From 61ab3a92785cce878e31970ee229b3f2b02093be Mon Sep 17 00:00:00 2001 From: fgvieira <1151762+fgvieira@users.noreply.github.com> Date: Thu, 27 Aug 2026 11:40:09 +0200 Subject: [PATCH] Implement single mapping step (no prefilter) --- examples/dragen/config/config.yaml | 40 +- examples/dragen/dag.svg | 4244 +++++------ examples/dragen/filegraph.svg | 1862 ++--- examples/dragen/rulegraph.svg | 810 +-- .../config/config/config.yaml | 142 - .../config/config/samples.tsv | 2 - .../config/config/units.tsv | 4 - .../Lib_LVsim1_collapsed.fastq.gz | Bin 130659 -> 0 bytes .../merge/Lib_LVsim1_collapsed.read_ids | 1300 ---- .../extract/Lib_LVsim1_collapsed.fastq.gz | Bin 66337 -> 0 bytes .../config/config/config.yaml | 142 - .../config/config/samples.tsv | 2 - .../config/config/units.tsv | 4 - .../filter/Lib_LVsim1_collapsed.tsv | 1 - .../taxonomy/Lib_LVsim1_collapsed.read_ids | 1299 ---- .../merge/Lib_LVsim1_collapsed.read_ids | 1300 ---- .../config/config/config.yaml | 142 - .../config/config/samples.tsv | 2 - .../config/config/units.tsv | 4 - .../data/data/prok.acc2taxid.gz | Bin 392 -> 0 bytes .../data/data/taxdump/names.dmp | 6450 ----------------- .../data/data/taxdump/nodes.dmp | 3599 --------- .../data/data/virus.acc2taxid.gz | Bin 10768 -> 0 bytes .../merge/Lib_LVsim1_collapsed.bam | Bin 105549 -> 0 bytes .../taxonomy/Lib_LVsim1_collapsed.read_ids | 1299 ---- .../unit/test_prefilter_reads_extract.py | 60 - .../.tests/unit/test_prefilter_reads_merge.py | 60 - .../unit/test_prefilter_reads_taxonomy.py | 60 - examples/euk_prok_virus/config/config.yaml | 45 +- examples/euk_prok_virus/dag.svg | 3098 ++++---- examples/euk_prok_virus/filegraph.svg | 1857 ++--- examples/euk_prok_virus/rulegraph.svg | 814 +-- workflow/Snakefile | 29 +- workflow/envs/metadmg.yaml | 6 - workflow/rules/prefilter.smk | 122 - workflow/schemas/config.schema.yaml | 13 +- 36 files changed, 4908 insertions(+), 23904 deletions(-) delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/config.yaml delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/samples.tsv delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/units.tsv delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/data/results/reads/low_complexity/Lib_LVsim1_collapsed.fastq.gz delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/data/temp/reads/prefilter/merge/Lib_LVsim1_collapsed.read_ids delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/expected/results/reads/prefilter/extract/Lib_LVsim1_collapsed.fastq.gz delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/config.yaml delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/samples.tsv delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/units.tsv delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/prefilter_shards/saturated_reads/filter/Lib_LVsim1_collapsed.tsv delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/expected/temp/reads/prefilter/merge/Lib_LVsim1_collapsed.read_ids delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/config.yaml delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/samples.tsv delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/units.tsv delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/prok.acc2taxid.gz delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/names.dmp delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/nodes.dmp delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/virus.acc2taxid.gz delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/results/prefilter_aligns/merge/Lib_LVsim1_collapsed.bam delete mode 100644 examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/expected/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids delete mode 100644 examples/euk_prok_virus/.tests/unit/test_prefilter_reads_extract.py delete mode 100644 examples/euk_prok_virus/.tests/unit/test_prefilter_reads_merge.py delete mode 100644 examples/euk_prok_virus/.tests/unit/test_prefilter_reads_taxonomy.py delete mode 100644 workflow/envs/metadmg.yaml delete mode 100644 workflow/rules/prefilter.smk diff --git a/examples/dragen/config/config.yaml b/examples/dragen/config/config.yaml index 34ba6ac..2d14405 100644 --- a/examples/dragen/config/config.yaml +++ b/examples/dragen/config/config.yaml @@ -41,9 +41,7 @@ derep: ############# ### ALIGN ### ############# -prefilter: - taxa: "Bacteria,Archaea,Viruses" - +taxon: taxonomy: nodes: "data/taxdump/nodes.dmp" names: "data/taxdump/names.dmp" @@ -52,46 +50,16 @@ prefilter: hires_organelles_viruses_smags: n_shards: 2 path: "/staging/hash_tables/hires-organelles-viruses-smags.{n_shard}" - map: + map: &map_prok_dragen tool: dragen - params: "--Mapper.edit-mode=1" + params: "--Aligner.global=1 --Aligner.match-score=0 --Aligner.match-n-score=-1 --Aligner.mismatch-pen=4 --Aligner.gap-open-pen=0 --Aligner.gap-ext-pen=4 --Aligner.aln-min-score=0 --Aligner.min-score-coeff=-0.4 --Aligner.sec-aligns=2000 --Aligner.supp-aligns=0 --Aligner.hard-clips=0 --Aligner.sec-score-delta=100 --Mapper.edit-mode=1 --Mapper.max-seed-freq=256 --Mapper.reduce-seed-ext=1 --Mapper.intvl-target-hits=256 --Mapper.intvl-max-hits=256 --Mapper.intvl-sample-hits=256 --Mapper.seed-density=1.0 --Mapper.edit-seed-num=80 --Mapper.edit-read-len=100 --Mapper.edit-chain-limit=29 --filter-flags-from-output=4" acc2taxid: "data/prok.acc2taxid.gz" human_genome: n_shards: 1 path: "/staging/hash_tables/GCF_000001405.40_GRCh38.p14_genomic" map: - tool: dragen - params: "--Aligner.global=1 --Aligner.match-score=0 --Aligner.match-n-score=-1 --Aligner.mismatch-pen=4 --Aligner.gap-open-pen=0 --Aligner.gap-ext-pen=4 --Aligner.aln-min-score=0 --Aligner.min-score-coeff=-0.4 --Aligner.sec-aligns=2000 --Aligner.supp-aligns=0 --Aligner.hard-clips=0 --Aligner.sec-score-delta=100 --Mapper.edit-mode=1 --Mapper.max-seed-freq=256 --Mapper.reduce-seed-ext=1 --Mapper.intvl-target-hits=256 --Mapper.intvl-max-hits=256 --Mapper.intvl-sample-hits=256 --Mapper.seed-density=1.0 --Mapper.edit-seed-num=80 --Mapper.edit-read-len=100 --Mapper.edit-chain-limit=29 --filter-flags-from-output=4" + <<: *map_prok_dragen acc2taxid: "data/human.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 500 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 25 --weight_type 1 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2" - - -euk: - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: refseq_mitoch: n_shards: 1 path: "/staging/hash_tables/refseq_mitochondrion.genomic/" diff --git a/examples/dragen/dag.svg b/examples/dragen/dag.svg index c868f81..7cf4d1c 100644 --- a/examples/dragen/dag.svg +++ b/examples/dragen/dag.svg @@ -1,3158 +1,2352 @@ - - - + + snakemake_dag - + 0 - -target_taxon + +multiqc_taxon_upload 1 - -multiqc_taxon + +multiqc_taxon 1->0 - - + + 2 - -trim_fastqc_raw + +trim_fastqc_raw - + 2->1 - - + + 3 - -trim_get_fastq_raw -lane: L002 -library: LVsim1 -read_type_raw: R2 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim1 +read_type_raw: R2 +sample: Lib - + 3->2 - - + + 15 - -trim_adapterremoval_fastq_pe + +trim_adapterremoval_fastq_pe - + 3->15 - - + + 4 - -trim_fastqc_raw + +trim_fastqc_raw - + 4->1 - - + + 5 - -trim_get_fastq_raw -lane: L001 -library: LVsim2 -read_type_raw: R2 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim1 +read_type_raw: R1 +sample: Lib - + 5->4 - - - - - -14 - -trim_adapterremoval_fastq_pe + + - - -5->14 - - + + +5->15 + + 6 - -trim_fastqc_raw + +trim_fastqc_raw - + 6->1 - - + + 7 - -trim_get_fastq_raw -lane: L001 -library: LVsim1 -read_type_raw: R1 -sample: Lib + +trim_get_fastq_raw +lane: L002 +library: LVsim1 +read_type_raw: R2 +sample: Lib - + 7->6 - - + + 16 - -trim_adapterremoval_fastq_pe + +trim_adapterremoval_fastq_pe - + 7->16 - - + + 8 - -trim_fastqc_raw + +trim_fastqc_raw - + 8->1 - - + + 9 - -trim_get_fastq_raw -lane: L001 -library: LVsim1 -read_type_raw: R2 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim2 +read_type_raw: R2 +sample: Lib - + 9->8 - - + + - - -9->16 - - + + +14 + +trim_adapterremoval_fastq_pe + + + +9->14 + + 10 - -trim_fastqc_raw + +trim_fastqc_raw - + 10->1 - - + + 11 - -trim_get_fastq_raw -lane: L002 -library: LVsim1 -read_type_raw: R1 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim2 +read_type_raw: R1 +sample: Lib - + 11->10 - - + + - - -11->15 - - + + +11->14 + + 12 - -trim_fastqc_raw + +trim_fastqc_raw - + 12->1 - - + + 13 - -trim_get_fastq_raw -lane: L001 -library: LVsim2 -read_type_raw: R1 -sample: Lib + +trim_get_fastq_raw +lane: L002 +library: LVsim1 +read_type_raw: R1 +sample: Lib - + 13->12 - - + + - - -13->14 - - + + +13->16 + + - + 14->1 - - + + 17 - -trim_fastqc_trim -read_type_trim: R1 + +trim_fastqc_trim +read_type_trim: R1 - + 14->17 - - + + 19 - -trim_fastqc_trim -read_type_trim: collapsed + +trim_fastqc_trim +read_type_trim: collapsed - + 14->19 - - + + 22 - -trim_fastqc_trim -read_type_trim: R2 + +trim_fastqc_trim +read_type_trim: singleton - + 14->22 - - + + - - -23 - -trim_fastqc_trim -read_type_trim: singleton + + +24 + +trim_fastqc_trim +read_type_trim: R2 - - -14->23 - - + + +14->24 + + - - -30 - -trim_fastqc_trim -read_type_trim: collapsedtrunc + + +28 + +trim_fastqc_trim +read_type_trim: collapsedtrunc - - -14->30 - - + + +14->28 + + - - -35 - -derep_merge_lanes -read_type_trim: collapsed + + +33 + +derep_merge_lanes +read_type_trim: collapsed - - -14->35 - - + + +14->33 + + - + 15->1 - - - - - -20 - -trim_fastqc_trim -read_type_trim: singleton - - - -15->20 - - + + - - -21 - -trim_fastqc_trim -read_type_trim: collapsedtrunc + + +18 + +trim_fastqc_trim +read_type_trim: singleton - - -15->21 - - + + +15->18 + + 25 - -trim_fastqc_trim -read_type_trim: R2 + +trim_fastqc_trim +read_type_trim: collapsed - + 15->25 - - + + + + + +26 + +trim_fastqc_trim +read_type_trim: R2 + + + +15->26 + + 27 - -trim_fastqc_trim -read_type_trim: collapsed + +trim_fastqc_trim +read_type_trim: collapsedtrunc - + 15->27 - - + + - - -29 - -trim_fastqc_trim -read_type_trim: R1 + + +30 + +trim_fastqc_trim +read_type_trim: R1 - - -15->29 - - + + +15->30 + + - - -33 - -derep_merge_lanes -read_type_trim: collapsed + + +35 + +derep_merge_lanes +read_type_trim: collapsed - - -15->33 - - + + +15->35 + + - + 16->1 - - + + - - -18 - -trim_fastqc_trim -read_type_trim: singleton + + +20 + +trim_fastqc_trim +read_type_trim: singleton - - -16->18 - - + + +16->20 + + - - -24 - -trim_fastqc_trim -read_type_trim: R2 + + +21 + +trim_fastqc_trim +read_type_trim: collapsed - - -16->24 - - + + +16->21 + + - - -26 - -trim_fastqc_trim -read_type_trim: collapsed + + +23 + +trim_fastqc_trim +read_type_trim: R2 - - -16->26 - - + + +16->23 + + - - -28 - -trim_fastqc_trim -read_type_trim: collapsedtrunc + + +29 + +trim_fastqc_trim +read_type_trim: collapsedtrunc - - -16->28 - - + + +16->29 + + 31 - -trim_fastqc_trim -read_type_trim: R1 + +trim_fastqc_trim +read_type_trim: R1 - + 16->31 - - + + - - -16->33 - - + + +16->35 + + - + 17->1 - - + + - + 18->1 - - + + - + 19->1 - - + + - + 20->1 - - + + - + 21->1 - - + + - + 22->1 - - + + - + 23->1 - - + + - + 24->1 - - + + - + 25->1 - - + + - + 26->1 - - + + - + 27->1 - - + + - + 28->1 - - + + - + 29->1 - - + + - + 30->1 - - + + - + 31->1 - - + + 32 - -derep_fastqc -tool: merge_lanes + +derep_fastqc +tool: merge_lanes - + 32->1 - - + + - + 33->32 - - + + - - -39 - -derep_nonpareil_infer -tool: merge_lanes + + +37 + +derep_nonpareil_infer +tool: merge_lanes - - -33->39 - - + + +33->37 + + - - -43 - -derep_seqkit + + +41 + +derep_seqkit - - -33->43 - - + + +33->41 + + 34 - -derep_fastqc -tool: merge_lanes + +derep_fastqc +tool: merge_lanes - + 34->1 - - + + - + 35->34 - - + + - - -37 - -derep_nonpareil_infer -tool: merge_lanes + + +39 + +derep_nonpareil_infer +tool: merge_lanes - - -35->37 - - + + +35->39 + + - - -41 - -derep_seqkit + + +43 + +derep_seqkit - - -35->41 - - + + +35->43 + + 36 - -derep_nonpareil_plot + +derep_nonpareil_plot - + 36->1 - - + + - + 37->36 - - + + 38 - -derep_nonpareil_plot + +derep_nonpareil_plot - + 38->1 - - + + - + 39->38 - - + + 40 - -derep_fastqc -tool: derep + +derep_fastqc +tool: derep - + 40->1 - - + + - + 41->40 - - + + 45 - -derep_low_complexity + +derep_low_complexity - + 41->45 - - + + 42 - -derep_fastqc -tool: derep + +derep_fastqc +tool: derep - + 42->1 - - + + - + 43->42 - - + + 47 - -derep_low_complexity + +derep_low_complexity - + 43->47 - - + + 44 - -derep_fastqc -tool: low_complexity + +derep_fastqc +tool: low_complexity - + 44->1 - - + + - + 45->44 - - - - - -73 - -prefilter_reads_extract - - - -45->73 - - + + - - -80 - -taxon_prefilter_shard_dragen - - - -45->80 - - - - - -81 - -taxon_prefilter_shard_dragen_csv -n_shard: 1 -read_type_map: collapsed -ref: hires_organelles_viruses_smags -tot_shards: 2 - - - -45->81 - - - - - -84 - -taxon_prefilter_shard_dragen - - - -45->84 - - - - - -85 - -taxon_prefilter_shard_dragen_csv -n_shard: 1 -read_type_map: collapsed -ref: human_genome -tot_shards: 1 - - - -45->85 - - - - - -87 - -taxon_prefilter_shard_dragen - - - -45->87 - - - - - -88 - -taxon_prefilter_shard_dragen_csv -n_shard: 2 -read_type_map: collapsed -ref: hires_organelles_viruses_smags -tot_shards: 2 - - - -45->88 - - - - - -104 - -taxon_shard_dragen + + +49 + +taxon_shard_dragen +n_shard: 2 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +45->49 + + - - -45->104 - - + + +50 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: hires_organelles_viruses_smags +tot_shards: 2 + + + +45->50 + + - - -106 - -taxon_shard_dragen + + +52 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +45->52 + + - - -45->106 - - + + +53 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: refseq_mitoch +tot_shards: 1 + + + +45->53 + + - - -108 - -taxon_shard_dragen + + +54 + +taxon_shard_dragen +n_shard: 2 +read_type_map: collapsed +ref: hires_organelles_viruses_smags +tot_shards: 2 + + + +45->54 + + - - -45->108 - - + + +55 + +taxon_shard_dragen +n_shard: 3 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +45->55 + + - - -116 - -taxon_shard_dragen + + +60 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: human_genome +tot_shards: 1 + + + +45->60 + + - - -45->116 - - + + +61 + +taxon_shard_dragen +n_shard: 4 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +45->61 + + - - -120 - -taxon_shard_dragen + + +129 + +taxon_shard_saturated_reads_extract - - -45->120 - - - - - -177 - -taxon_prefilter_shard_saturated_reads_extract - - - -45->177 - - - - - -181 - -taxon_shard_saturated_reads_extract - - - -45->181 - - + + +45->129 + + 46 - -derep_fastqc -tool: low_complexity + +derep_fastqc +tool: low_complexity - + 46->1 - - + + - + 47->46 - - + + - - -49 - -prefilter_reads_extract + + +48 + +taxon_shard_dragen +n_shard: 2 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +47->48 + + - - -47->49 - - + + +51 + +taxon_shard_dragen +n_shard: 2 +read_type_map: collapsed +ref: hires_organelles_viruses_smags +tot_shards: 2 + + + +47->51 + + 56 - -taxon_prefilter_shard_dragen + +taxon_shard_dragen +n_shard: 3 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 - + 47->56 - - + + 57 - -taxon_prefilter_shard_dragen_csv -n_shard: 1 -read_type_map: collapsed -ref: hires_organelles_viruses_smags -tot_shards: 2 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: refseq_mitoch +tot_shards: 1 - + 47->57 - - + + - - -60 - -taxon_prefilter_shard_dragen + + +58 + +taxon_shard_dragen +n_shard: 4 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +47->58 + + - - -47->60 - - + + +59 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: human_genome +tot_shards: 1 + + + +47->59 + + - - -61 - -taxon_prefilter_shard_dragen_csv -n_shard: 1 -read_type_map: collapsed -ref: human_genome -tot_shards: 1 - - - -47->61 - - + + +62 + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: core_nt +tot_shards: 4 + + + +47->62 + + 63 - -taxon_prefilter_shard_dragen + +taxon_shard_dragen +n_shard: 1 +read_type_map: collapsed +ref: hires_organelles_viruses_smags +tot_shards: 2 - + 47->63 - - + + - - -64 - -taxon_prefilter_shard_dragen_csv -n_shard: 2 -read_type_map: collapsed -ref: hires_organelles_viruses_smags -tot_shards: 2 - - - -47->64 - - + + +128 + +taxon_shard_saturated_reads_extract - - -110 - -taxon_shard_dragen + + +47->128 + + - - -47->110 - - + + +48->1 + + - - -112 - -taxon_shard_dragen + + +67 + +taxon_shard_saturated_reads_remove - - -47->112 - - + + +48->67 + + - - -114 - -taxon_shard_dragen + + +76 + +taxon_shard_count_alns - - -47->114 - - + + +48->76 + + - - -118 - -taxon_shard_dragen + + +49->1 + + - - -47->118 - - + + +94 + +taxon_shard_saturated_reads_remove - - -122 - -taxon_shard_dragen + + +49->94 + + - - -47->122 - - - - - -176 - -taxon_prefilter_shard_saturated_reads_extract - - - -47->176 - - - - - -180 - -taxon_shard_saturated_reads_extract - - - -47->180 - - + + +103 + +taxon_shard_count_alns - - -48 - -prefilter_fastqc + + +49->103 + + - - -48->1 - - + + +50->1 + + - - -49->48 - - + + +100 + +taxon_shard_count_alns - - -111 - -taxon_shard_dragen_csv -n_shard: 2 -ref: core_nt -tot_shards: 4 + + +50->100 + + - - -49->111 - - + + +109 + +taxon_shard_saturated_reads_remove - - -113 - -taxon_shard_dragen_csv -n_shard: 1 -ref: core_nt -tot_shards: 4 + + +50->109 + + - - -49->113 - - + + +51->1 + + - - -115 - -taxon_shard_dragen_csv -n_shard: 4 -ref: core_nt -tot_shards: 4 + + +69 + +taxon_shard_count_alns - - -49->115 - - + + +51->69 + + - - -119 - -taxon_shard_dragen_csv -n_shard: 1 -ref: refseq_mitoch -tot_shards: 1 + + +90 + +taxon_shard_saturated_reads_remove - - -49->119 - - + + +51->90 + + - - -123 - -taxon_shard_dragen_csv -n_shard: 3 -ref: core_nt -tot_shards: 4 + + +52->1 + + - - -49->123 - - + + +99 + +taxon_shard_count_alns - - -50 - -prefilter_reads_merge + + +52->99 + + - - -50->49 - - + + +113 + +taxon_shard_saturated_reads_remove - - -51 - -prefilter_reads_taxonomy + + +52->113 + + - - -51->50 - - + + +53->1 + + - - -52 - -taxon_prefilter_align_merge + + +102 + +taxon_shard_count_alns - - -52->51 - - + + +53->102 + + + + + +111 + +taxon_shard_saturated_reads_remove + + + +53->111 + + + + + +54->1 + + 96 - -taxon_prefilter_align_stats + +taxon_shard_count_alns - - -52->96 - - + + +54->96 + + - - -99 - -taxon_prefilter_metadmg_lca + + +117 + +taxon_shard_saturated_reads_remove - - -52->99 - - + + +54->117 + + - - -178 - -taxon_prefilter_metadmg_damage + + +55->1 + + - - -52->178 - - + + +97 + +taxon_shard_count_alns - - -53 - -taxon_prefilter_shard_sort_query + + +55->97 + + - - -53->52 - - + + +115 + +taxon_shard_saturated_reads_remove - - -54 - -taxon_prefilter_shard_unicorn + + +55->115 + + - - -54->53 - - + + +56->1 + + - - -55 - -taxon_prefilter_shard_saturated_reads_remove + + +70 + +taxon_shard_count_alns - - -55->54 - - + + +56->70 + + - - -56->1 - - + + +88 + +taxon_shard_saturated_reads_remove - - -56->55 - - + + +56->88 + + - - -65 - -taxon_prefilter_shard_count_alns + + +57->1 + + - - -56->65 - - + + +75 + +taxon_shard_count_alns - - -57->56 - - + + +57->75 + + - - -58 - -taxon_prefilter_shard_saturated_reads_filter + + +84 + +taxon_shard_saturated_reads_remove + + + +57->84 + + + + + +58->1 + + - - -58->50 - - + + +74 + +taxon_shard_count_alns - - -58->55 - - + + +58->74 + + - - -68 - -taxon_prefilter_shard_saturated_reads_remove + + +80 + +taxon_shard_saturated_reads_remove - - -58->68 - - + + +58->80 + + + + + +59->1 + + 71 - -taxon_prefilter_shard_saturated_reads_remove + +taxon_shard_count_alns - - -58->71 - - - - - -58->176 - - + + +59->71 + + - - -59 - -taxon_prefilter_shard_count_alns + + +78 + +taxon_shard_saturated_reads_remove - - -59->58 - - + + +59->78 + + - + 60->1 - - + + - - -60->59 - - + + +98 + +taxon_shard_count_alns - - -60->68 - - + + +60->98 + + - - -61->60 - - + + +105 + +taxon_shard_saturated_reads_remove - - -62 - -taxon_prefilter_shard_count_alns + + +60->105 + + - - -62->58 - - + + +61->1 + + - - -63->1 - - + + +101 + +taxon_shard_count_alns - - -63->62 - - + + +61->101 + + - - -63->71 - - + + +107 + +taxon_shard_saturated_reads_remove - - -64->63 - - + + +61->107 + + - - -65->58 - - + + +62->1 + + - - -66 - -taxon_prefilter_shard_sort_query + + +72 + +taxon_shard_count_alns - - -66->52 - - + + +62->72 + + - - -67 - -taxon_prefilter_shard_unicorn + + +86 + +taxon_shard_saturated_reads_remove - + + +62->86 + + + + + +63->1 + + + + + +73 + +taxon_shard_count_alns + + -67->66 - - +63->73 + + - - -68->67 - - + + +82 + +taxon_shard_saturated_reads_remove - - -69 - -taxon_prefilter_shard_sort_query + + +63->82 + + - - -69->52 - - + + +64 + +taxon_align_samtools_stats - - -70 - -taxon_prefilter_shard_unicorn + + +64->1 + + - - -70->69 - - + + +65 + +taxon_align_merge - - -71->70 - - + + +65->64 + + - - -72 - -prefilter_fastqc + + +119 + +taxon_align_sort_taxon - - -72->1 - - + + +65->119 + + - - -73->72 - - + + +123 + +taxon_metadmg_lca - - -105 - -taxon_shard_dragen_csv -n_shard: 4 -ref: core_nt -tot_shards: 4 + + +65->123 + + - - -73->105 - - + + +130 + +taxon_metadmg_damage - - -107 - -taxon_shard_dragen_csv -n_shard: 3 -ref: core_nt -tot_shards: 4 + + +65->130 + + - - -73->107 - - + + +66 + +taxon_shard_unicorn_refstats - - -109 - -taxon_shard_dragen_csv -n_shard: 2 -ref: core_nt -tot_shards: 4 + + +66->65 + + - - -73->109 - - + + +67->66 + + - - -117 - -taxon_shard_dragen_csv -n_shard: 1 -ref: core_nt -tot_shards: 4 + + +68 + +taxon_shard_saturated_reads_filter - - -73->117 - - + + +68->67 + + - - -121 - -taxon_shard_dragen_csv -n_shard: 1 -ref: refseq_mitoch -tot_shards: 1 + + +68->78 + + - - -73->121 - - + + +68->80 + + - - -74 - -prefilter_reads_merge + + +68->82 + + - - -74->73 - - + + +68->84 + + - - -75 - -prefilter_reads_taxonomy + + +68->86 + + - - -75->74 - - + + +68->88 + + - - -76 - -taxon_prefilter_align_merge + + +68->90 + + - - -76->75 - - + + +68->128 + + - - -97 - -taxon_prefilter_align_stats + + +69->68 + + - - -76->97 - - + + +70->68 + + - - -101 - -taxon_prefilter_metadmg_lca + + +71->68 + + - - -76->101 - - - - - -179 - -taxon_prefilter_metadmg_damage - - - -76->179 - - + + +72->68 + + + + + +73->68 + + + + + +74->68 + + + + + +75->68 + + + + + +76->68 + + 77 - -taxon_prefilter_shard_sort_query - - - -77->76 - - + +taxon_shard_unicorn_refstats - - -78 - -taxon_prefilter_shard_unicorn + + +77->65 + + - + 78->77 - - + + 79 - -taxon_prefilter_shard_saturated_reads_remove - - - -79->78 - - + +taxon_shard_unicorn_refstats - - -80->1 - - + + +79->65 + + - + 80->79 - - - - - -89 - -taxon_prefilter_shard_count_alns - - - -80->89 - - - - - -81->80 - - - - - -82 - -taxon_prefilter_shard_saturated_reads_filter - - - -82->74 - - - - - -82->79 - - - - - -92 - -taxon_prefilter_shard_saturated_reads_remove - - - -82->92 - - + + - - -95 - -taxon_prefilter_shard_saturated_reads_remove + + +81 + +taxon_shard_unicorn_refstats - - -82->95 - - + + +81->65 + + - - -82->177 - - + + +82->81 + + 83 - -taxon_prefilter_shard_count_alns - - - -83->82 - - + +taxon_shard_unicorn_refstats - - -84->1 - - + + +83->65 + + - + 84->83 - - - - - -84->92 - - - - - -85->84 - - + + - - -86 - -taxon_prefilter_shard_count_alns + + +85 + +taxon_shard_unicorn_refstats - - -86->82 - - + + +85->65 + + - - -87->1 - - + + +86->85 + + - - -87->86 - - + + +87 + +taxon_shard_unicorn_refstats - - -87->95 - - + + +87->65 + + - + 88->87 - - + + - - -89->82 - - + + +89 + +taxon_shard_unicorn_refstats - - -90 - -taxon_prefilter_shard_sort_query + + +89->65 + + - - -90->76 - - + + +90->89 + + 91 - -taxon_prefilter_shard_unicorn + +taxon_align_samtools_stats - - -91->90 - - + + +91->1 + + + + + +92 + +taxon_align_merge - + 92->91 - - + + + + + +121 + +taxon_align_sort_taxon + + + +92->121 + + + + + +125 + +taxon_metadmg_lca + + + +92->125 + + + + + +131 + +taxon_metadmg_damage + + + +92->131 + + 93 - -taxon_prefilter_shard_sort_query - - - -93->76 - - + +taxon_shard_unicorn_refstats - - -94 - -taxon_prefilter_shard_unicorn + + +93->92 + + - + 94->93 - - + + + + + +95 + +taxon_shard_saturated_reads_filter - + 95->94 - - + + - - -96->1 - - - - - -97->1 - - + + +95->105 + + - - -98 - -taxon_prefilter_metadmg_dfit + + +95->107 + + - - -98->1 - - + + +95->109 + + - - -102 - -taxon_prefilter_metadmg_aggregate + + +95->111 + + - - -98->102 - - + + +95->113 + + - - -99->98 - - + + +95->115 + + - - -99->102 - - + + +95->117 + + - - -100 - -taxon_prefilter_metadmg_dfit + + +95->129 + + - - -100->1 - - + + +96->95 + + - - -103 - -taxon_prefilter_metadmg_aggregate + + +97->95 + + - - -100->103 - - + + +98->95 + + - - -101->100 - - + + +99->95 + + - - -101->103 - - + + +100->95 + + - - -102->0 - - + + +101->95 + + - - -102->1 - - + + +102->95 + + - - -103->0 - - + + +103->95 + + - - -103->1 - - + + +104 + +taxon_shard_unicorn_refstats - - -104->1 - - - - - -153 - -taxon_shard_count_alns - - - -104->153 - - - - - -169 - -taxon_shard_saturated_reads_remove - - - -104->169 - - + + +104->92 + + - + 105->104 - - + + - - -106->1 - - - - - -155 - -taxon_shard_count_alns - - - -106->155 - - - - - -166 - -taxon_shard_saturated_reads_remove - - - -106->166 - - + + +106 + +taxon_shard_unicorn_refstats + + + +106->92 + + - + 107->106 - - + + - - -108->1 - - - - - -157 - -taxon_shard_count_alns - - - -108->157 - - - - - -160 - -taxon_shard_saturated_reads_remove - - - -108->160 - - + + +108 + +taxon_shard_unicorn_refstats + + + +108->92 + + - + 109->108 - - + + - - -110->1 - - - - - -134 - -taxon_shard_count_alns - - - -110->134 - - - - - -137 - -taxon_shard_saturated_reads_remove - - - -110->137 - - + + +110 + +taxon_shard_unicorn_refstats + + + +110->92 + + - + 111->110 - - + + - - -112->1 - - + + +112 + +taxon_shard_unicorn_refstats - - -131 - -taxon_shard_count_alns - - - -112->131 - - - - - -140 - -taxon_shard_saturated_reads_remove - - - -112->140 - - + + +112->92 + + - + 113->112 - - + + - - -114->1 - - + + +114 + +taxon_shard_unicorn_refstats - - -130 - -taxon_shard_count_alns - - - -114->130 - - - - - -146 - -taxon_shard_saturated_reads_remove - - - -114->146 - - + + +114->92 + + - + 115->114 - - + + - - -116->1 - - - - - -154 - -taxon_shard_count_alns - - - -116->154 - - - - - -163 - -taxon_shard_saturated_reads_remove - - - -116->163 - - + + +116 + +taxon_shard_unicorn_refstats + + + +116->92 + + - + 117->116 - - + + + + + +118 + +taxon_align_unicorn_taxstats - + 118->1 - - - - - -128 - -taxon_shard_saturated_reads_remove - - - -118->128 - - - - - -133 - -taxon_shard_count_alns - - - -118->133 - - + + - + 119->118 - - + + + + + +120 + +taxon_align_unicorn_taxstats - + 120->1 - - - - - -151 - -taxon_shard_saturated_reads_remove - - - -120->151 - - - - - -156 - -taxon_shard_count_alns - - - -120->156 - - + + - + 121->120 - - + + + + + +122 + +taxon_metadmg_dfit - + 122->1 - - - - - -132 - -taxon_shard_count_alns - - - -122->132 - - - - - -143 - -taxon_shard_saturated_reads_remove - - - -122->143 - - + + + + + +126 + +taxon_metadmg_aggregate + + + +122->126 + + - + 123->122 - - + + + + + +123->126 + + 124 - -taxon_align_stats + +taxon_metadmg_dfit - + 124->1 - - - - - -125 - -taxon_align_merge - - - -125->124 - - - - - -171 - -taxon_metadmg_lca - - - -125->171 - - - - - -182 - -taxon_metadmg_damage - - - -125->182 - - - - - -126 - -taxon_shard_sort_query - - - -126->125 - - + + 127 - -taxon_shard_unicorn + +taxon_metadmg_aggregate - - -127->126 - - + + +124->127 + + - - -128->127 - - + + +125->124 + + - - -129 - -taxon_shard_saturated_reads_filter - - - -129->128 - - - - - -129->137 - - - - - -129->140 - - - - - -129->143 - - - - - -129->146 - - - - - -129->180 - - - - - -130->129 - - - - - -131->129 - - - - - -132->129 - - - - - -133->129 - - - - - -134->129 - - - - - -135 - -taxon_shard_sort_query - - - -135->125 - - - - - -136 - -taxon_shard_unicorn - - - -136->135 - - - - - -137->136 - - - - - -138 - -taxon_shard_sort_query - - - -138->125 - - - - - -139 - -taxon_shard_unicorn - - - -139->138 - - - - - -140->139 - - - - - -141 - -taxon_shard_sort_query - - - -141->125 - - - - - -142 - -taxon_shard_unicorn - - - -142->141 - - - - - -143->142 - - - - - -144 - -taxon_shard_sort_query - - - -144->125 - - - - - -145 - -taxon_shard_unicorn - - - -145->144 - - - - - -146->145 - - - - - -147 - -taxon_align_stats - - - -147->1 - - - - - -148 - -taxon_align_merge - - - -148->147 - - - - - -173 - -taxon_metadmg_lca - - - -148->173 - - - - - -183 - -taxon_metadmg_damage - - - -148->183 - - - - - -149 - -taxon_shard_sort_query - - - -149->148 - - - - - -150 - -taxon_shard_unicorn - - - -150->149 - - - - - -151->150 - - - - - -152 - -taxon_shard_saturated_reads_filter - - - -152->151 - - - - - -152->160 - - - - - -152->163 - - - - - -152->166 - - - - - -152->169 - - - - - -152->181 - - - - - -153->152 - - - - - -154->152 - - - - - -155->152 - - - - - -156->152 - - - - - -157->152 - - - - - -158 - -taxon_shard_sort_query - - - -158->148 - - - - - -159 - -taxon_shard_unicorn - - - -159->158 - - - - - -160->159 - - - - - -161 - -taxon_shard_sort_query - - - -161->148 - - - - - -162 - -taxon_shard_unicorn - - - -162->161 - - - - - -163->162 - - - - - -164 - -taxon_shard_sort_query - - - -164->148 - - - - - -165 - -taxon_shard_unicorn - - - -165->164 - - - - - -166->165 - - - - - -167 - -taxon_shard_sort_query - - - -167->148 - - - - - -168 - -taxon_shard_unicorn - - - -168->167 - - - - - -169->168 - - - - - -170 - -taxon_metadmg_dfit - - - -170->1 - - - - - -174 - -taxon_metadmg_aggregate - - - -170->174 - - - - - -171->170 - - - - - -171->174 - - - - - -172 - -taxon_metadmg_dfit - - - -172->1 - - - - - -175 - -taxon_metadmg_aggregate - - - -172->175 - - - - - -173->172 - - - - - -173->175 - - - - - -174->0 - - + + +125->127 + + - - -174->1 - - + + +126->0 + + - - -175->0 - - + + +126->1 + + - - -175->1 - - + + +127->0 + + + + + +127->1 + + - + -176->0 - - +128->0 + + - + -177->0 - - +129->0 + + - + -178->0 - - +130->0 + + - + -179->0 - - - - - -180->0 - - - - - -181->0 - - - - - -182->0 - - - - - -183->0 - - +131->0 + + diff --git a/examples/dragen/filegraph.svg b/examples/dragen/filegraph.svg index 990f9ca..c168ee5 100644 --- a/examples/dragen/filegraph.svg +++ b/examples/dragen/filegraph.svg @@ -1,1346 +1,842 @@ - - - + + snakemake_dag - + 0 -target_taxon - -↪ input - -reports/multiqc.taxon.html -reports/multiqc_data.taxon.zip -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/prefilter_reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/prefilter_reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/prefilter_reads/saturated/Lib_LVsim2_collapsed.fastq.gz -results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/reads/saturated/Lib_LVsim2_collapsed.fastq.gz -stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/metadmg/damage/Lib_LVsim2_collapsed.stat.gz -stats/prefilter_metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/prefilter_metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/prefilter_metadmg/damage/Lib_LVsim2_collapsed.stat.gz -   - - - +multiqc_taxon_upload + +↪ input + +reports/multiqc.taxon.html +reports/multiqc_data.taxon.zip +reports/multiqc_data.taxon.zip +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz +results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz +results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz +results/reads/saturated/Lib_LVsim2_collapsed.fastq.gz +stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz +stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz +stats/metadmg/damage/Lib_LVsim2_collapsed.stat.gz + +output → + +stats/reports/multiqc_taxon.upload.flag + + + 1 -multiqc_taxon - -↪ input - -/maps/projects/caeg/people/lnc113/workflows/aeDNA/aeDNA/workflow/resources/multiqc_config.yaml -logs/prefilter_shards/dragen/Lib_LVsim1_collapsed.hires_organelles_viruses_smags.1-of-2.log -logs/prefilter_shards/dragen/Lib_LVsim1_collapsed.hires_organelles_viruses_smags.2-of-2.log -logs/prefilter_shards/dragen/Lib_LVsim1_collapsed.human_genome.1-of-1.log -logs/prefilter_shards/dragen/Lib_LVsim2_collapsed.hires_organelles_viruses_smags.1-of-2.log -logs/prefilter_shards/dragen/Lib_LVsim2_collapsed.hires_organelles_viruses_smags.2-of-2.log -logs/prefilter_shards/dragen/Lib_LVsim2_collapsed.human_genome.1-of-1.log -logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.1-of-4.log -logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.2-of-4.log -logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.3-of-4.log -logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.4-of-4.log -logs/shards/dragen/Lib_LVsim1_collapsed.refseq_mitoch.1-of-1.log -logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.1-of-4.log -logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.2-of-4.log -logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.3-of-4.log -logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.4-of-4.log -logs/shards/dragen/Lib_LVsim2_collapsed.refseq_mitoch.1-of-1.log -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/prefilter_metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/prefilter_metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/prefilter_metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz -stats/aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools_stats/Lib_LVsim2_collapsed.txt -stats/aligns/samtools_stats/Lib_LVsim2_collapsed.txt -stats/prefilter_aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools_stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools_stats/Lib_LVsim2_collapsed.txt -stats/prefilter_aligns/samtools_stats/Lib_LVsim2_collapsed.txt -stats/reads/fastqc/derep/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/derep/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/low_complexity/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/low_complexity/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/merge_lanes/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/merge_lanes/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/prefilter/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/prefilter/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/prefilter/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L001_R1.html -stats/reads/fastqc/raw/Lib_LVsim1_L001_R1_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L001_R2.html -stats/reads/fastqc/raw/Lib_LVsim1_L001_R2_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L002_R1.html -stats/reads/fastqc/raw/Lib_LVsim1_L002_R1_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L002_R2.html -stats/reads/fastqc/raw/Lib_LVsim1_L002_R2_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim2_L001_R1.html -stats/reads/fastqc/raw/Lib_LVsim2_L001_R1_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim2_L001_R2.html -stats/reads/fastqc/raw/Lib_LVsim2_L001_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_R1.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_R1_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_R2.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_R1.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_R1_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_R2.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_R1.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_R1_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_R2.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton_fastqc.zip -stats/reads/nonpareil/merge_lanes/Lib_LVsim1_collapsed.json -stats/reads/nonpareil/merge_lanes/Lib_LVsim2_collapsed.json -stats/reads/trim/Lib_LVsim1_L001_pe.settings -stats/reads/trim/Lib_LVsim1_L002_pe.settings -stats/reads/trim/Lib_LVsim2_L001_pe.settings - -output → - -reports/multiqc.taxon.html -reports/multiqc_data.taxon.zip - - - +multiqc_taxon + +↪ input + +/maps/projects/caeg/people/lnc113/workflows/aeDNA/aeDNA/workflow/resources/multiqc_config.yaml +logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.1-of-4.log +logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.2-of-4.log +logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.3-of-4.log +logs/shards/dragen/Lib_LVsim1_collapsed.core_nt.4-of-4.log +logs/shards/dragen/Lib_LVsim1_collapsed.hires_organelles_viruses_smags.1-of-2.log +logs/shards/dragen/Lib_LVsim1_collapsed.hires_organelles_viruses_smags.2-of-2.log +logs/shards/dragen/Lib_LVsim1_collapsed.human_genome.1-of-1.log +logs/shards/dragen/Lib_LVsim1_collapsed.refseq_mitoch.1-of-1.log +logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.1-of-4.log +logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.2-of-4.log +logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.3-of-4.log +logs/shards/dragen/Lib_LVsim2_collapsed.core_nt.4-of-4.log +logs/shards/dragen/Lib_LVsim2_collapsed.hires_organelles_viruses_smags.1-of-2.log +logs/shards/dragen/Lib_LVsim2_collapsed.hires_organelles_viruses_smags.2-of-2.log +logs/shards/dragen/Lib_LVsim2_collapsed.human_genome.1-of-1.log +logs/shards/dragen/Lib_LVsim2_collapsed.refseq_mitoch.1-of-1.log +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz +results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz +results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz +results/metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv +stats/aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv +stats/aligns/unicorn/taxstats/Lib_LVsim2_collapsed.tsv +stats/reads/fastqc/derep/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/derep/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/low_complexity/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/low_complexity/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/merge_lanes/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/merge_lanes/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L001_R1.html +stats/reads/fastqc/raw/Lib_LVsim1_L001_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L001_R2.html +stats/reads/fastqc/raw/Lib_LVsim1_L001_R2_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L002_R1.html +stats/reads/fastqc/raw/Lib_LVsim1_L002_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L002_R2.html +stats/reads/fastqc/raw/Lib_LVsim1_L002_R2_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim2_L001_R1.html +stats/reads/fastqc/raw/Lib_LVsim2_L001_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim2_L001_R2.html +stats/reads/fastqc/raw/Lib_LVsim2_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_R1.