → + +stats/aligns/samtools/stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt + + + + + + +13->1 + + 14 -prefilter_reads_merge - -↪ input - -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv -temp/reads/prefilter/taxonomy/{sample}_{library}_{read_type_map}.read_ids - -output → - -temp/reads/prefilter/merge/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.read_ids - - - +taxon_align_merge + +↪ input + +<input function> + +output → + +results/aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam + + + - + 14->13 - - + + + + + +20 +taxon_align_sort_taxon + +↪ input + +results/aligns/merge/{sample}_{library}_{read_type_map}.bam + +output → + +temp/aligns/sort_taxon/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam + + + + + + +14->20 + + + + + +22 +taxon_metadmg_lca + +↪ input + +<function <lambda> at 0x7f19482f3270> +data/mitoch.acc2taxid.gz +data/plastid.acc2taxid.gz +data/prok.acc2taxid.gz +data/taxdump/names.dmp +data/taxdump/nodes.dmp +data/virus.acc2taxid.gz + +output → + +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.family.bam +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.used.bam +stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz +stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +14->22 + + + + + +25 +taxon_metadmg_damage + +↪ input + +<function <lambda> at 0x7f19482f3530> + +output → + +results/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz +stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz +stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +14->25 + + 15 -prefilter_reads_taxonomy - -↪ input - -data/prok.acc2taxid.gz -data/taxdump/names.dmp -data/taxdump/nodes.dmp -data/virus.acc2taxid.gz -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -temp/reads/prefilter/taxonomy/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.read_ids - - - +taxon_shard_unicorn_refstats + +↪ input + +<input function> +data/taxdump/names.dmp +data/taxdump/nodes.dmp +temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam + +output → + +stats/shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv +temp/shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + - + 15->14 - - - - - -16 -taxon_prefilter_align_merge - -↪ input - -<input function> - -output → - -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam - - - + + - + 16->15 - - - - - -22 -taxon_prefilter_align_samtools_stats - -↪ input - -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -stats/prefilter_aligns/samtools/stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt - - - - - - -16->22 - - - - - -24 -taxon_prefilter_align_sort_taxon - -↪ input - -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -temp/prefilter_aligns/sort_taxon/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam - - - - - - -16->24 - - - - - -26 -taxon_prefilter_metadmg_lca - -↪ input - -<function <lambda> at 0x7f59c911b7e0> -data/prok.acc2taxid.gz -data/taxdump/names.dmp -data/taxdump/nodes.dmp -data/virus.acc2taxid.gz - -output → - -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.family.bam -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.used.bam -stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -16->26 - - - - - -41 -taxon_prefilter_metadmg_damage - -↪ input - -<function <lambda> at 0x7f59c911b600> - -output → - -results/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -stats/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -16->41 - - + + 17 -taxon_prefilter_shard_unicorn_refstats - -↪ input - -<input function> -data/taxdump/names.dmp -data/taxdump/nodes.dmp -temp/prefilter_shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam - -output → - -stats/prefilter_shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv -temp/prefilter_shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - +taxon_shard_saturated_reads_filter + +↪ input + +temp/shards/count_alns/{sample}_{library}_collapsed.mitoch.1-of-1.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.plastid.1-of-1.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.prok.1-of-2.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.prok.2-of-2.