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_R2.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_R1.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_R2.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_R1.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_R2.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton_fastqc.zip +stats/reads/nonpareil/merge_lanes/Lib_LVsim1_collapsed.json +stats/reads/nonpareil/merge_lanes/Lib_LVsim2_collapsed.json +stats/reads/trim/Lib_LVsim1_L001_pe.settings +stats/reads/trim/Lib_LVsim1_L002_pe.settings +stats/reads/trim/Lib_LVsim2_L001_pe.settings + +output → + +reports/multiqc.taxon.html +reports/multiqc_data.taxon.zip + + + - + 1->0 - - + + 2 -trim_fastqc_raw - -↪ input - -results/reads/raw/{sample}_{library}_{lane}_{read_type_raw}.fastq.gz - -output → - -stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.html -stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}_fastqc.zip - - - +trim_fastqc_raw + +↪ input + +results/reads/raw/{sample}_{library}_{lane}_{read_type_raw}.fastq.gz + +output → + +stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R1|R2}.html +stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R1|R2}_fastqc.zip + + + - + 2->1 - - + + 3 -trim_get_fastq_raw - -↪ input - -<input function> - -output → - -results/reads/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.fastq.gz - - - +trim_get_fastq_raw + +↪ input + +<input function> + +output → + +results/reads/raw/{sample}_{library}_{lane}_{read_type_raw,R1|R2}.fastq.gz + + + - + 3->2 - - + + 4 -trim_adapterremoval_fastq_pe - -↪ input - -<input function> - -output → - -results/reads/trim/{sample}_{library}_{lane}_R1.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_R2.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_collapsed.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_collapsedtrunc.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_discarded.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_singleton.fastq.gz -stats/reads/trim/{sample}_{library}_{lane}_pe.settings - - - +trim_adapterremoval_fastq_pe + +↪ input + +<input function> + +output → + +results/reads/trim/{sample}_{library}_{lane}_R1.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_R2.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_collapsed.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_collapsedtrunc.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_discarded.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_singleton.fastq.gz +stats/reads/trim/{sample}_{library}_{lane}_pe.settings + + + - + 3->4 - - + + - + 4->1 - - + + 5 -trim_fastqc_trim - -↪ input - -results/reads/trim/{sample}_{library}_{lane}_{read_type_trim}.fastq.gz - -output → - -stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,R1|singleton|collapsedtrunc|R2|collapsed}.html -stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,R1|singleton|collapsedtrunc|R2|collapsed}_fastqc.zip - - - +trim_fastqc_trim + +↪ input + +results/reads/trim/{sample}_{library}_{lane}_{read_type_trim}.fastq.gz + +output → + +stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,R1|collapsedtrunc|collapsed|singleton|R2}.html +stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,R1|collapsedtrunc|collapsed|singleton|R2}_fastqc.zip + + + - + 4->5 - - + + 7 -derep_merge_lanes - -↪ input - -<input function> - -output → - -temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz - - - +derep_merge_lanes + +↪ input + +<input function> + +output → + +temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz + + + - + 4->7 - - + + - + 5->1 - - + + 6 -derep_fastqc - -↪ input - -<input function> - -output → - -stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}.html -stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}_fastqc.zip - - - +derep_fastqc + +↪ input + +<input function> + +output → + +stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}.html +stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}_fastqc.zip + + + 6->1 - - + + - + 7->6 - - + + 9 -derep_nonpareil_infer - -↪ input - -<input function> - -output → - -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.log -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npa -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npc -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo - - - +derep_nonpareil_infer + +↪ input + +<input function> + +output → + +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.log +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npa +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npc +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo + + + - + 7->9 - - + + 10 -derep_seqkit - -↪ input - -temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz - -output → - -stats/reads/derep/{sample}_{library}_{read_type_trim}.dup.tsv -temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz - - - +derep_seqkit + +↪ input + +temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz + +output → + +stats/reads/derep/{sample}_{library}_{read_type_trim}.dup.tsv +temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz + + + - + 7->10 - - + + 8 -derep_nonpareil_plot - -↪ input - -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo - -output → - -reports/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.pdf -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.json -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.tsv - - - +derep_nonpareil_plot + +↪ input + +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo + +output → + +reports/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.pdf +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.json +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.tsv + + + - + 8->1 - - + + - + 9->8 - - + + - + 10->6 - - + + 11 -derep_low_complexity - -↪ input - -temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz - -output → - -results/reads/low_complexity/{sample}_{library}_{read_type_trim}.fastq.gz -stats/reads/low_complexity/{sample}_{library}_{read_type_trim}.txt -temp/reads/low_complexity/{sample}_{library}_{read_type_trim}.discarded.fastq.gz - - - +derep_low_complexity + +↪ input + +temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz + +output → + +results/reads/low_complexity/{sample}_{library}_{read_type_trim}.fastq.gz +stats/reads/low_complexity/{sample}_{library}_{read_type_trim}.txt +temp/reads/low_complexity/{sample}_{library}_{read_type_trim}.discarded.fastq.gz + + + - + 10->11 - - + + - + 11->6 - - - - - -13 -prefilter_reads_extract - -↪ input - -<input function> -temp/reads/prefilter/merge/{sample}_{library}_{read_type_map}.read_ids - -output → - -results/reads/prefilter/extract/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.fastq.gz - - - - - - -11->13 - - - - - -20 -taxon_prefilter_shard_dragen - -↪ input - -<input function> -temp/prefilter_shards/dragen/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.csv - -output → - -temp/prefilter_shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -11->20 - - - - - -21 -taxon_prefilter_shard_dragen_csv - -↪ input - -<input function> - -output → - -temp/prefilter_shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.csv - - - - - - -11->21 - - - - - -28 -taxon_shard_dragen - -↪ input - -<input function> -temp/shards/dragen/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.csv - -output → - -temp/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -11->28 - - - - - -40 -taxon_prefilter_shard_saturated_reads_extract - -↪ input - -<input function> -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -results/prefilter_reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz - - - - - - -11->40 - - - - - -42 -taxon_shard_saturated_reads_extract - -↪ input - -<input function> -temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -results/reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz - - - - - - -11->42 - - + + 12 -prefilter_fastqc - -↪ input - -results/reads/prefilter/extract/{sample}_{library}_{read_type_map}.fastq.gz - -output → - -stats/reads/fastqc/prefilter/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.html -stats/reads/fastqc/prefilter/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}_fastqc.zip - - - +taxon_shard_dragen + +↪ input + +<input function> + +output → + +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.fastqc.csv +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.json +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.map.csv +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.ploidy.csv +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.replay.json +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.time.csv +stats/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.trim.csv +temp/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam +temp/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam.md5sum + + + + + + +11->12 + + + + + +24 +taxon_shard_saturated_reads_extract + +↪ input + +<input function> +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv + +output → + +results/reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz + + + + + + +11->24 + + - + 12->1 - - + + - + + +16 +taxon_shard_saturated_reads_remove + +↪ input + +<input function> +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv + +output → + +temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +12->16 + + + + + +18 +taxon_shard_count_alns + +↪ input + +<input function> + +output → + +temp/shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv + + + + + -13->12 - - - - - -29 -taxon_shard_dragen_csv - -↪ input - -<input function> - -output → - -temp/shards/dragen/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.csv - - - - - - -13->29 - - +12->18 + + + + + +13 +taxon_align_samtools_stats + +↪ input + +results/aligns/merge/{sample}_{library}_{read_type_map}.bam + +output → + +stats/aligns/samtools/stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt + + + + + + +13->1 + + 14 -prefilter_reads_merge - -↪ input - -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv -temp/reads/prefilter/taxonomy/{sample}_{library}_{read_type_map}.read_ids - -output → - -temp/reads/prefilter/merge/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.read_ids - - - +taxon_align_merge + +↪ input + +<input function> + +output → + +results/aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam + + + - + 14->13 - - + + + + + +20 +taxon_align_sort_taxon + +↪ input + +results/aligns/merge/{sample}_{library}_{read_type_map}.bam + +output → + +temp/aligns/sort_taxon/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam + + + + + + +14->20 + + + + + +22 +taxon_metadmg_lca + +↪ input + +<function <lambda> at 0x7f7cc7f07950> +data/core_nt.acc2taxid.gz +data/human.acc2taxid.gz +data/mitoch.acc2taxid.gz +data/prok.acc2taxid.gz +data/taxdump/names.dmp +data/taxdump/nodes.dmp + +output → + +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.family.bam +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.used.bam +stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz +stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +14->22 + + + + + +25 +taxon_metadmg_damage + +↪ input + +<function <lambda> at 0x7f7cc7f077f0> + +output → + +results/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz +stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz +stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +14->25 + + 15 -prefilter_reads_taxonomy - -↪ input - -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/names.dmp -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/nodes.dmp -data/human.acc2taxid.gz -data/prok.acc2taxid.gz -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -temp/reads/prefilter/taxonomy/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.read_ids - - - +taxon_shard_unicorn_refstats + +↪ input + +<input function> +data/taxdump/names.dmp +data/taxdump/nodes.dmp +temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam + +output → + +stats/shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv +temp/shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + - + 15->14 - - - - - -16 -taxon_prefilter_align_merge - -↪ input - -<input function> - -output → - -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam - - - + + - + 16->15 - - - - - -24 -taxon_prefilter_align_stats - -↪ input - -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -stats/prefilter_aligns/samtools_stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt - - - - - - -16->24 - - - - - -26 -taxon_prefilter_metadmg_lca - -↪ input - -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/names.dmp -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/nodes.dmp -<function <lambda> at 0x7fef3af5f060> -data/human.acc2taxid.gz -data/prok.acc2taxid.gz - -output → - -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz -stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -16->26 - - - - - -41 -taxon_prefilter_metadmg_damage - -↪ input - -<function <lambda> at 0x7fef3af5f1a0> - -output → - -results/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -results/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.res.gz -stats/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -16->41 - - + + 17 -taxon_prefilter_shard_sort_query - -↪ input - -temp/prefilter_shards/unicorn/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam - -output → - -temp/prefilter_shards/sort_query/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - +taxon_shard_saturated_reads_filter + +↪ input + +temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.1-of-4.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.2-of-4.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.3-of-4.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.4-of-4.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.hires_organelles_viruses_smags.1-of-2.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.hires_organelles_viruses_smags.2-of-2.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.human_genome.1-of-1.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.refseq_mitoch.1-of-1.tsv + +output → + +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv + + + - + 17->16 - - + + - - -18 -taxon_prefilter_shard_unicorn - -↪ input - -temp/prefilter_shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam - -output → - -stats/prefilter_shards/unicorn/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv -temp/prefilter_shards/unicorn/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - + + +17->24 + + - + 18->17 - - + + 19 -taxon_prefilter_shard_saturated_reads_remove - -↪ input - -<input function> -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -temp/prefilter_shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -19->18 - - - - - -20->1 - - +taxon_align_unicorn_taxstats + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +temp/aligns/sort_taxon/{sample}_{library}_{read_type_map}.bam + +output → + +stats/aligns/unicorn/taxstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv + + + + + + +19->1 + + - + 20->19 - - + + + + + +21 +taxon_metadmg_dfit + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz + +output → + +results/metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz + + + + + + +21->1 + + 23 -taxon_prefilter_shard_count_alns - -↪ input - -<input function> - -output → - -temp/prefilter_shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv - - - - - - -20->23 - - - - - -21->20 - - - - - -22 -taxon_prefilter_shard_saturated_reads_filter - -↪ input - -temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.hires_organelles_viruses_smags.1-of-2.tsv -temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.hires_organelles_viruses_smags.2-of-2.tsv -temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.human_genome.1-of-1.tsv - -output → - -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv - - - - - - -22->14 - - - - - -22->19 - - - - - -22->40 - - - - - -23->22 - - - - - -24->1 - - - - - -25 -taxon_prefilter_metadmg_dfit - -↪ input - -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/names.dmp -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/nodes.dmp -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz - -output → - -results/prefilter_metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.boot.stat.gz -results/prefilter_metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz - - - - - - -25->1 - - - - - -27 -taxon_prefilter_metadmg_aggregate - -↪ input - -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/names.dmp -/datasets/globe_databases/gtdb-hires/20240313a/taxonomy/nodes.dmp -results/prefilter_metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz -stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz - -output → - -results/prefilter_metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -25->27 - - - - - -26->25 - - - - - -26->27 - - - - - -27->0 - - - - - -27->1 - - +taxon_metadmg_aggregate + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +results/metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz +results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz +stats/metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz + +output → + +results/metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +21->23 + + - - -28->1 - - - - - -34 -taxon_shard_saturated_reads_remove - -↪ input - -<input function> -temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -28->34 - - - - - -36 -taxon_shard_count_alns - -↪ input - -<input function> - -output → - -temp/shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv - - - - - - -28->36 - - - - - -29->28 - - - - - -30 -taxon_align_stats - -↪ input - -results/aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -stats/aligns/samtools_stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt - - - - - - -30->1 - - - - - -31 -taxon_align_merge - -↪ input - -<input function> - -output → - -results/aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam - - - - - - -31->30 - - - - - -38 -taxon_metadmg_lca - -↪ input - -<function <lambda> at 0x7fef3af5fd80> -data/core_nt.acc2taxid.gz -data/mitoch.acc2taxid.gz -data/taxdump/names.dmp -data/taxdump/nodes.dmp - -output → - -results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz -stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -31->38 - - - - - -43 -taxon_metadmg_damage - -↪ input - -<function <lambda> at 0x7fef3af5fce0> - -output → - -results/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -results/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.res.gz -stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -31->43 - - - - - -32 -taxon_shard_sort_query - -↪ input - -temp/shards/unicorn/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam - -output → - -temp/shards/sort_query/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -32->31 - - - - - -33 -taxon_shard_unicorn - -↪ input - -temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam - -output → - -stats/shards/unicorn/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv -temp/shards/unicorn/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -33->32 - - - - - -34->33 - - - - - -35 -taxon_shard_saturated_reads_filter - -↪ input - -temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.1-of-4.tsv -temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.2-of-4.tsv -temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.3-of-4.tsv -temp/shards/count_alns/{sample}_{library}_collapsed.core_nt.4-of-4.tsv -temp/shards/count_alns/{sample}_{library}_collapsed.refseq_mitoch.1-of-1.tsv - -output → - -temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv - - - - - - -35->34 - - - - - -35->42 - - - - - -36->35 - - - - - -37 -taxon_metadmg_dfit - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz - -output → - -results/metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.boot.stat.gz -results/metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz - - - - - - -37->1 - - - - - -39 -taxon_metadmg_aggregate - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -results/metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz -results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz -stats/metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz - -output → - -results/metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -37->39 - - - - - -38->37 - - - - - -38->39 - - - - - -39->0 - - + + +22->21 + + - - -39->1 - - + + +22->23 + + - + -40->0 - - +23->0 + + - - -41->0 - - + + +23->1 + + - - -42->0 - - + + +24->0 + + - - -43->0 - - + + +25->0 + + diff --git a/examples/dragen/rulegraph.svg b/examples/dragen/rulegraph.svg index d9d66a8..7e83681 100644 --- a/examples/dragen/rulegraph.svg +++ b/examples/dragen/rulegraph.svg @@ -1,721 +1,421 @@ - - - + + snakemake_dag - + 0 - -target_taxon + +multiqc_taxon_upload 1 - -multiqc_taxon + +multiqc_taxon - + 1->0 - - + + 2 - -trim_fastqc_raw + +trim_fastqc_raw - + 2->1 - - + + 3 - -trim_get_fastq_raw + +trim_get_fastq_raw - + 3->2 - - + + 4 - -trim_adapterremoval_fastq_pe + +trim_adapterremoval_fastq_pe - + 3->4 - - + + - + 4->1 - - + + 5 - -trim_fastqc_trim + +trim_fastqc_trim - + 4->5 - - + + 7 - -derep_merge_lanes + +derep_merge_lanes - + 4->7 - - + + - + 5->1 - - + + 6 - -derep_fastqc + +derep_fastqc - + 6->1 - - + + - + 7->6 - - + + 9 - -derep_nonpareil_infer + +derep_nonpareil_infer - + 7->9 - - + + 10 - -derep_seqkit + +derep_seqkit - + 7->10 - - + + 8 - -derep_nonpareil_plot + +derep_nonpareil_plot - + 8->1 - - + + - + 9->8 - - + + - + 10->6 - - + + 11 - -derep_low_complexity + +derep_low_complexity - + 10->11 - - + + - + 11->6 - - - - - -13 - -prefilter_reads_extract - - - -11->13 - - - - - -20 - -taxon_prefilter_shard_dragen - - - -11->20 - - - - - -21 - -taxon_prefilter_shard_dragen_csv - - - -11->21 - - - - - -28 - -taxon_shard_dragen - - - -11->28 - - - - - -40 - -taxon_prefilter_shard_saturated_reads_extract - - - -11->40 - - - - - -42 - -taxon_shard_saturated_reads_extract - - - -11->42 - - + + 12 - -prefilter_fastqc + +taxon_shard_dragen + + + +11->12 + + + + + +24 + +taxon_shard_saturated_reads_extract + + + +11->24 + + - + 12->1 - - + + - + + +16 + +taxon_shard_saturated_reads_remove + + + +12->16 + + + + + +18 + +taxon_shard_count_alns + + -13->12 - - - - - -29 - -taxon_shard_dragen_csv - - - -13->29 - - +12->18 + + + + + +13 + +taxon_align_samtools_stats + + + +13->1 + + 14 - -prefilter_reads_merge + +taxon_align_merge - + 14->13 - - + + + + + +20 + +taxon_align_sort_taxon + + + +14->20 + + + + + +22 + +taxon_metadmg_lca + + + +14->22 + + + + + +25 + +taxon_metadmg_damage + + + +14->25 + + 15 - -prefilter_reads_taxonomy + +taxon_shard_unicorn_refstats - + 15->14 - - - - - -16 - -taxon_prefilter_align_merge + + - + 16->15 - - - - - -24 - -taxon_prefilter_align_stats - - - -16->24 - - - - - -26 - -taxon_prefilter_metadmg_lca - - - -16->26 - - - - - -41 - -taxon_prefilter_metadmg_damage - - - -16->41 - - + + 17 - -taxon_prefilter_shard_sort_query + +taxon_shard_saturated_reads_filter - + 17->16 - - + + - - -18 - -taxon_prefilter_shard_unicorn + + +17->24 + + - + 18->17 - - + + 19 - -taxon_prefilter_shard_saturated_reads_remove - - - -19->18 - - + +taxon_align_unicorn_taxstats - - -20->1 - - + + +19->1 + + - + 20->19 - - + + + + + +21 + +taxon_metadmg_dfit + + + +21->1 + + 23 - -taxon_prefilter_shard_count_alns - - - -20->23 - - + +taxon_metadmg_aggregate - - -21->20 - - - - - -22 - -taxon_prefilter_shard_saturated_reads_filter - - - -22->14 - - + + +21->23 + + - - -22->19 - - - - - -22->40 - - - - - -23->22 - - - - - -24->1 - - + + +22->21 + + - - -25 - -taxon_prefilter_metadmg_dfit + + +22->23 + + - - -25->1 - - - - - -27 - -taxon_prefilter_metadmg_aggregate - - - -25->27 - - - - - -26->25 - - - - - -26->27 - - - - + -27->0 - - - - - -27->1 - - +23->0 + + - - -28->1 - - - - - -34 - -taxon_shard_saturated_reads_remove - - - -28->34 - - - - - -36 - -taxon_shard_count_alns - - - -28->36 - - - - - -29->28 - - - - - -30 - -taxon_align_stats - - - -30->1 - - - - - -31 - -taxon_align_merge - - - -31->30 - - - - - -38 - -taxon_metadmg_lca - - - -31->38 - - - - - -43 - -taxon_metadmg_damage - - - -31->43 - - - - - -32 - -taxon_shard_sort_query - - - -32->31 - - - - - -33 - -taxon_shard_unicorn - - - -33->32 - - - - - -34->33 - - - - - -35 - -taxon_shard_saturated_reads_filter - - - -35->34 - - - - - -35->42 - - - - - -36->35 - - - - - -37 - -taxon_metadmg_dfit - - - -37->1 - - - - - -39 - -taxon_metadmg_aggregate - - - -37->39 - - - - - -38->37 - - - - - -38->39 - - - - - -39->0 - - - - - -39->1 - - - - - -40->0 - - - - + -41->0 - - +23->1 + + - + -42->0 - - +24->0 + + - - -43->0 - - + + +25->0 + + diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/config.yaml b/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/config.yaml deleted file mode 100644 index ae3df34..