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.virus.1-of-1.tsv + +output → + +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv + + + - + 17->16 - - + + - - -18 -taxon_prefilter_shard_saturated_reads_remove - -↪ input - -<input function> -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -temp/prefilter_shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - + + +17->24 + + - + 18->17 - - + + + + + +19 +taxon_align_unicorn_taxstats + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +temp/aligns/sort_taxon/{sample}_{library}_{read_type_map}.bam + +output → + +stats/aligns/unicorn/taxstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv + + + - + 19->1 - - + + - - -19->18 - - + + +20->19 + + 21 -taxon_prefilter_shard_count_alns - -↪ input - -<input function> - -output → - -temp/prefilter_shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv - - - - - - -19->21 - - - - - -20 -taxon_prefilter_shard_saturated_reads_filter - -↪ input - -temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.prok.1-of-2.tsv -temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.prok.2-of-2.tsv -temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.virus.1-of-1.tsv - -output → - -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv - - - - - - -20->14 - - - - - -20->18 - - - - - -20->40 - - - - - -21->20 - - - - - -22->1 - - +taxon_metadmg_dfit + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz + +output → + +results/metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz + + + + + + +21->1 + + 23 -taxon_prefilter_align_unicorn_taxstats - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -temp/prefilter_aligns/sort_taxon/{sample}_{library}_{read_type_map}.bam - -output → - -stats/prefilter_aligns/unicorn/taxstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv - - - - - - -23->1 - - +taxon_metadmg_aggregate + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +results/metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz +results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz +stats/metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz + +output → + +results/metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +21->23 + + - - -24->23 - - + + +22->21 + + - - -25 -taxon_prefilter_metadmg_dfit - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz - -output → - -results/prefilter_metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz - - - - - - -25->1 - - - - - -27 -taxon_prefilter_metadmg_aggregate - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -results/prefilter_metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz -stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz - -output → - -results/prefilter_metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -25->27 - - - - - -26->25 - - - - - -26->27 - - - - - -27->0 - - + + +22->23 + + - - -27->1 - - + + +23->0 + + - - -28->1 - - - - - -32 -taxon_shard_saturated_reads_remove - -↪ input - -<input function> -temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -28->32 - - - - - -34 -taxon_shard_count_alns - -↪ input - -<input function> - -output → - -temp/shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv - - - - - - -28->34 - - - - - -29 -taxon_align_samtools_stats - -↪ input - -results/aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -stats/aligns/samtools/stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt - - - - - - -29->1 - - - - - -30 -taxon_align_merge - -↪ input - -<input function> - -output → - -results/aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam - - - - - - -30->29 - - - - - -36 -taxon_align_sort_taxon - -↪ input - -results/aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -temp/aligns/sort_taxon/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam - - - - - - -30->36 - - - - - -38 -taxon_metadmg_lca - -↪ input - -<function <lambda> at 0x7f59c913b9c0> -data/mitoch.acc2taxid.gz -data/plastid.acc2taxid.gz -data/taxdump/names.dmp -data/taxdump/nodes.dmp - -output → - -results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.family.bam -results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz -results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.used.bam -stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -30->38 - - - - - -43 -taxon_metadmg_damage - -↪ input - -<function <lambda> at 0x7f59c913ba60> - -output → - -results/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -30->43 - - - - - -31 -taxon_shard_unicorn_refstats - -↪ input - -<input function> -data/taxdump/names.dmp -data/taxdump/nodes.dmp -temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam - -output → - -stats/shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv -temp/shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -31->30 - - - - - -32->31 - - - - - -33 -taxon_shard_saturated_reads_filter - -↪ input - -temp/shards/count_alns/{sample}_{library}_collapsed.mitoch.1-of-1.tsv -temp/shards/count_alns/{sample}_{library}_collapsed.plastid.1-of-1.tsv - -output → - -temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv - - - - - - -33->32 - - - - - -33->42 - - - - - -34->33 - - - - - -35 -taxon_align_unicorn_taxstats - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -temp/aligns/sort_taxon/{sample}_{library}_{read_type_map}.bam - -output → - -stats/aligns/unicorn/taxstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv - - - - - + -35->1 - - - - - -36->35 - - - - - -37 -taxon_metadmg_dfit - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz - -output → - -results/metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz - - - - - - -37->1 - - - - - -39 -taxon_metadmg_aggregate - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -results/metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz -results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz -stats/metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz - -output → - -results/metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -37->39 - - - - - -38->37 - - - - - -38->39 - - - - - -39->0 - - - - - -39->1 - - - - - -40->0 - - - - - -41->0 - - - - - -42->0 - - +23->1 + + - + -43->0 - - +24->0 + + + + + +25->0 + + diff --git a/examples/euk_prok_virus/rulegraph.svg b/examples/euk_prok_virus/rulegraph.svg index d3534ce..ec6216a 100644 --- a/examples/euk_prok_virus/rulegraph.svg +++ b/examples/euk_prok_virus/rulegraph.svg @@ -1,721 +1,421 @@ - - - + + snakemake_dag - + 0 - -multiqc_taxon_upload + +multiqc_taxon_upload 1 - -multiqc_taxon + +multiqc_taxon - + 1->0 - - + + 2 - -trim_fastqc_raw + +trim_fastqc_raw - + 2->1 - - + + 3 - -trim_get_fastq_raw + +trim_get_fastq_raw - + 3->2 - - + + 4 - -trim_adapterremoval_fastq_pe + +trim_adapterremoval_fastq_pe - + 3->4 - - + + - + 4->1 - - + + 5 - -trim_fastqc_trim + +trim_fastqc_trim - + 4->5 - - + + 7 - -derep_merge_lanes + +derep_merge_lanes - + 4->7 - - + + - + 5->1 - - + + 6 - -derep_fastqc + +derep_fastqc - + 6->1 - - + + - + 7->6 - - + + 9 - -derep_nonpareil_infer + +derep_nonpareil_infer - + 7->9 - - + + 10 - -derep_seqkit + +derep_seqkit - + 7->10 - - + + 8 - -derep_nonpareil_plot + +derep_nonpareil_plot - + 8->1 - - + + - + 9->8 - - + + - + 10->6 - - + + 11 - -derep_low_complexity + +derep_low_complexity - + 10->11 - - + + - + 11->6 - - - - - -13 - -prefilter_reads_extract - - - -11->13 - - - - - -19 - -taxon_prefilter_shard_bowtie2 - - - -11->19 - - - - - -40 - -taxon_prefilter_shard_saturated_reads_extract - - - -11->40 - - - - - -42 - -taxon_shard_saturated_reads_extract - - - -11->42 - - + + 12 - -prefilter_fastqc + +taxon_shard_bowtie2 + + + +11->12 + + + + + +24 + +taxon_shard_saturated_reads_extract + + + +11->24 + + - + 12->1 - - + + - - -13->12 - - - - - -28 - -taxon_shard_bowtie2 - - - -13->28 - - + + +16 + +taxon_shard_saturated_reads_remove + + + +12->16 + + + + + +18 + +taxon_shard_count_alns + + + +12->18 + + + + + +13 + +taxon_align_samtools_stats + + + +13->1 + + 14 - -prefilter_reads_merge + +taxon_align_merge - + 14->13 - - + + + + + +20 + +taxon_align_sort_taxon + + + +14->20 + + + + + +22 + +taxon_metadmg_lca + + + +14->22 + + + + + +25 + +taxon_metadmg_damage + + + +14->25 + + 15 - -prefilter_reads_taxonomy + +taxon_shard_unicorn_refstats - + 15->14 - - - - - -16 - -taxon_prefilter_align_merge + + - + 16->15 - - - - - -22 - -taxon_prefilter_align_samtools_stats - - - -16->22 - - - - - -24 - -taxon_prefilter_align_sort_taxon - - - -16->24 - - - - - -26 - -taxon_prefilter_metadmg_lca - - - -16->26 - - - - - -41 - -taxon_prefilter_metadmg_damage - - - -16->41 - - + + 17 - -taxon_prefilter_shard_unicorn_refstats + +taxon_shard_saturated_reads_filter - + 17->16 - - + + - - -18 - -taxon_prefilter_shard_saturated_reads_remove + + +17->24 + + - + 18->17 - - + + + + + +19 + +taxon_align_unicorn_taxstats - + 19->1 - - + + - - -19->18 - - + + +20->19 + + 21 - -taxon_prefilter_shard_count_alns - - - -19->21 - - - - - -20 - -taxon_prefilter_shard_saturated_reads_filter + +taxon_metadmg_dfit - - -20->14 - - - - - -20->18 - - - - - -20->40 - - - - - -21->20 - - - - - -22->1 - - + + +21->1 + + 23 - -taxon_prefilter_align_unicorn_taxstats - - - -23->1 - - - - - -24->23 - - - - - -25 - -taxon_prefilter_metadmg_dfit - - - -25->1 - - - - - -27 - -taxon_prefilter_metadmg_aggregate - - - -25->27 - - - - - -26->25 - - - - - -26->27 - - - - - -27->0 - - + +taxon_metadmg_aggregate - - -27->1 - - + + +21->23 + + - - -28->1 - - - - - -32 - -taxon_shard_saturated_reads_remove - - - -28->32 - - - - - -34 - -taxon_shard_count_alns - - - -28->34 - - - - - -29 - -taxon_align_samtools_stats - - - -29->1 - - - - - -30 - -taxon_align_merge - - - -30->29 - - - - - -36 - -taxon_align_sort_taxon - - - -30->36 - - - - - -38 - -taxon_metadmg_lca - - - -30->38 - - - - - -43 - -taxon_metadmg_damage - - - -30->43 - - - - - -31 - -taxon_shard_unicorn_refstats - - - -31->30 - - - - - -32->31 - - - - - -33 - -taxon_shard_saturated_reads_filter - - - -33->32 - - - - - -33->42 - - - - - -34->33 - - - - - -35 - -taxon_align_unicorn_taxstats - - - -35->1 - - - - - -36->35 - - - - - -37 - -taxon_metadmg_dfit - - - -37->1 - - - - - -39 - -taxon_metadmg_aggregate - - - -37->39 - - - - - -38->37 - - - - - -38->39 - - - - - -39->0 - - + + +22->21 + + - - -39->1 - - + + +22->23 + + - - -40->0 - - + + +23->0 + + - - -41->0 - - + + +23->1 + + - + -42->0 - - +24->0 + + - - -43->0 - - + + +25->0 + + diff --git a/workflow/Snakefile b/workflow/Snakefile index 1e1e16d..82020fd 100644 --- a/workflow/Snakefile +++ b/workflow/Snakefile @@ -33,27 +33,11 @@ module workflow_derep: use rule * from workflow_derep as derep_* -module workflow_taxon_prefilter: - pathvars: - reads="prefilter_reads", - shards="prefilter_shards", - aligns="prefilter_aligns", - metadmg="prefilter_metadmg", - reports="prefilter_reports", - snakefile: - github("GeoGenetics/ngs-taxon", path="workflow/Snakefile", tag="v0.12.0") - config: - {"units": units, "cfg": config["prefilter"]} - - -use rule * from workflow_taxon_prefilter as taxon_prefilter_* - - module workflow_taxon: snakefile: github("GeoGenetics/ngs-taxon", path="workflow/Snakefile", tag="v0.12.0") config: - {"units": units, "cfg": config["euk"]} + {"units": units, "cfg": config["taxon"]} use rule * from workflow_taxon as taxon_* @@ -66,9 +50,6 @@ pathvars: shards="shards", -include: "rules/prefilter.smk" - - onsuccess: print("aeDNA workflow finished successfully!") @@ -211,13 +192,6 @@ use rule multiqc_derep as multiqc_taxon with: input: rules.trim_multiqc.input, rules.derep_multiqc.input, - # FastQC of prefiltered read - expand( - rules.prefilter_fastqc.output.zip, - zip, - **units.assign(read_type_map="collapsed").to_dict("list"), - ), - rules.taxon_prefilter_multiqc.input, rules.taxon_multiqc.input, config=base_dir / "resources/multiqc_config.yaml", output: @@ -233,7 +207,6 @@ rule target_taxon: default_target: True input: rules.multiqc_taxon.output, - rules.taxon_prefilter_all.input.res, rules.taxon_all.input.res, message: "Taxonomic assignment finished successfully!" diff --git a/workflow/envs/metadmg.yaml b/workflow/envs/metadmg.yaml deleted file mode 100644 index 07e0781..0000000 --- a/workflow/envs/metadmg.yaml +++ /dev/null @@ -1,6 +0,0 @@ -channels: - - conda-forge - - bioconda - - nodefaults -dependencies: - - metadmg =0.4.1 diff --git a/workflow/rules/prefilter.smk b/workflow/rules/prefilter.smk deleted file mode 100644 index a096d73..0000000 --- a/workflow/rules/prefilter.smk +++ /dev/null @@ -1,122 +0,0 @@ - -rule