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/config.yaml +++ /dev/null @@ -1,142 +0,0 @@ - -# - Only tested with Phred33 quality scores - -samples: config/samples.tsv - -units: config/units.tsv - - - -############# -### READS ### -############# -trim: - trim: - activate: true - tool: adapterremoval - params: "--trimns --maxns 10 --trimqualities --minlength 30 --mask-degenerate-bases --seed 12345" - - # Ignored for SE - collapse: - activate: true - params: "--collapse-conservatively" - -derep: - extension: - activate: false - k: 16 - params: "ibb=t prefilter=0 el=100 er=100 ecc=f ecco=f ignorebadquality extendrollback=0" - - derep: - activate: true - # vsearch or seqkit - tool: seqkit - params: "" - - low_complex: - params: "entropy=0.7 entropywindow=30 entropyk=4" - - - -############# -### ALIGN ### -############# -prefilter: - taxa: "Bacteria,Archaea,Viruses" - - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: - prok: - n_shards: 2 - path: "data/prok.{n_shard}-of-2.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal -N 1" - bt2l: False - acc2taxid: "data/prok.acc2taxid.gz" - virus: - n_shards: 1 - path: "data/virus.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/virus.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 25 --weight_type 1 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2" - - -euk: - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: - mitoch: - n_shards: 1 - path: "data/mitoch.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/mitoch.acc2taxid.gz" - plastid: - n_shards: 1 - path: "data/plastid.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/plastid.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 15 --sim_score_low 0.95 --weight_type 0 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2 --seed 12345" - - -############ -## REPORT ## -############ -report: - multiqc: "--no-ai --verbose --cl-config 'custom_logo: data/KU_long.png' --cl-config 'custom_logo_title: CAEG - Center for Ancient Environmental Genomics' --cl-config 'custom_logo_url: https://globe.ku.dk/research/caeg/'" - multiqc_db_url: "test_qc.sqlite" diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/samples.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/samples.tsv deleted file mode 100644 index 5994081..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/samples.tsv +++ /dev/null @@ -1,2 +0,0 @@ -sample alias group condition -Lib ancient diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/units.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/units.tsv deleted file mode 100644 index 4a8a376..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/config/config/units.tsv +++ /dev/null @@ -1,4 +0,0 @@ -sample library flowcell lane seq_type library_type material data machine run_n sample_n date center platform adapters -Lib LVsim1 BHXXXXXXXX L001 PE ds DNA data/test_L001_R{Read}.fq.gz SIMULATED 0000 S1 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Lib LVsim1 BHXXXXXXXX L002 PE ds DNA data/test_L002_R{Read}.fq.gz SIMULATED 0000 S2 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Lib LVsim2 BHXXXXXXXX L001 PE ds DNA data/test_L003_R{Read}.fq.gz SIMULATED 0000 S3 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/data/results/reads/low_complexity/Lib_LVsim1_collapsed.fastq.gz b/examples/euk_prok_virus/.tests/unit/prefilter_reads_extract/data/results/reads/low_complexity/Lib_LVsim1_collapsed.fastq.gz deleted file mode 100644 index 3f41b8b05303215cdec352bffde70c4a554accfb..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 130659 zcmV)CK*GNtiwFb&00000{{{d;LjnL-0CVt-4>5=j@^mqc4>pMRbB;GKH?lM{)HAd) zG&DCdFx3T7W~T8usd?!o8CGV7@wxda20)IlNjuk0Z$q&G%Q>vC%@YzDvoOpkcy+C%7Zva1tAK;E%-r9|j()tNYY@ zd(zIXYiD|;QA;3MP~QLfw}1crzyG+W^!~5^{56CS ze)Grhn;+>Do3RKBn}{*9v6(0v%r!H6#>B&nJYa^rhZaYJ85Bw{Tcl8H*v)A5!3UWxWaIPM|8iTK0N9<~Sj9qN4)-ASPzLYrb5PWwB=i_||p1vU> zh>q;H?J?vPUC$s-xF;)nuCI#Msc^!M3MGV6Z*-@WYuYH4Fm~s2d(4|Rl>KXV9tKj|D?6qVD3^Gnd+Cw3(i`m-7J5W2nbA}h6$KjYkr!2f7j^^S z1wefv=%;m98kV6Y)Z8N=wo;`n)=0l>>Z&O;B+m#2a(YN@mW|CyGn0>+n%dg+RtScM z)Y=w9PKTl8F{Xx;_AY6AG#T-m@ZgCLco1V2R{a3zpPCo#2G=k;-RMp&w7gNHwD7H7 zlK^%IdXl09jnTr`)VH6F1&AapUYp*=^kwjVT&Ef!}W%*uj|^u7ju?L7`pO~D5JgHUN^!t&ut`_*;Y>KsojI3@JE z(tF-0)esg7CVFgnB3^g4!<;G7+6)e(E?ETmAk5-5yT3N0^Co-X1a&L8Fz>8-jw+rX z`tA7gYt8p(#IipYK6NTNZPclzxH2YOii6b@6@j+qzi-G05nc(;v*!tm&t%9JLB@D- zFh0Oxf?0mKO~2~o=hoqPkGtbBhcs?<&oyr)jW1xGVwezj!X}KN1`rICkANJDfbIdX z%@ocF?lBX78oQrer_NvY{ExBMaHD&Uqqi-mP}V3~$73T!v4W0Z!t>TYIe@r_$YQ+A z$l^)3rk`I;TCVF<&5qmPhAGvEsg`ORaicnp(VFN2Xix@hl5}_>&brWde8dA{iSMcp zwGMgMEXGuFjdIX;wAFQV~=E@ixUvlMZ;NHy;;_^_#c(XV=eoya%d= z95D`t-1-(n$*VtHxEjiuQ4N!`WAJsba~f}+2;LZX?(CAoH^`3DR>yRi>B7imBMNOH zHpPA^a-f$f>&$cTF3$k$*R)wcnz3KVap0NxyJr47Jrxs~GKyE#P96|T|o?=8|IMOKth=;!9>+blgNY)RES^1(O(RWAMl|ve*qSYY=KBA5@I1iawQ$s9UuPAlHU zT0j?Do73B)IcQoQLfdO zv9&Pra(Fz(A3*Hn6S?ScE4wa-#PeCwXD$r*AYINxm#phO-BlFxamB^y@8|nzo%TIF zhJkWOEpC)UE^Y1nV;`Gxk7uL%fI`ERHZe;l8u_L|Bygp`!3%?pD&oMRCj5NjzPiry z%BgMl5CKD}$Bjy^art`@KA^UnZ>hOT2T9KNkR7Ag|1d=bq_n9C^gFX1uJN|-;p*AT zaN1W4;IWUM#}@k-badT#L0h1R518O-uC-2jg6x(#R$!Wddg2Z18!(NN2eep2>O}EI z_cSPMX|%Mg&lfym=TDx4v!B|Il&<#4q~1PM@a(7X;=}g;d=L5}(^FRsU%xv2om>t1r1;~gh-#<2 zQSHY;Sbl6DlNPaadY9lPsGu7ts4#{E*01s6WMQwX>|2F}rPUs{(%O+wSDu0*CF?aMasU4_nLiORPj}@gkWQ2tcTEnNuld zBb`T10_6}wk@sO&fgw++Q_7F|^rdwkD%%oCVlU-J_tsO{+MvAr4Uc8C_tT{m;;|EF zXUI5;$E-NnhB@f@Wa-k$JX-uNt?3LE<=^4M*o3_@ZQgZzNvqQXMG(3#n^%MEr+_ba++@FkyrR3_f+S+4ebewi^^1pZO(VL zkB`91J!_ZpGF2n=aPM@kuL4KEvFlH*)6S368Ck`#aI2wjt%Y?$cG1cGm=~k)qK{(p z(E?Zx2XY#O(v<^0MiAbkHVc~fH-68Op6f)k>t_x#6P3Cp8q5E5;n{AyO%)Atrgxk@ zAD(U`hb<#6Vv<9xgm#!m?rqDX97psmUOR$UA)1-z;1cn8jx;+lak0`-Xg_CVm%W~} z_?dOeuXGe(4w-Ir@4dyXkMhgBUe!HV(t7Zi>W5U;Xx{;;jCpjnXfuJXs;XW^@J*#vYE`1@X`HsnswTO5>FVI%Z=_7 zOB@@;dTL-7`<#Hw#BJzYfJJ0_T$qDG1`spsa7gm zs`bF8)~?&;Gy+1J@~+rJc=LYbD*qf$_H^^gnT>4{=WpWFc^wYs$Mcy{$Ee$AAs;1k z@eQ`R4Hn=_B#$c7GPOPHpZiBjy|3YaT>f&0`$r{+GkBlS~ejox-f=lJYZo5Q>`VnE!A4uq2^vGt=o%DQFt;1>8a*E zw?8LKT02<+a-9jXW~ML>ODM+c7C^3@-==U(o#KOk6=o7oK~dnVNth`n%SMR^HV5#v zCNJKp+xn`;{645m!uG%7t|YmV99N#@AAn_?huV~dalxHdVb;sO|1G|mI~c?hpOkuo zs@YXplJaGCZ~)+NI2b>g;%|+$bh?TQ@ZNkVriB!)MRS{zK(HDF;KGH%Yha3S5rQ{o z5r>7HK~PG-E=OP-vhP#$fUo2ajzhAU=S=o3LnS&{8+j5w!A9~4D_-0o&xIT%Fqb77 zlsuCTA6;@-=HOEF!kH7UnJ4uZQW0Ypp4Gyw$)F_*jeLe+3j%D-Y}r zKh-%=Fkj-S;m$~+zlVriLru)Z&#@+i=#n)dM89U{?9K&Y-9ZWu@C6r{HHh5E`ZE`} zir6gncjhaE)Cm000bmsnOlcUCwt4^7{$VJ5eX~GP56LY%<6^OK)kAhH)alIi`}0K z6l2QOnix}AtsonLECOcmr&Kw>2?851wZC+Lr?ng;-mxCd6i! zG`nuttWW+(_D13}X@3&p@()W%G-lv|F~Jh7Um(xuFHY*qp>sLn?^|XkS?_{L)~CfY z?RqpJ4}1TRtdoX`YNzBmp9_57S)qO?og^azb3SEfoKNjKJe$;kNk8dZ(szAwO2RDl zNBWG)u)9>rhkSE1qlqlfLN9F(H}qM{jr|CY?+47 z&X#O^b}nDey6(`6@s*R1@*pU5HoyVM52^j)Yf`L`Z;XrkqK;2W|NV)6tOte;%4C)P z^IvO2OgVyRaW*95+|npGf2S3VwZlnNP(mhR%SnMTyC0YtelFp=3qC)_aeRQg82s!x zCM$b%R9XA<(u45yy$t8~c6N6t8a{ek6L3)SrBb;_++Q*2(vi7jcK$@1Fx zK?TAPV;PeE!FZ^d0QYy!HdGkhIFIRQg$wvq%lhY2guH=2nVd~DIn~vxmp03~x_wS= z=Op+f>fzs66F7#X3NRM3GeT?fFF9yP0+-)xJ$HxlE}j;0{@3Mf9S}mQ;67K0`A#8( zq#Czghj zR(ei!?@T8MsMyZ|C5|A1XDRI)@1@MNwa?U^54pr@e8|wDF4%sUZLVyM-G660z>ydxPJEa+n^SYm($G3+v#9{A_@ zd1+LQ^^BPdF1HMzt*chsOsjQyhI9|Mvf@sgz!&rrsO68|&yOy)!s<2R>W_2%`zx&d zS-t$3+>YQf8q!>D>bSSIJ$YX~Ytrw8HAu~5CQNg1O3;f3V`nEjJ|GSbHqn{aiHCmx zt-mys(YWgt1D{&*HB>S>B~;^Lt}6j-yOxk=X$(16B7%f|Q;;J4I+kT%eGu%${~cm# z7t4$ChWL|TUx~E{^+Glmz0q>b!GxCEYB(!)i*b}3uo{l(4v~KjdJ1wk1c;1fEK~}g zHQu`AI)U4|OMNQdIpb6D`Enj<%jt!Mpju?m(_w!Gx9X6?%=(g)KAxVzZQ6G0?R<&W z7UN5_D+k^HCNnL`%#TSo$w8c!Dj5gzJNALFP{ZC*hVDatC83UF=jmzvY^d1<4ux<(N2;i2|15N86%2K_CzGpZ{7Htqa+wzuez7*ko#0?);7(nza2A z7_dG!W4};(!jcS}D)@?z<9IFaho9FG(|!hUAtoEG2{GAvWx?@tKmy+;cL`j*(*y-4 zYkW*WnA|-DMAuU$bi~g0^t(`0XdA`mUjz(lY6JjYX=yBok5%3#sjKj4gshCI_*){DjR%)Mist zz*6HwApX-(PDtqs>!=^?Kg2gFjjXOl05}LOLqLPwD2NS7IX$Nyh^qGG;F0?l84{Lnui8m?bXWA=Z?RBJIYwR}0b zjbbAK58{x?2Xhc1*{&iG{>7K@_}6zR-!ZtK;w9fc$A50-+0x84ZSy6!0;ucJ>F$$X zTEp!YC~+zWtG-kNO$`CImx(vP{-cx75cuZ4LWpx?vauK!lM7dn-Y7t7zlNl?+c%E|&rsJU#N zGu~yzEo>bC@NWpS@;|8oV{^|glSM@6ERqs@c7hT7{>gvd@8;J0R)d2JE~ir1^zWK+ zDb#h_VZO7iCvmTwQ~@2>yX&{$ucxY+E=>IYd*-ALX4L&Pl+xIoV>Qm^T-WuYJB`KM z1y$xjSv^cn$Tboz{n0BJ)Dd!9W|*wYwwYvIPOG4^uQ5C*GzCoP4@v}>R3TddQ;WrZ z=;{8sdBS=vUGk*{9s%!-OF{LxZ2SZ-oTEMjkHEqwx(%q2IanuQ+Yaa!rm`@6a2Ss* z>UTp0t(h}i*Au(ytI4h|d(Atgf6jU=b2bVQ*lGB%3UnxOU>5! z(&AOh-223&icYvGSRbCYPs`*##A8I&=j4nLV2EIez%b1>>P|inWw%7$a^CQ33CRI_aRhl;43a=v0p5eOKk(9ORB zW@P3iFb)yW5ebozq(>KAKvyZS_vKmKZiQbQiWE70&bC?Ob9TvnxfM83@CIl`IIev- zr`a4Ae(7R~Bz(^PT73sY&7fr!+Cza1%Vv|~0w`t2ok*rx45TMu73WfwGj}3S#U6vf z1atb*!41M6d3ie9P)E&P?8CJ~#buj~FD|c`wM(srEdMDgLz#;-1c~Dl5%x^1&=HB? zJNhwQ1Ea<-Re97*Z@PyPx&d3WCKS82@>0~TTYpHt5<48^1g`T(VxJLC=0W!-T~d_Q zk*1j4W#@5zbnNmk-h#Z;D9X>l20la1P3( zg1f@5x^uz1=1lN@fzs_BDb!5_8V$)}QBwTCCc#(G6A(wupnS?P`|e49s7_VWh~b*X za?;U;VokI$f34_|C_f*c6(c?+({xe~q@@^SoHT76#~Ts; zH$x*2U1*0GAeP*cHL(;Mcg6B021Kn!6sm9}>p%Dn_H%XgS`RJ}>IVmxiXEI%MrEpV zd;pWa0hin#(_XZLWvJ8&H``JU#@UwF?Tz)0q>EYaampYaJu$NUkXV~gnp=$t%5=p$ zpJ036sBgL*YqrsDJ>4nTlATGxR+TMn8f|(mL=MIWc-Vu{Ud#a5AOx<+nCKX21MG33 z>=h~c_{ENT4TLTxGUQ-!Pk74KnwWC9%3)#K+hcr?KR;&>8QkbOaX$JV+^<^qph+Whnxi~ z&%E&rr-AbAe6-nAYUP;;+(*~lTl(_ohN|y4S)Uo%s#=T zOQ-SnUL#x3=o6DD8UD~a27C@EKJxIpD zgU-vsF-sQ0PuUFlWkxswMZaelDrWnr-2s^El#4emmAE$W^IfQ7-NzUoqQw#Q-Vkfx zT^pk6V}^LpJ)A@{=h(r?A7a3thBoqblbWJ3bM?;nTA2zW7ZAOt`JZs@2hbsC|Yj2mrpVPKDZRK1wwHe(8Yjin0QIZ*y|@e zk1x+f4?VA>lhB6S;Jh`prd1}{s+nZn;3j6mz|t+(UIO$Z?sh#<+wXbGu>|9CS~8za zd;yvRCxCZpOKS_*-C2QH$l(}|LkA0?caC)rCcK#lGJ(FGrSB8b(Ewg?eYhAp* zQK9jraV=%zoek^tp<4v#r?@&%op*ufteuJS=D>xD%d&lXzN+u2P;8?j8K~149GNRSsJhqr2imF|LI5*0lX*=fPkzsos-ZX=izuoE3o$?SS5J-Z(U1 zCX7_VnNn2ud&{6E9j|n9)}L$hrY&)N%A5P+!w;J5kO07T2lhxHPb3y(0^eV|gSnjYO3C=K~`Hd*EyKmw@#+q#%XQKYtqan%>+v2Lxer z2-Y~8qe7`)RQKo}8BT=zrB08h6A%d?0%8xrdAx0pD$J+nu#ZnC#og>fN;$-AQp$0? z0yN(fQ_3}3IJ?4m@JGA~l!?(HydG&4W=XI6d^H1kM~9qsG_b@PiwRLRgE+UzP$d5( zk8udRlZ}FBW&+1t0zR6NoCYAjGQ$vec=A{Iv;1@T+!Lnq>QG6@ss*mz+gg(|q1EQT zP7g)452lc?h@l=qjz-AZCyr{LDHwk8(?Z!dL%G+u?%pXOJI3nlY%$rd7ol%p4jaPt zmoKY2DHu6P9C^(LV)Y!&iwLxNQ?am z=WcDACA82?iPo*S6}FWniz+n%79P7i6Bt08k5icN33m?~6Z1pt$GF9 z4uE8RbSBxbK-VTfoc!eS4JXq&h6Da^@Yvu-GueCnWesXy>LwP-HF$4w4XYV{6FW;K ziB7CbJjFGpL=jSB;|!(<2X{VdC=p@tI!TPtnZqt+SUD1mlQns^AOg1hPRUUmG>U!MG7Km7FE=& zZ}Y556h4XRkyK;zr!7*c_^#P~8f&sS-Qx#*U^n?UtTcOXxk+=(Bue1q!OP`Ap8vEm&QZnMy4hx{HZ|j0b<1yV`u&reB#p%q5WwsSEyjI*6c(xT70do)C1vAV z4eNMq{v7U`mH@{-h>tx z98a4FS(bgK=u=`ob4yWGv#PfJaE%A5gbEr(cgJ_-mTfb+6_qjN&3ExENv#|fgJkCbV#cXsnoAHO z80z9&m@FUSA&6$VQrP{6r~kxIr&nGCB=HJ@MOTwE(Y3V(>7M`Yc-mE!XJv=v_Bn~A zlP-rG+0!#qetF$TH$_LOlw3?Ib-nd|OCHdTFq2sxvrgZJoPxE7N8o^ZqOji?6>Dn2 z_*k>g*E7Z4d?az9O$@qNmi7+66jXZk3p zc=ymJF@Ls+Xrqg_GU#-#jC?YBbmlY|pk7c$ky;Uw9qAo-$zkd=WV;c|d6!Ew&bzYS zKb7x!Lc+U)Y!S=5l2$VBK%$TDh~?42Nnza2Z2bG7ym@QNJGzVmo6)&dz7buEy&kl5 zh$?u@`oZiO4^283pAojOGqlT{+O%o;Tc$LF8qYUO@{dD>_HxtM0kf?s)@oc$X}#w7 z4x7Vnb~-f>U~+qm`q@M+Ea;8vKKWyQ=#^5+ouPKu>ta2dibJv~85fdU(J$Rm*NLbV z)GYRfdE~$`#q$sGRYWDv%|Pc*H_~sk=BL`cNvW-y;I~HZ35f(FotHdcOQ#Dl_8Dv#3W6Kf34h+oswOKD)< z(FEIh%Y4*OW>S~1aUtMXy$dE*zuu>^y)J}l6|g+?%t9Pf0;s|mlQ6&n5*Dv|0(HLP zo}k;{Yct-4uxeVlZvL933+lz-oyW|02PG?ruEdEQA2`KwnCLtL6TcnWTFPh3&NkX$ zvW@GY?HXiyWZDZe5bTOPtn>jL+zZ)|m-sz(c=CEpyB9TLj>Q_6Q&CE>xZ4JZSgPh> z3!qAVVe<+w@3_sc=zRK74x6<6x@=FLm+n3^luxYT@bUp_TkI45L~l$TA=K(y2y z0A28=6sefK<*AeNSCpT65^JNg##tMeqPN_+u=eP(f=p&WiBXQl+euL+8%*dA>Q1_( zwJZbT$1hA{8!F;#VuKi>%h|*beO+&cbbChvmY5J3#6EXIDtin!B*T!~0j9#fI#YD1 z@lu}3MH1|X6M0>!ffG5NVQStpRDx!;-wY1j1}T~rt4h!67QSdaSRHXUST59j5XcUR zSA)l4+Tt}1#tDEw;KCsmJNP#mk>0#@>IX#h)uqM%`}K%?3l*i@^%pPhoL-rTOBRg zrkEq{3UoOJ9cmA6Ng#6=(%jyuk?6kOm=F&{3l^bTO9 zAtr+Kf(fO_rw5Vi0jDE{YYb!O)_oxSO=<)@aF=lkU ze+2kW>e;7oXW%5Hi1lhpF^7gj*992YyZdvn$+#TS*LOV+&VqbCG9QqgBKQN9!lJWW zM#T>9rypKDZ@GX_^cks;bGdorTv=hT?G-_R%+qwPXpe7cM-(i|55=%Vh%=S1V>*Av zyG+{kPX!AhiSPX-}CBc`pixA*zwT=q8v z<(85&KI^vlwr2^%tetrr$qymoDW7GWIR$$N;$unooHlf^_W}Yh9Q1Fv5QTGB*Y@=? z+g55Y(Y30s8{X9~^r-}`{i}Uyw^E&h z>@8Sla&&P;k~>8rN%C2PL9m!<|0G!HEhhF1gwx#!kmH*l=+yZveCtISMY@#7nUa`MTvR98^GcaJodP0o&-Ai5uVMts31 zCUZ8WOHZuo?a=6J6UYS{OLivMsHCEs*aeRy&XAVRg+C_@=PZPT?eevhEd@o+)a`h( z@#PO=%`%3lFecx7<$R9Dx!_lRvA@2I;kdI#(`S0cNG>f#=a4U1$ziJd(rngqCwT)q zU&lzMi(Rsd=W-!$kIi~;=OI5Be~8~n3G(r|{DPNg4WwdOZ)V67KPUpZ!9P1#7(L`K zV{9Ycds6=Mi_*AfhCcACfG@rGvH4_TQ&)xVbe3FW47dI<#0>Er88?PYYHlQnl2z?@ z#JUftX*e_z)mP);<-gfhlh@VU_0D}y+#g_3gmwlmO6jM*L>xPi3$=Ba1~|Ec2yM1Y zgOB;W?bZ3tb-lV$sd<}IG~VWRvEcEJf13Z3Yyp;gt^m!0{lF}gKUwcEOTHrOcdmtK zoNLSHr@fKo>RDk~P*8@fE`cJ7?y~~_(DUh`e2D4^yk7fat1re|tMo_vJ2hCErM4bN zyNg$V%$E>{!iqj~N&&>;@J}kw0EM5N$JaychP*T6KmWDPyHt2#qzkz<<3e3ZQfIdv zIp-Fz)Gjoo0(L3_Pb%b)ug^=QCLm9uAgRrB78u@3Vt+ey{-aK)yhkO3l8g&6T>Q`8 z#X@>ka<{?BjXAGV<^)<%dR3U(}$hsZ`@?E=xeT`#cKJXsCAz(3qJJ7{JKd(>cRu=zs|IScb;LB&< zA5u)ggp}+RJNFcdoh*I&cQREFSq&Z$mL1pxb3E_jbd(DENh9-7=ZbMYxV-Yww8vD? zM+`<+Xod2IFL)#i(Vuxr^?cQ62o-{fokRVJt$A#ysV4=Wsqb>3IA@#->Snikr%hWFQd6YIya`oE(wj7tLkgOJ zaYRo7i3AZ*TKNm}Rfx!@&*37Z&`ijy+IUY=1?C^dgt#fvMEoLI?kO96xnw{+R2i>E zsqqWbTXXaNx@JthTCC+3O;b^2gEliOz7%cTNV!dMW^y>CJgS|)dv@9KcT7n+6uSYm zm~m(Ay6oT%At6clm`{K3J_B0i`~`e1>I)>|Uz3B}KK1UUZEV&!Z`10$+cbyt3nK62 zt2Nda6yZ%8S<>i}pB?kFFHK+$0c3DF^kIpG|j8kpaY>I5ZO$47rAe z@)o&fiMM7Tg`R~4kt@DsJ{)US<>tC|!o+61Eygvgv{8E^1UxS<4iWDz!H1WI4az7x zZHL8Cey)?}U`ZRHSAGX5;)0tttFwh*$QtJrxvaKX+d4{vollhPSRz85F=gz=0rxJ%bDzy^$I4J;sXWM@E#CQ95|paOz96p zIgnC6huBt2ai-N8uLQg7vR+J(2pb6sGg2Z|R<8%Yqi7bmmAS|4SN#UadG-Vr(T5z|nVDPt?5ULvx9z2=!G((E$z>7FZZ8bNsmD1I z;*S80EopsH8bmE(?qJ|f{&EQFK`w|BHwB9n77c#;w3PqJq0Medrxrb$gDc+T;Met4 zt?pqAQFi*_5#K zoZIb@Q~lBp0VpI5CeO`%Ckw_e2#`AqDM)89|5pLlHdIJ&s~NLJmVkV2$v9uuJ4T(o z^OAAqmjJdR<(g&MQ;ZXbTrL&mIbfaOU?oVvrl6NoYC8u%NXvNdw7(k)gqDSztGrv^ z*6V6+xjN&h_;2Cv#|#EDqmrgz9{lrPb6{T%<=N^D ziHGLr>`Ms7XI~b&%G=s;eVFlbO$h2cGBMWwuo#163<qQ4kenTh}gj0E&=E;Ah`=fvSONA7U|GPD-bOCtpD?0gI zOvM=&vtI?3-DA%>!6^$Q8#-k20+r;eXR)F3obKuz3e^P<7@nOs&gQaurteU-0`2DG z3CJ4~OBOXt=(|whOF1EiN+NPnPmfA@jxm^=>@xbiJFfFWm4sP*JXu{S=iw+G^3Vgv zY$DNDCxD?1i2+{S?de(x&bU_UGW&fVlCO2S5CguJOqdkRd2C3jGlsoJo~~yO_U6?= zo)wE|g00C1n=%5zo}`5!I0xgNknTKOgWsK43Mr{{7F6CbF&)MB zB73nldlQOn_OhqAUyKFO2FwJ}SgNE~Kghx3{*aw3zwfp;KGo*4Gqr`)?YbK|c?BuC z14c;A475ULV;f60^q0cClc+^#e&rIRZ7AsH^vyp|%GMl;H#Nug_RPA2a4hNIv61#q zII5FiR`PAs(%E*ypQu_DOFCDl$opoehnne1utN?m@GkCVQeMiTYv#$W=tf^)o-5+YeB@w)5?sE8fP?s_`}^1%v(0sT1omTSTJHo2XA3 z2?4EWD*MbuI-u1O#Gd?Xglv;^6^R*knkES5acYw&JNn^T{NB*!yx)kJQ;N>`oU&iR zVY|QXphtnISmdTsHaP_Sh~Q2p4gg2NwXh)*jhsZ=_-o#1;oH!&Zu;OrJ`+Q2!Gsvp zyZQHgZ*-;ywDhaJkh!e5TsYu^VCEG?fI8?|r!-6zf{)R-5LN)+SkS>jWoJ=SXD9MV^Np;@SS$9DZQE7&?t`Ti%^(aLt5V!{R~rdJC5Klvs!D;O0nS znL(q&_zntK4q?}j*`YaF^44EDb}E$LykvwDBOg<$#`~C-G$n-1OOXx1K2o|#)J{kH zvnr8#j+>XbzA z3Im5=wxO|%MyldKP#{B# z#i993;nAD#K*3O(Yug5mii@QhU!1zeZG*KedtH7}5RsHo30e;+pHf%PIvexsAFGEnU7O%f|F<5I{4C<8?`vp9b$YIYINMNLLKtV}>!38jx%qa5~YX11| z`#WIQ+^V}L=ycJ0Om9ibHh^}>DeQ=JQvHw+NC^)tSlB_%`Jl(@q)R5cg-;ve>EAt7 zJ=U~UGgR^w99Ooy((9UW+~O2#xTGDZUP9uFZzr;+U;1%Aat#$PlIGt$dxT2y#<{vm z1@}tQhhP>kA|F6u{iI4p{2*USK<@~zLI=qgq>#nB|Li|SUU!CC^%|~-U|kChEw9c+ zSB!IUz16VX)hLlzlL#R3KoMxu)1Uk#BFNNh9yBPN$47VO4?`a+uTXSMf4RTG^|or) z%=~t!h+_tywquh(5J4?F3$k*su2gYM_$;EwcRIl}qmtI!V6sKUyu}<%OX>2DwsQ*HVVmc5=y5;}%8E!}kqi|QOY|r}PSV04R!%p|t@$4nsg;j& z>ZWjZzK2##T**q?USi#^;CaYoNtF;Pp3}mGL7}xwa`;2s1}iFZ@H+p7@dj@7PwsKe zJS(}8WCJm_9PmcSyhLf+8zCpPi7AmFp0~#V3*ingL{gy*pP7?-&YSmH@#gdtT8qY~ z=+@2YZp$i%oW{ZbT>h8|3c)*4HRj0V!#N4@bH~{~@Dun&lv1ewmf9)xom3(m9|!-M zlj6@4YxMGl&he*>UE}^Ibw;2$mc(2r1#6s3t8*sr`s&V1PAY3CmrSsQ^UpRncCH~4 z#6c%Wet8*GEVxmV%ud3Tjq}NUt%&Z2gteK$h>BQpGcqUa0Ge#c`SkIfL**%9UAo;I zu0oBqcoUm?d(qB|95g4khDn4SSDccBjM+B<$eRdU^b$aNotW>K*$0sKkQNrHVTvCGVj9QXp9vRPF&BtCX%`$c8ajzthT_+c z-D^XoH!Z6}E8Q9;S8rk}MYRF%^=x*oQ&9t19orZfSEdjfKM>!Y_ETg3H0G^ zx~|QVkaICr6P!y~N$T#1nt+)4RT2dFA54<49GDcAU+rK3wyv3C_S%ZJ4e^4@?HWZq~UA7q-a;o^!f^(suCweb_* zAf_V*{%|QCI0|}b`@fFGW&a_$V0=(4YTSJua+*`>Qy_TA0|Ok+0_iNM%!u>I%lcO>#zhwdj9v04EPX1R{t^Lada=0f3pQoj))2KRL9? zI*q-MswEeliOGkrU)VzOS`1GDB&lrH5m^OAup0RNE=>4Ao26ERFb!%T;YuXI`+fNE z&n<-T>!M)Hl+#s)b*=?#g7em2nN-{P47UArk{BI+6B+FR^LQp`4+Sm<1W;+rjLx-dPhkzGMCbx2Cr_bfqc30+9H5k{6 z7mvxts-h~!Y>c1&merJ5P3Fs#MVQT0#YB~bMOaw`*QO$(A|k@ZEW+~T_g{Ye%=P6D ze|fg>{L`QRNQIt%4$n{W9QN4va-%zyUiP|C={5G}fBpSG|M=fO?NAs)>p`VVj~X%F1enyZEIdDk{SGq#CQLAcP36>I*IV-H&fy zix1Mp3#oRhTdKXb8ME}@12Gd51cem_vWlr1n=->>I7CbkP%)908g^OdZucCH9E-74 zy3w8LUh_t^#kt#BE*a+A!ZI^9!Ea+mAVrML5FSxu+(#MW!)*N4ov&;0IpxFW(+b*C z+K5_BhZU6Q!3;+M6gN`PSls|sRYqEh3M+0P%T#sP#jw)U)UcS;& zX7&U|5t_ZD>OORxt}G!vrZ1J6THUDBoM#c2$CU8W1zwu4n2F+lcu5>!fy-th%wmck zZ@2&4bB#Op{MY9YOE0mdcB4C`xR<<9ihG|}nd_zQ92$WoCZk=jm?0sM+jxTyyn46i zCR@)(r5%oqiApP5OjPqeYb{+Ii&S#3V`DQrpqyEO=;AlM-rNF3BV+x51Y0^%o^@9C zn$wN$DN@~1q7&UOSOGX^HuXwjLmP$_UQL2a6eB7Twdm!9@*AII1FjpY)L}&QLy+Xx z*J6Kahy8o(dvdhQsc%&Gyq{S{*DQmPIw8Rr_L!QE%tMO3#+n7io1^$c0n}FZjcQLb zIQxYvDAGmE+YT#>sZLN=8MuzXiP>`HfN8)w`4~i>>ohH=x{#oRl%o(+-x7rs>tR`I z7gC|DBFbv|bPxpW6!l^F2i#+D2Juj+2{KQCX7~#_nFjL(0^UO!9@lAgPwfn74y~4U zqkAiRZCfj?PP2P|%rx{b7yvU=6fl4Qiy5xPqsXTC)WAPsMf_1$9&qPRCW`NxDBJ6D z^zCcu?kz6eJ)tGlPI03>(5yKMj~Sre%5AiA0jUBGsRBaS6BvCNgvuCLb@Z&kztHBz zI{|QPmZ>PgKsiv53bWbI;EtL`{937BMXRjW)arA5q15fO%4dDk7 z68<%S{d(@7drP6OaG7s(&zT}^Ima+*S-Uno@Ozb!c)(2^IqV$}8ExQEPP`O^6EmF$ zm%+EtxId%`er+u&S{oi_1lqsyUK3xmmgc@M$%;l3%N}~(V%ce*{H)~*;$p(_2I;)lZ3S?!j-O~R7`Z{^ zd^Q(j7a(*LqqxI9$@C@YX`Pr#z0tjdnzlkYPfO!t!t&??$WPZ8TwFlVft)_4Vr(~7 z;fW={QlFpL{NjU2!?Bh&N_4c*kW0uZ)EnJ1rIfZzxlCR}^p*4m0n(!fD)bcdj^Q?s zsTa3KrsE~RD)uk7@`GMcUlA3fN4;24lUEAHQ4r_TcNVt_%p(LJTsX-lc6sR!hC z%?woTaD>muAPeek*R1X-GP2`dJ+ z8{JE%u$5jXtE}NMe?XVScg9}Xeh1j?l-gw^+z_V-#-0+F*D5m zwkIcKxtAF0mU~Iz9EdM!1qMDh)^&^V6Ey&JYZ!=z$9O4vyK9NwF;wM)%|C5xB|Z|i z7-QV~7Gq4Up5S+FYEHVmkNe&Sbv8^pj$gQDZ`D3WIuG?=yL2i3;nDF2d&L`<1b*vQ zwm@IK!cN>(G9Y-fmyC}v zM*%U$Gq_HC#`AMGels+#T(3M<1(nt|s`cdV;c>6(umzFFlO92Fh5*IOCle=ugR&v; zs05Q?hvMopl72z`l1|=Ja^8Et(R~k@wmtOOP|Ib`^e7x6Ds-H|&}=T)I3(J)Lf2A* zVSj|*n0uza#oP~iopUVHK?0*1hF1%$Xb#VDOaru>>9@G3LU zy;EEjR~$R1+#;1NLJtCL!Yow_6tSzxn`u?A)~3!H{Pi?!~HPXCzm z><8LN49^+>l%J3wTSnR|3K=*x6ngK~>X-n*$v!1x76=Y;u@VQ(DYcsGmQvf(%$Odp zwV^)#Lwz>S5@#45fuV+BsL;`QTp2qw2bax!FdBp#>Gug1uj{ma@Bx>a13GMqRLVvv zE{x!E6a#q~5GKexXU}LtkVhQO%*JR3!S_6AHzyPr`eY;k{PUTHFT7%&hu7Yz+~{7Y z?OR!pkmxbopoGXxKPs@NDt2eu@rQD{>MLAHau_F0$ zDO;h1L|xj`A)Acn-iBi9=UpQYed}^eISw|j_wuq9@|Pz}w9wm)?zQ#Ww%P-o{ps3M z5qlr5*?hXP;b-LiAgC_Oy?(1pNv{>{(syfRE1}b@>Ga5M#um(fj|=xHYWIcSTin!6 ziWvKN(58ir%D$gZQ_xpp>+Bf%!zdRZhmTV58aC){9;)ooMqHuMhcJUT~HU$3Y$+5H?V5Skw?(pt^7uU=^kN^d$i=@at=q{B+Qe_Ds5aHqR zf%{ATmJ+iyQc|4J=q&uX@Ck~sdZ^s}_fa5=YjN$HPu^P6P(B*5 z&RzDT+HEon*YUK`Qo~u(RBmWKru&@St&_?{Jv-Gk>Z=Z_|9mn>>*;ZOkX6%^OmTHS zhHS+7B<|Y9Eu&Fs5e;N@>PtPIOqXDcmM}|!0dX=?Z#)6iASf;2RNjvS_N64g!snX)({A&1!?|qHN`%vSxh<1;=Xeb#`BK%L}!NW6N!Sd-!LIo*Q#@Z`% zVM?|JWE&khAhCZ9OwZ-;mwO*1IIS46&PdAsaxi?^Y&zWvcxa?~nhHs0q`g057H-by z73@Vtg7}qpk|>3W5B|h%e*c4dQ>&(2=Z!2%p?B>>05Z(D1_( zczP`I=yphAU9!oDb$KS%)@=_okfd|btsohx839@=*mW%sum-&jCvU6{c}&f)B^S>S z@8_n!jAbQ~TQG7$8d!BU8mVsC`yHCm3sBm5B>s2Kg=UEgjwvrlj@I}oeFSLgQ}aDK z<2xUl`~CSU%1OzkXj1YaUi1B~h?EhcbKVu@z-%)co^KGWjCgCOM|%w1JHRqYgmW8a{!B{`HL3XFv0Sebi%mmBPIZjTdDf6ddNzSytC)aR+4Pk{1r0ArI@xkSv6Zc8-;BWxz z0?w$X);Kln3MmtKppD$6>J!wa@VA**{Gmg&$XZxrjSi446{@t0Hc z8_L}ztAme1DDl>3RKPNp>B}r|i2*4uHMtN?O@7+CxN%vX?lg8lofnN3({o|^n;HOJ z8xoeko7(c^rGCeaArui4!V(zUkqPuIQ;qeTYGf56Ml7ypwg1!job-+y?p=!-2qOn2XsC{Qx`%3Ne#m z^Z>qPvbSRaz!%kU@sScz%0?vQSs|VG{FqCd<1c17VEYbz^1<4jDwFh=luy?H$h)Vv z2 ze08R};D1gVQNER=;W?ZVfR~eo0kB@HnV+7*DqL$Hmw@L>K37vyNV7(6uU^p%FU|Eq z(-15*AMxmeDdXyQeC8k%2H<`$7Pe~Vv)n8u{ss_ z4$?q}o*~rbc6DXmF{O1Z)0^7Y0t)+_b1^;__j6{=LG?AB_s~rkKR`Iu&>Sz-ATGLV z(#@J{m239ZVplVnM<6?caNIy81f!PbT4 z15yVuv4JrNl$s;%$_FN2ue=v_2y8@Cn@E}-CiKKVMHPR1czgahR-<}_tVWJYcEy?O z*KF0HAY`0BO$#7&pqp{(S~9Fj^sVNKi5>^HTsdUoxVcIcZ=Owh2mS0{y0oZa_!n2~ z#%sMRWrIx>pK1~#KHFLCoHu>d6)K)u%RtQp)WL8TgPk}PN;slegYRRRl{|iTp}1Il_SrEFb>B-+M1^ne%cxMeM2# z!MG}uwA+iniNZ+#YOW-GkP!=ESRckn8CFU(9Tb)Bu0shwB=7Ofvwy*T#XtJix&Jg4 z(Voi_>a{w_Wz;o`lVGAOm9OOvOc>{wD?~bz6pLoosFpaWM0v^^69AA1*02^Mmk?|C zxn)@7!CtvisaA)$NX@>OREwX*W}Dr**oNUc0ibJj0k`55R>B9i}-zjKNO}T+sD`A+gQXyxIDMKWOZV_sZP?&q_20*1nZ)i)}zOq6?g2F*685T zYZ4u0u`1P#AJ|Q~p%h zCbP0_cwI5%T1^bar|XHzu3VbZEPMp=5>$+Yo9&5;?**gR6&r(LFK_}&S<>gXN@rB4 z!%jnTPi{56lY=2}m2gHudQ&>+*HQiDAUeO`5yb05NiLdD^2})6>c^O2&^1tX>S`*M zqGck(a8liWX3T+u;56m!Cc+^-^k$g*;8;<< ztbR;F$wvy&B%7y#+M>fqX<@FJ79b8+?%;$K{NhkSv`A_yEY$Nfx?Isl0z1FLyFND- zs5`qAE8myJiOFulp1OBGt`DU=mo7%KRELdDu8}qV&~DBjL2-(VOdFR zfuee1(vOch&sj3&t0b0ySX;!1wK4-eTeVzk<5{Wfh~_a{RSqP0JAIfdFn1`JJ4R}* z@<__ewU1XZt*3iE-0Ws!V>RI>8|pjy>;3rZ8sEYkRIEpKwZ>AJ?xl&T@OfB*rl#>l z`Q%tl;Oef!?7L_~F)qqHr|C`-@<}BPP1KlxryHjp%E4(V0)VidryBX=eNNbdzAlAx zWxskGYc%3*3bU)(R^AFDbY7{yB+}UXf_WUBZzBiu1?gJN<`%{mFFsl$UV@!%E$-!q zLSiN~XkDp5HKllLQiB7+{(6}gb(UwTkaigGxwv9{u5Mbgy&{GAWv!_mrfhVLOfe{f zIkEXMj)SIV^Ya=fZ3AYqZ7?AOj>@kl`0!XAp+&K?_8`{el8H6Xn)N$*1_zD0W_fAG zf$k)?wZSu_mjv|(_mAN@Mq-$oz}{vDR)Xy+KE4QxBuuq8++LT&SL2eK;g`I5IZ9Db zOcmT>Q#pll8Xij|Z-RK0+oePem%oR61jz*qxUgVbzlaI@4Z?%T;aqU-5cUIPan zDp4az4Fao9&+CuBJg$>fW7ogr@8WH8rg(`zCmfOqWm{VnC@i-6WpKh-=8VrN(Fj>Q z6o{$dsSNTXa9m%W)njAMJ#SoEl~AgwvSeTQ&0Qn)4L!u;Mwb&xs6SZMvzVDH2_)4j z%(D^DAa1#qWlQ*Mgf>l4Ds(r?TCa+2bz$fjp>iI2;2k<{KK`Y=M&hH0OSKvim&2vV z!{+D%gir@*USFe=)(?mcz$zXYKFbSFytocC|3sb3>{9Y3yE40z%EdIvCF5E>Kx0G7 z^Q7d$fmAfYNvNj{8{e?%n&H(rIVhn+J&VB?u||Vy0Ub`fcD65emSiaT<6hRE#y51h zC~sRAnkNG!*%WgzVpDSQ$Nk6DM|g=k4$(EJ5iKNzC_qYHDiB;%@+GC?pi2s_1|um1 zS*V#iEvulul=X$qfwH<>j+dt+V!k9RdO0 zC{zqr40%)G;*~UvTeWu=GA-xL`W4b@9|z~HK|6=#yltTjB*Br7({6~ca&Y-reua4` z1&W&z*iESOKO9tT^Qi~wJkPHmA|$BUCQI5q}V=*^3dW#r~W%0TzvBjU*d9_pWLIe`rDb051(+m{5XL z3yLjR?*||I@v&epyG{@a&IcQ-5g%mc_iwD)JYgLZ(A$T=GC@W;IY2Q$+LPkjDWm87 z1174y(Ggk4Vy9D_Cz7;U6&s?dV#{o1v|s22M2nqcgn_zIDbbrfeN?=zvEcBFG#b4r zyi_U1J3DVn6TkIPWtk613}{2JMF(Y#W*T3Vxgbx#rUV1VQC~3PLglH&H;fl(oJ=Q- z6sZGWNErM#&Ga10F2|Y4SS2C=6-x0YhZ@6mT=&a9ScEd@H;_FHDZ$-Tq&nPEoMugo z19BS~V{crI#g@#g1x8VruaZr$GmN-jGYVskv#E40hqB$um=K)t2TILI{#EG4&ugTa z!6SbE#+m*!7En{lcTkf`Ox2{4<~5^YckHTU-i2CwSBDDFp>g7aOVB0biZH@)QtbIl zj245OpzD6TL|(o$77?%ZyRHzMVyJL9W>kDj*JTwd%_CcYLyVd44e>oDRMIR^+zQMk zRNh%JJ0trHn0;~ymSZq)`52{W&gI~Zb7iuGTe3St=;X^86jfigUD{3)85wlu$J*Fy zo`dnxch7VY@tF)VJ9ml{YedA&diS&)^z%3r)WH@pDNUoD3=y1Thr7D+BcjE!__s`I z^*~ma2~((|QmSQ71dtB^31%&SO!T+1$W-|WZAAUKFMc>SRVOO`6 z=p+;)(Ye`KuxtWD2A-DppxJE-rAP&^Pyl}1cptmhPPHqSF4A9ox1+j_6(TR#iSc!D zNlXzRXFzH{AGDqg=Ru#DCl&`-gMCf;!BaVfi}7P}C5?_oq&oj8a>^f@_#Dd_tg`y; z3`ON!OspkLckkZqhDYzmm%=U##SE&+R7zF*vJ27|q1Uy3%Tyn7nCJNZ@l~r_>B1wp zlyZ(HE%|(D$HRT({2w~Eekc_Tp;fB(7(eR#Fzx4c;P|3J(1*BOoQ90NwknMBGu1JHMYCWsn6*UQfre}V8tkv*yz)* zc?Z;i3Pn!EPmI8i1dGNuUW#u#ITp3D9Z2yureKiYGW(*(ZL^6_X}6eO0Te}p)sIKx z7R%w1dFR3?BlX@}lf9qqZc@0Xp{bjX_C*QeS~E#@IPnxmI`YhVrC;#D&}*~L5;V!sdIr0G!@)z#I8;R2hln2K@JcA;N|nFrw{^9e>a z-=SanZ*!I&9CH!sEZrWCjQA+li1_6;%qyj0CaY3Gs1wUX9d%ZlzIvWtCw3Mmab(GH z()cZS1YAzOOE=-+6?ow!e1ni_aey<^bfdE-OIj`h-y7y&;(#Nab017xqg}v$(pw-6 z*;%*P_)de^;2S;nA2660%fXk44Ae&ozGQELU(0niOETs}*a+W%m4s&-2bW=Cpc|^S zlMVzi4n13da-{`m!3)}VaHfG$M|#-%t3_4s`O7@O9R6QKGzs3quPC2jC6;Km7A zczt54RwZQnpZ~Q^lB+2pO|tl8jVocsg~Oc!nS-KvoZNRA zxS#d|2$dW>?AS3Ha*e`awq&wdXhA)4Gso8e$TgNTW4E4+HHvelMk&*^xRY2(_>4^> zmkfWFcUrd(y^;|G?Kj*y4^bxd3vN$iMxOo*;*l$Z6535L+0ohru z1aIj6;Dj#g|TeKWd~>Gy$#8@v}DVP-3=iNQz7_J&!DO_Ct_q_5#|xlGdMw=hu_j> zb=s?rgk)DTiP;GKm2lE8#-b2sE$ZMTTuIg&w-T27b@F=mEvrqml@MNp%xVM=#tceR z0Wln2q@#5zlefF=i%Rr%RVfx{&pK<06PY)f?z!3wMljilTIBk^V_Ia#PilAuHb7AD z)OLl?$hK>03CV+T=ifWwAI7r7#Vr63JcamLq!{tF&RV-&^tDmhfUkW?2Vl(RRE-2J z%Y+e42qRvmp9;?XuU1L68%G2s(SO1c~gE%ok^7U|g)fn?mN%)P{Ofbb7 zYaR~8ICl@%C*2*(TFzcI7aQbkEWwDgDP9tocX-WovO(W#;_m_Jqd%Y$d0rBV|G4bb zljmFeFf0cvtez0GpUX8H?@IiKQYT1{;A}KyL71*Th%pkk7ng~D z@7EK4cC0Sdl{|RW0Xdf}itUzM%JiL@@2s0ZGV~XdZlF3bDcW!ReCj*nZ;JA_89(pg zE;A_0ov&ia-c=`J#MY%->5k#F=Yw*YgI(|Vx#K|cd&nps{~S@ZPE(Cvr$}@KxQg`K zvzckHj&(0*>pN=$sw7}Z^nYcOF|L3?DDJ?U^pho5}?R8v2M;1oeFy-hQ-G;}Xc6p}RTura8cQw0YT+L++PSt~~JLp|u0!gmhr+oU} zCZ4@;LH!N`tIlbs(mv_hfT?&53jWiW^NY58cgI}8-jp)yu=muvlRlN&i4+`RY(F7MA{wcTs_AqsR{w5}Q#?Yu!|yP8?7TO{#vm8D>+>)U!?5Abo6ZW~VX$bE&Ve z&YHX%-f8M3bV@T|*t@3oZOoav**@V)(Gy=nFe1KAQf1?5H8#+f;K2EXif>k(j}mf# z-cj2G@}yIOukphipH?^+t0CG0zCLF`&*Z#Zn6=?ykQn3I#L=Sw3bOU_?ekFZE(jVC z3m=kr<3n0nVeK75Itd0n41__))Z?_BXTNMF3zdnDaMGyzF|RiR0FFhjCR81LZXIqn zaIx6w5N=(tMmK8Zm3rq6CN7Njz>x$14viY`~&w%EMvtJvqg>4z&^NWjStJ+lAFD41UG6ZPtr3yQAl9X zoD~g#j^HN5uqlQZh(d`#r72Dt?+?y>j0JN@S+pAy+6QSA7EsgmKGj~c`G5+`6N~@pu`0#c#cy1f z;Hq`OutCMOsLt&YHxxqWAd#oB=cB9ofO%3*p^u?#%2+4Ovr;ylQTB7})JP+^VhaD& zbzF7pb}x=EQi}1#g$tW(xkc?%2uLQ5;1K77r0#LzWsM{r5UF1UNLQqB9psBqiXjyv zHpbaff6u|j899i&8GdJk7eU-}m~}Pf3;?0E3WE^8c=l^7kkH?#Bc}BipODo*bK33% zuGsUAb%3f1RQljHlMcm^WuO|;%M`&=MUcD-WSd~+ph^Ek?}|HP5k9|mc_>(gAUQfC zL6&=??xgaJ$Pf#IN63W~Hgl~`A{=kw(lXG)Ks~Hezk%{vu* z{qk(A&mI=&3dh_RvDx^t#0vKwyKp@YqIhOdQdu>+=$$(3xJW;>%BNc3{=N-aPxhs; zQmw*b2@#1#L?qQ~AMPa4tLnv*K`YS_V}MW<`Cv-ub^Yd$EVd?YO~yiS&Y2MWl74P? zeoI^X-wUO+Awujeg9F}FtumC>Y5XzW&dt$piBPds=f4$*;aC>M-PC=c^O|=>O!40T zoJXP5dE?3`OeE+b9^#A4t71gz_&Qz|#Q*;dtF5w!Qk7DpHM!b(|Hz*Daj0VtgO4f{ zR&Zc9m; z0P&-5I@mxc?mo;e{KeyAl=2_ODz)-mY-`O$Os#eL-QqUN3Wf>%8Z!_Md;_}-dFC69 z$t=K2&?_^ph@`bcrF(`IyKaJp71`pTU9SVneCpnS=f-l5Bz|AS6l2LI#Z;%f*=-S3 z^{SIfGf9#~3!Z6;s3V3aK~A}=3w$W*Ir$r!HAzC@P`%&({pMoJajbRK<$?x;(FRj$ zoVDN^G~)Cy3C@J6NOY?%4qELNmjF2YWe$3bb_;j@~=) z9BsHYpl(j=mhuhcZ}6;7LWl+F%>Fi4<0{EH7+F2Ddp-;TJ_HDmI}-d{M1brQ(nBuf zWl~_pWaazz2kV_P!7kTzi|p}OQ_S|pk~?#0vyBl zImlm99pMAdE0x!xV&BKISo4mqVUS}@;!Lb*mOQ8L_plNQVyVaj4w8oi^FXf*_Vq7f z#*;ocmH6}9e0S<|COPc#DN+hsaLtSJ?!a1g708D)+@~{KKu$$xw7mGk)BkyU79GA` z6{8fi3pIHoF50D%aci&yAsS9+yLrfy1c-{}fjeV(0O>akWp=kl`#Ih4>{!6I_3H`s zoVmBwhzow^3GLpio*~ARkIM(YE`scApGDG^(N4mG=f&-2EW0)XZZRic|B}CB%)y!