prefilter_reads_taxonomy: - input: - bam=rules.taxon_prefilter_align_merge.output.bam, - names=rules.taxon_prefilter_metadmg_lca.input.names, - nodes=rules.taxon_prefilter_metadmg_lca.input.nodes, - acc2taxid=rules.taxon_prefilter_metadmg_lca.input.acc2taxid, - output: - read_id=temp( - "//prefilter/taxonomy/{sample}_{library}_{read_type_map}.read_ids" - ), - log: - "//prefilter/taxonomy/{sample}_{library}_{read_type_map}.log", - benchmark: - "//prefilter/taxonomy/{sample}_{library}_{read_type_map}.jsonl" - conda: - urlunparse( - baseurl._replace(path=str(Path(baseurl.path) / "envs" / "metadmg.yaml")) - ) - threads: 1 - resources: - mem=lambda w, input, attempt: f"{10* attempt} GiB", - runtime=lambda w, input, attempt: f"{(0.05* input.size_gb+0.5)* attempt} h", - params: - extra="-taxnames {}".format(config["prefilter"]["taxa"]), - shell: - "(extract_reads bytaxid -hts {input.bam} -names {input.names} -nodes {input.nodes} -acc2tax <(cat {input.acc2taxid}) {params.extra} -strict 1 -forcedump 1 -out - -type sam | awk '!/^@/' | cut -f 1 | uniq > {output.read_id}) 2> {log}" - - -rule prefilter_reads_merge: - input: - taxonomy=rules.prefilter_reads_taxonomy.output.read_id, - saturated=rules.taxon_prefilter_shard_saturated_reads_filter.output.read_id, - output: - read_id=temp( - "//prefilter/merge/{sample}_{library}_{read_type_map}.read_ids" - ), - log: - "//prefilter/merge/{sample}_{library}_{read_type_map}.log", - benchmark: - "//prefilter/merge/{sample}_{library}_{read_type_map}.jsonl" - localrule: True - threads: 1 - resources: - mem=lambda w, attempt: f"{1* attempt} GiB", - runtime=lambda w, attempt: f"{30* attempt} m", - shell: - "cat {input} > {output} 2> {log}" - - -rule prefilter_reads_extract: - input: - fastq=workflow_taxon_prefilter.get_data, - pattern=branch( - is_activated("prefilter/filter/saturated_reads"), - then=rules.prefilter_reads_merge.output.read_id, - otherwise=rules.prefilter_reads_taxonomy.output.read_id, - ), - output: - fq="//prefilter/extract/{sample}_{library}_{read_type_map}.fastq.gz", - log: - "//prefilter/extract/{sample}_{library}_{read_type_map}.log", - benchmark: - "//prefilter/extract/{sample}_{library}_{read_type_map}.jsonl" - threads: 2 - resources: - mem=lambda w, input, attempt: f"{5* attempt} GiB", - runtime=lambda w, input, attempt: f"{(0.06* input.size_gb+1)* attempt} h", - params: - command="grep", - extra="--invert-match --delete-matched", - wrapper: - "v9.15.0/bio/seqkit" - - -def get_data_prefilter(wildcards): - return [rules.prefilter_reads_extract.output.fq] - - -workflow_taxon.get_data = get_data_prefilter - - -use rule shard_bowtie2 from workflow_taxon as taxon_shard_bowtie2 with: - input: - sample=get_data_prefilter, - idx=workflow_taxon.get_bowtie2_index, - - -use rule shard_bwa_aln from workflow_taxon as taxon_shard_shard_bwa_aln with: - input: - fastq=get_data_prefilter, - idx=lambda w: multiext( - config["ref"][w.ref]["path"], ".amb", ".ann", ".bwt", ".pac", ".sa" - ), - - -use rule shard_dragen from workflow_taxon as taxon_shard_dragen with: - input: - sample=get_data_prefilter, - - -########## -### QC ### -########## - - -rule prefilter_fastqc: - input: - rules.prefilter_reads_extract.output.fq, - output: - html="//fastqc/prefilter/{sample}_{library}_{read_type_map}.html", - zip="//fastqc/prefilter/{sample}_{library}_{read_type_map}_fastqc.zip", - log: - "//fastqc/prefilter/{sample}_{library}_{read_type_map}.log", - benchmark: - "//fastqc/prefilter/{sample}_{library}_{read_type_map}.jsonl" - threads: 4 - resources: - mem=lambda w, attempt: f"{3* attempt} GiB", - runtime=lambda w, attempt: f"{2* attempt} h", - wrapper: - "v9.15.0/bio/fastqc" diff --git a/workflow/schemas/config.schema.yaml b/workflow/schemas/config.schema.yaml index 7203198..befa7a4 100644 --- a/workflow/schemas/config.schema.yaml +++ b/workflow/schemas/config.schema.yaml @@ -17,15 +17,7 @@ properties: derep: type: object - prefilter: - type: object - properties: - taxa: - type: string - required: - - taxa - - euk: + taxon: type: object report: @@ -42,6 +34,5 @@ properties: required: - trim - derep - - prefilter - - euk + - taxon - report