% zi~l+JG^n^X+A<&X!$+8frkGTYw$=djqfbkolIk4Zg+_OozK5lCJFa*Hqo|Fn(<23!n%$CEEqp zmX%mdvI~DF683|7sG{d=FW`yf)2855V*!d>>Aon@hZ8&SD33BBZ99Aaf{j68y{fK% z0dw8aaLYo)yuwn@hvFi7#<@6Yw{W)t<05S|!ApHnyfUCAvl*VB=AwLLwvSPZCppJt zBriArZ$JiY7`!O*NuAz2$>ye7webUu49W9P`JY?cJgcUc%V1NInoUY>wrJRr6AtBS z^cE-bN-X>tCyhprahS%J;EDcTl`IpmZqxHtQi?{bhZ95 zAZB13el?#T_XkhzVoXL{nqhg_nze&Ff;LwJrOtBiy?@akJQYflV5Sew&}k?9Q?u7r zQ6y$O2~6-3a5Li{Crzg+it_<}{m)?RePa=aIy35&UUkuzU|b9{Gb8P{^03<-%*7X@ zJ(zJDt~g_rJj7V|Mj&w)-aJ3|MMH+IZC_5dCXCeySC>?E~{^d4#UW=%5B*w-g{F0CYY}3d}K|R_fN~TqKqh zjYzCBb0F`65G3P*s%m1ARE&dg z+nD(V*<(xnuTyadP;>iT(2HZY!*hkv^uhV**A`JH&=?(D z2WWnc4gD&xx}18uT=%ItIudirQ1o_s!+sAu;=u+ez+s2hR%eRw2C`I8aR9_@O{2dA zx=WK(NoD~X0xDh30Gu6ibqYer6e*|s3AufBtWf->Upbn%q?oFSDNRac^GY#An0r{z zqj703E|b0m`)cZVZTic}ylJr+S&5o`h3^0dCm&90C zz<3M*cd6X=fd+{SuvuCP59k(Bu--^WVK&m)??5~U)q%P#EzHtBO*nsSBupabrJDEE zty=B|V%Og!;<8C1`5!t)G>Q&6M%69@WQ;o@NU1StSUUefVovo&81@&n&bv!3W+{l2Dgb%5e}s?iG6`CLqJVbXSW=V_WM>EW3lOdkP5 zdk(=T_$3>vcIzN;I>}t>aX)}a5XSuF%>H>S^PcVXHE0xEw8aD$%T#6imJwg*)F9u4 zMc5n=7BEvpS3LDR+A5D+DoWlPP{uwMkqqU^0{a&(fi=uaPrA9z5Chwe) zn0%Ty=I`y@m_r3C#v*(5S59IM;EtyN*n$jhTa_T#lAKxZy}Oev!*u&Y0n|y?329zj zJf?ac%2+f4W~K31bWgfQE4+qWU&#;b4ho*R58)?Mi(h+Urk@(C%q<~1z0%wx{W@5Y zAC+5E?~{QjrK5Y-ml*Zt{;Cm~$69}@VX+B6!C=w~eRg#gs2-AVo9DL{iGhF800xsdyN&jP$S7M(V)vK>yQ z6R^<|X6UlqtIHo=8iTIAU1*i;0jvNy{tHVrJrd-pHE;_zM8E&2U0;2aw4C?=amlHO zNjXohuI|;5P~+H06&G4*#p>K_H9|Dsq~Vl=>z8R~eB*@loP6OK?f=@C^Ut!uIq@MU zZ^VZsT`O(p<>2E&f6)>g6WM4dC_+-b5M;R3=Q}#CE^t5G%z%+(>pZe~mP;e=kPLdj z$!3w%QrMt-qd(GUH%Kdgf!PT>{g^GxoW7(`kMsQuX#06ATkB`cZd_~@oX^%saG}ho zo$P%L*i2V-oz}PUM3ZklXxNoUK(Ycz8ZH*hJrpDvB`gZ4Xj%)+xk0u<|1^ZZKURlk z<5NUj2-b+Wu=LB@yI_+|=?aLbwlF;{!x~vE{dv}X)yrYk%c!&T&L!i$mzhSic^;}w zIuwjP;Skw_h8TJqlhCY7YH<{jweiWuS<&Vlzpn22!&uO)w!K0p_-wt>*FK{6W11OM zn@J-4L=JZ&#O`=>&57ZEFzbCtchgN&Fiw@wbpi3-@nJb#&h6}np#@vjx*ANizAi;K zyFym)lCD^1DiK}E2CYj1wX-_#q+qf?=@kh4V(bqj2(>t4E5l5`ZS(&abzZ>fY+x`P zK`%v;@lxg;PG!3f0MlbG1WdKIqrieNIqXn#HA2qR*Zn%U$Wi4X`F%3Qk7E^i`#oG! zO9&nDmp7cvJop`xw>LI1tcMOu9@kMI5DT9<(Mb&I#0mMaBDfSdz+D(Y;~q4iI?xa z)hP~YNLf8>+`(!}NFk4;sxS2|=!Vd2_BVw%Z{d`k&11D|eGprU2_g%Ra3^@(=0hug zMXSO5f!3gqhgxNnngLsAB>GD50Q3zg9|mp6;C!}g%_1or@V>du`1s62lf>jAridL+ewJA30)HXD^s z1;Xtn^)sXu?oH!{D_mgF`N>aeT>F9@hniItl!jG#n@IojSnwZp?rkBBD=9kTN}gTZ zu8wpgf_!q9pkW%R4zfPy(6}@-jnM0h2N(#W>nEPag+Fcnva>h6aT#{C5&}{wV_5P} zHW~|ul*A2AA%e$j^{xH(RAO5jK^z=W&0?kdPGdPrT~#U=dHnb2zD1vv^c_COA}N?y z+^iqi?|`~u#_-o^8fg^?owXQAGqZWDNobs^s-d9S^a&DvsyrO8SM@$I<_eVCfH8=j z8f!7Grg;;|-YG+QNlgmS1IoC%@_R5%3LDsUl}@613@S(Ooa*OV(pb8#=$1)Gdmx0KNN4K1**8u1r5 z;?NqE_8=*|tm&*J7?f|0u~d^|nzxerd#U4nkaMJ_h)f;>Rts#OakGICQmT?o%648R zF54ogT7ct8STGz;?5ld-6hr0NyT;71SjWf{Ae5(~Qg5!Q0X{XjK-XOxmZ)JqewXR< z&auL+C5J+Jqo#Agdn|Ba-iv~#)&}p&GARZ{tv*AYl+D|KnFMs@fqV)c2cz=`kP{*KjqdUbi(%2}L(ewL1{`#-K{pauZT;Kos@4ti)!ViB4 zKm0-;OqfNO&CHBdnb}NC4d2{cYAm9#Rn=7dr+kG~ zU%5_a)b^w`zF$$ z9&U7Rqcz&v=%w#l==~BBVKWmoHdbaeV>323VR)C-)I`KsMA(!~5fKD})tzr5!k%}^ zCgxlJPHS=eI33?xOE%p0ZF;}QPRuKQp$6ou~rIj)8;Wnoc8sjx9Cs+mPl$tVUh)H*VsMf?XNkj82z z&)D&;>+}Pqx@2G(H@de_Ds3&)bf7{TkC??e(+wug{1Z=0gQe!lIdQ_16z_6aP-Q>{ z-t>B#7Yj?+Eo{_!z0p0UT4{@^wQ}GdmB&Df1F^8!ZjG7ime?jtc8yjg*nWts`m+1 zabz(Okv-gKAj*Q;fHPFx7cVn^34T4xJhV7&bf-{Kqm4qzxgHihHf7)3)TE`sw))uSDR;_cqugUZ8Z4y?A2v~J1fF$NRqyx;;8YQv zxXfO3Ix*T4+DR%O!DDYkNM$tXxx|6n=EvAv;JW%<+0d7+6{6b_a>|h~WyF%>MlsfK z^t1XHbT;vVHl3alV`t#(-`Fp(*T1?0os+P=!W*X*iH;&JA!H;+>ZzoSQqQR!&{eLm z%pUr~5*9V#$$LdHieUZ_aZ6YQSNt`K*PxfHGxqO>TT9eRy)@Psdv6=XIC9+WE%g#L zn4;|C-~?mFpX!luCgl{8Q497>CN0BBOM9-B5OTZGJ=K=VmTEsUtz>@q6|uUX1KB zVR00|E&VRdd&Rq>Q8#KM+~{6tBg&tKYi9W0cgG6Y5-?2`6)^+`7T_+TrJ?}9*EFxC zmyf(kTk%Hs7O9u5#dr!^6duO{lrxIKTd=yP6@hT@MF3eG;?SI3R`D5ej+15+@qzvf zCjdphuV%5XC6=Qf`MP6BtS#k@V(sA^DJ}{ICVd~66&50YF-t&?VPyjuRghA1r@>1u z;7rH7(&W>we%4_LA^Y$bQf?bj$V5k~UV8EzbpYRh#5ojTuA74qD`vha1cHC_RGnU8 z&pH$Z)Y_llL!=hcpnRiyiXm+&wtj@CUMr4$KsDc&86zmJReD=;WzFVXELzrS+=%5OTjg3hRLj~9R^4~ilJ+1u;op@hFlfg`@z^=CxbZ&qiXuQh7(jkQ z7QW&7i#40Qf3LF*9j$ug0-_s6qm3w(bGCiNO$@cDv0ZRMH*l!oDNeZPiP!=$S@DV~ zB~H!8FN!{=EPlmWT3{Xr(Q0ut(BU{j*(k+P4qB2gGc6{VLugmAIhhO23*MZ6coRf} z_`E4sCUx$!#U&x{Vv(SW=ionbfUln#|M7kpi_XD?fFzm z)iCZoVawO9#o|Pd{^?pA zxZxVwKE%m0mHFwlFtu_Z$)R_a5Gid`LW(C>qsIn;(vr71qAC0*&bTlkc(C7G%mz6- zsWupzOw;{07x)cv!OKkMC3#~pIqm(-S=ndrKePNZmNrWHENegf%b}#P_FJWOl1xzuDY0CR`(fT;9G+KxwVx1dE}XT82v`~R$|#& zJy~mymlk8bbu<|Wa&v&^8PRDZM1M>mPTrl*y0VWBEYtAsV(da3(pY({YfDsO-6&C| zqjWzai~CS7Z_fF6w+O5i#^XT455U0;ATWV8;R+~~1C(o$nD|$FUy;nqT3Byuht(|( zu=m>fMvacxrb|8pn5I4>JnNagzapzai=GeI0`B8r;UU*n2G~MQDTghmoKBtoW9M!% zrTWR=rdI3v3LCD>E_6urJ|M}o1(3wYdu38PelczR=vq>79DHd%dZdxU76X+d4KEGO z(Sae3`O*A*#KI=?Rt(hay=5MUqldVnIdww!krTlGk#Ap{gG+W&&RB2T+ExKX-Z+x$e;|#1c5odJKZ%{>VSvVgcE@| zJ^>zdy2W|ugbn{t;HE!)@@hvszn0Vv=W_>jxL!jglpZ!Jq4s!qEnJEWg|9ARoAWHV z40Gl_6uWQnO2qoBG%_YsB^@^#AkHGJnu<`m*c!G)hSujanAb^`i6u zcRck0p>OEt^Q_Y;D&*sN{O91ny0=#^DAlQsAGDR#ZyDbCF^{~qvCOrkNk7$xDZI8E zV%}N~CjzFAs1LJj6h#CKlsQ8>Ts)5l3z_bDK`}gsFlruo8?~hK?ERXs{uGr(w#x`s z&c{*b^8qQ>{@>!hWJi)+S?-J2;5_t3ph5tF2cZ@c7t-74|NlaOnKQ^PMpS2JW%c7d zXw-azq>tw29$7h`{0TOPjk^FDltiDEY~c{Gyh{nL18jmN{6=y;pEu@7TO9DX^R{SZ zoL@3)7d}7nA?kDx*Jpmzrs;lE`c{K^X8FU%81G#0%6R9s-R^kUhT;Bt{}^_&(!Dg2 z8kyOkn6~qBAJp%~)8|tXL-I()5`1BbWu_%@=U$0LB2q0js@L|x%OBb-;Xsqe77EMX zMDxL2{1E|azxs6d%lwWm=c1x3_LS8<0%Q!r97Z5o1S(vQC00vhVdiN@n;19wsIxNG z$4MgCB(M(m$ApTp1+=G$qkCEc<2;emIq9U0GCG?DW%{hXtX2vR((wtM4B+9R&kRit zRBR7Iq0r=m5g)7&F_@wIEWC95?M5R&!1ztk>yvA76Lw7jQTZ*gM5{{DWggT{cLrpB zNDe+wHWYCVehfw;HZ6vPP;#S6;HL3uJDoOb9Gzc3PPQhC;DZ&^4wA!bJzh7PZ(gev z_MdYHo1zZNrZ}VPxMK>9sGSrlx!Hrvp?-`!;$*9e8JVo@cbvpx7t5qSC0pz-^ViAPMp-&0C5|yY@ElQ|MO8=^YPff1+u|UBXT4)S$pZxnVk{_0BFj)ecM`X2 zap{7WEh$ip&R7+ri!&VB85X@!CRE^G_S^t-k*)Cbt@aMQ?0$O#46Lj(Q_UAnc)u)9-UMaX0G-otF*1fcR9U==mvKktW`0G zGP!cwKDh)sr>YHr0$yFFn?r#Vn_j&dTYOPq&b+vgCn;l9VI}5W$;aXbxu)=64L*6%~V?SghY03_AT1Ods$?0*}XV)YvYfktZK}b-ODQ)dKm*)>>t<(`M88 z^VuNqQf()R2yrkYe1_CGTNJQ~lrm#z{4FX3W$1XbR&XskKba@Prl(YbQz`3-GhMk| zB!WP1AWhgVcHD-wq( z{0Q628Z(iKW+w0o9(~yPT+uDh^}qhlcrI|WeMrfvT=&{ZlU7wyS0w-ijz-){ z3@Pzx2|U>rNDle{-PrR_wgV|LBu!LY)1zDa{#wk0Nw=pHOK>@;SVEYjW@FQ4pz-`< zVs{)BsAkMUh`@}mG~6hD9Fd?jh%!k%_?KXQ4t@$G_~1`B{9XLN9MneW<-a?%yS0cK z>-wKn0ELARbTP_>VB&o7Z6`^mVAiMrjS z$-Zc-Ob*)Sdx;UG8qW{=Dqf{=>IJX4cdC&52l#=u3@sjqd>3i_=w4&WOB`^pkQ#&! zS(E_xZ$6k8)*>-wIn4k0pK_RJP>wD~qoP~7-nLA+cKIKBiz_!jN>W78B|MS{o%+QD z5`IE>`gCzWgbpnGjf=UN`wdbQEULti_3eHUtV)vDm@=X`$>`&(50a^VoEp(Y)>`~bhh#1MwDPxLGg|vu zpSgrK`qJciwvp$Ym35({dl=y$p`_8*fdp9(F>EYcu*?Jd)bL-Gzzy*RttFd;aM!Sa zG@Czp1fT8xh3Xn+J<+Qe%rsROgHXU#lYB>5ij7G%aZUEX!i3dEOV#*u2V*30jyTKr z?|N=jUu{%N53Da3@)7NqAraygK@wnT2g9lkwiwJ9VHEipLX|usF)YPTM0`sN2qYqi7MD)r0k}daOyg6kg+$f} z6LG@KPsyEReW!IXI6tmHSc@e!m$n4#>zGr{%EX+*^a%TWC(#lZ0me#|NjYo_V{r!2 zVou22K_>qOi@EG2T;8quWqwkyt~v4cLcjb}-nK8anx6kKWWPYw^bZcKra_)FV})6p(DWwoDW z@Tfl@O{H(-a6g_v6=qDQuN-M6>b^`Im~(z}zl-fz0hLcMm^a!NWxX+e`nwB$Gf_z* zU;U#o^2a?A7=QpsPEeWHk;cNrk0~9rSXfIeQZN#^#`fQ2rPj3u0p`{qTN`~))~3n0 zH1;ZZWLF1bp9;Yxi=Ean{ooz;xeSWtI+*zgaK?xc78~zl2QG!t#LnI}Lw7;SI z?^{bGu5a}u7*o7g!C394jP1?eq=3=fF{Wg=#NbIFO2$+O)P-ImEQwB4qin%x;9Fu^ ze*CZ&UuZAwsr_Ys=UjsKD(4c@!XMib>~`?x`v|LK^E?#5Y7o6K+kj9e67eo(g{9vn zfaM5LNvxHYDmE<;CZ+A3<)0rvuZPyEuJ+P~fsT}Q)XHWPzi2k7lGdO{fOYo6ykH#fqd{QnMJBdj9xJ+asqrr(- ztsDTYJKMM5%e#1M$yTH*qy1sOqz8d1qs;FTY@MXHpN9x;)+d27*J>Jyb1tY*oSQVy zctPJ1kVHaprhrga@-7BAdqgkU0h~Bm**NU}!f6)k7Q_sVt~({sZ6rY0ZQ3 z?mn%}rKF;A(R#X_ZK4e`w_{{QghXH8}<<<^v~x@BE|nxhNNH2=`>BK8m)YbtrZ; z>L~o!iEcKQIdQwpT$?0tZyj~BnA|_Wygy-YTa0x^*Y(qjNqg8=aqYT@scX7P>p7QmFGjZvl~y|DT>eIf;r6cIsH=%pZ`kJ6+NlS(E;v} zySNdVCUDTn;426@UK*oyzm~k?-h!pLw^q$quELPA4+h@g=QFIDB& zs6%V)evKXg#dXPhudGX9M!acD_86QoMH*52G1TD%tc6(y5u%%vAA_5DWfRwHu~+8S z|67xTH_DnE=S;S|H!DKRh1n$;Jw@-}j$4=71I-rux5Rl!dMI%{xrFbOxMeNZ`9}fw z^QKKMNm*mcjLUZ}x{y@3-!6qG*0f2~VJnlQYyBYhBiL(y*TmsvOXc2E`shngK8AR2 z#HF?@Ln0ugd>4WQGJqg>#c-sjEv(~;$!B}Zwz!tfrFdxzEz4ucMipaTUg)xi0mq1! zY1jI&5KRo9=%GZ{uXeI5YNgAq--*Sg7*s4S&pPrx?fw}0FJvj{IHJ>(dCFCyXEE8J z1c*P9(iodN1Xp`)R}ZY!;igMLL;&QhjaeCI-OT^|Udm*+BlerTd@@K!7SRPod>#f| zJdnPXDep}xS$S`=n;rgppACD$7>bd-0%JxJPnTaM0O24Y|mnwUdTCgw6Hx^0Ow zQ!Nt8$eOI8)*rOG{rFoW+EO!H9&B~ipUq_nJ}YZVG&2<0Un2)ul^Pc)t4%0ih!GEt zXOS}JQTgEHG>+L6Z*6&86xEqqIdIXJ7?q1*ojP1DHz%43QAKs-pn0UXA9W_V5hy4< z9&IeXD9uZ_r}oCY@oLQjNcu`&HRceToRU|@X%OFr4Kip$G;p@7 z9Yp)dR6_+7?zW1z;=MACMLf&m7xm+vdi~m3BaLz!=qGD*&?;G@=X(#%c`N2L!sH&2 zkByT%YO5cEtMcWwuZ)HHQ1LoHhg%3a2CYoU%cQiMSu}(BBVY&{Qh3*oT)-MWr%OMD zw~pv&y|Ow^>cft4;wXR#4BjIN45BI0J_9#^l=?MWFdz6j6vLhBoQhFN=cQXJf471?qb!k}aoOm<26 zVDfC!*x#E5A&}riq*F*b^#656TTgCmdCYjJS#ZWKyQG!Ne!8Q5oNDcpIwjehARtKF zno#q>1tQY5^a4&bSyT9qGGYd&uD9#55^;w>IkAqgbv8#h6N$$ zOBU#;sKe$6Jx+ix_Py8sV5I)aTDKl=w_dU@(W{b!UI4v)kP%%bcEm;!WJSD3R!iYf z$?}48740K9fjuK|x6yns z#iyczDa-pC@}^)Y53!AfW(036Ahu7pM@SrZROt(GH!L01#o~6Br0-*^SA6@r7R!>Z zAs7A2{I@A}-^SPS4qxkH7317W)xzox1hGhN7$w&de(G zP?9sJ!2OWoAXRlZJ#3-&4;mGQTCgdc3P|eD-=F_$Nn9?VxXX<&$<)QD7)(sJat3=o zB?(a>VRD30qyb4u9Y(!NT-lj1!Xz?;eq>wEt!0}g-5PvrymeMtRqb20dZ;0tFYuswu8EvsOpO+u`N zPDlbWDG-Rw2zd&bhUF&!xr`#v$Rk5Z-&+xUcrA*4&%iX=#$=VzHu>qa;wB;7RpXtr za6O1PthEWc3koU?*)gJgVPFVH?9E59Mu1;*^INM^P}W*AU$C(eO$k!b8%YXDJf4NO z&Q1@Q``*PYP%|n7riqde>SrwS=IxF(x9zX#eHerobhau4GYgFuud^eb&7BggZw&SO zLvJQs9qWBHF@@~4RVn14mx)XlBh-XgC+&Sa?RMJXI_;Jty7PvMqC2L9_@g zqV_7J2_fun`)2D#rSoU4x64zL)bn zJyU6l)jv9}`?VZoxC~DK6Gms8RW3R+-_N}zTy5w9bVQ<%LxOZ^fq{EyIH~8izUue2 zugaK!U6NI?=y*Evy$_jJQmMXtQb`n;Fi6+KAUiOLl;JlFNQPP*gusWs)cOyytTlAL z@2!i)hvZZ&K26$>*_-Q#2};`ENJW+nQy~Zlv3>mzL9X({b%Zx;DyI3*3MrSoIP^R2x$_ zd=GB-^>bMsK7CPWw@K@wl1)aJ=|;AYybqtp3Qw1Rg;l~V3yLol`3eCOq;1ew0i;oD zDl3J6>!FDC$MTYGEkRRpS2o4uU*@;7)*I!lUB)Z#ou91wz@D(bLKstm*AQoXmbN+{ z@Q)dWpSr+&G{q_BqqV2i+bAZ0O%S%R+w_343x3icd|~@4O4n^^n1ODz%~?64-NM<( zno^blan%mF%Qd|J~x#WT}F3k!5 z+dH2cBgsBfBdQYwz1?R_L?RM-A+auqf#ZqeRsB5!ESluJR?#Fs5hJ6wcS(;b6Gex%jBJEa^=*>e6E1?! zKZw5&ij>NBt?URnj@CW|mcXAO*{;3FjCy2U7ll@nb_u>fMnf#wsgRb5<-19v9V645 z9ipRXLSFlrr1{(y7m2-}k?l*#Ix1gE&Jz;5s1^#|4V%$u)H<2snu@M@X7j9E>U z*N+__qlJh+wUvk0vgdd|nb2vUb5c(Gvb=ljLU`$2xjmV`A*{B6oE&wSlwKu6msocs z<3vIcSpYXBTm!5Sf1iY$pE-`(wFs|`x9-Ji?_yC_dq2lU#2sDfL{M1oYIG&Xi46;Oz|85emYN`l_^$E322RXhB1>OKuDX(Q66uWy5;cyppt(g zC%E8DR>lRdPqg5K#mu=qmYt+c4zL|eJOm1LQgV2~B^Jrz@FBd(uZ>@82XSC1-m~HE z*Ia;YEh-i5l|R4%1e2W#cE0t~T@V*#=%iE{4=Jt?DS0%oUBoS1cWinzHK!6)E_tG- zTiIuf9wDO_=RJUD1h{nNWRi^136aZ@#bV?dLdu68{qeQBxO_O-f( zYvv9qNX43kKMZ9iP^Lv7qdprxfk?+1889J={t?Qi(Se0y}H5qP>c%BFMaTS zpC?0dFm6-ovB29I$(+sDNUdK3*H^o9KNiyE>}^pl=P*s-nYfrN_oD4u_ysGa&SoEd#uo3vw~}04R8(}Vo*-UW!mZIz1O21AMjn&IIz?S z@1ddW;FlOwGwiJFr;rL?JsYdPYlP;WuJasEB%(OwjG4LkPI?n4>X55qb-kl( zHO8qxGk9Jo={>s3uSI&XLHhbK@iH-ItWn9CJewMKj-RCDgvMBMgn6fEB2L~>pnd%`BDN{v;K4>!}=-NhL@M9|dX)PiY?yI;_TkDdF+S)l!ckinwBbR^% z2q&yOFbyNH@kBbmTv^Gt*2hHcZB{1gW%}mUdkxzP?2yHrQ79IwEv`fcc8t)C7gXtZ zh}Sb>MfyV9_3&PvUUTza-;bSg*68Auvu1s>*fx1a(h}~1up2i^@R$gV+#Je*BrgKp z;>@6i(|G50mkow+1qmQ>C?UJ7N+|B!-ZnIy01|8#B#&J`xFn=5!(;X~AVyfZMlh9B zL?Y?PVuVD3KRCe3cW(TCExK5)XP}y2=64P{8I^;X>{Y*asdq+sA0ubQ1$VJQ>|&Id z;}1Xdwd>?squBh#V>+Xw%E6g51KEogypYO=6PHMqwMdERyM*`T!lQYSzyfXTJKX4h z`_tGYdus=SjoND!Y}6^;+Cga{m47)9?WhvfzzFqcN;6Bq;_u(T7mar&s%ZQ&zrb&H z5Gjzb2Beh7G=Vudzb$P`uPFR-jxOJZ%EpCajWRBjWf)P|jW%aw&=xa2Yt(Hafz&FZ z(itSS_8scNVw3*pzx~tbnykHz%4F@Aad?-na}>4;MO<_c+K2CSNkw~;&+7L&PM5Qf zm+!Gc-$v3tTa|Qh^WpWy!=EOzcX|lXRro+YE=>!(#7mF;$;02EqPc{aRW5Ova_4s+ zfRv$;Qcs>L{Wv^6i;G~wKKrO^gmhitA)6ZIPusaXzi2_ z!ORA-{e3Acj6$6Tzyr%ARb@dufRl7=ZxDUDfChst%P@ZMNd@)n@0vgN*R>pqz8+A= zMkZ&9QARtPCNQ=`@|7NDL~+oGk)U=ON!)H9N5-g63PA*N5%BUba6&(J4vT*M0n`7P zk9+ToSKhlhQf8m9EXKAHcBOk8xDYu_QiPCjmvLVk1TU6Rp0y8OtaWRbw<@z~Vo6$= zkn~q0D`c3r)Q?%!V+>b`z_ZXr=18Xy19FFcG>M7d4UR2F$dp@uZ?%awE2~YMg6p?H z{$K#li{b@waH%BKh)LLbhMRn4CrdPC+@;k7rWJy-%7rk)ll@)(Y=}5Sj`&PaE@;hA zE5s#FKIv)>ZX@gzT#8wx;PMxi9Yzgqy0XT8bSWPawO~Ye!fiO+C!cn#MHbTan5~SX zwc08dY?-6d$}a49(uM|0_B0P>BH9WG_*32`UuCqyh>IqF?VS+KcyVVBtwq~yy2LB+ z;!9(LP0AR%Ojy_g1=dTY3L_yo(p*p{7?eFMREsp-yz(6nmb~*;ndBGRtly{DcTjp@ zjgHi(Et+0RR%v-H(Pq;z;gJbR=QB(GA%)v60VsXkB!v?L zt1k^mxLT`VUgHF8`%c;wWpvVc#%%e*9}woE!zDMhi(_t#t($n^*WQ7#dWZX#BV#on zC9BJP3CmXH62ObCb`6Iu5(X7QknvQwHXknCs(A7y*`ks+d7(p_{Y968s~}Bl_>YN- zbawPA0UK3BIO2SEwlkA^ct{XU7{3k_M`Q`UgjC&E;E*@28`t#y; zxfX90^KEFFN>19TRC1bA_V%%g4MuiI8vGXwZ6Ap;nN&C$W~GCPT#x>NqVTuRfbqy0 zbLdM818zsu!59^z4&lqTIASR$(TD{pndpXSk)-^m9)3Pz(D%r=vk@igyu9bo?v#4C zs)|GIhXhH71iC=+XboE(APddkahyLUMc{$MNRI^(GXAwHaPKrLPwn@;Ysq86H9-bb zX?!R;E9*lEr|rC$6paIsZH-jC(Lszdh?rH{yO%b;KJw)gqws4>uuf%L*0)9NSRauy zI_V~45s^xf(J?3pZm&T#>$eAJEql=JR%kIR(#*My zZDoVXU|~oRl151So;s-k4N}9bubxp362k8Us-M>){^hz82h-_eFh$uI%G}zPu1LwX zkNpXVg0D;N0%gEQ$3U!Dx`&Cb`0>U9#{0H7*1FYr8yLjwy!R?*=O@*3Yx#oc!%-p+ zV>^TNS25v$Q+;L^OY9u3ze6Q*r@DcW-eI_{(MQZS;(RU(9r=;|Zz##+7>5mZsG8&|f zp*#%GpVN|LA~pZN{*_!@u0`RCyAAl9v&kyw+#DjYH5rk<%IyOflqLxt!cpO4;8b`V z-&Bd!Qr*Hd&N!cxGd?Y0{tkiS)^TeDtANf>cd5ek+G7k&l}|Vy;Gi)O7gFWYMG+*+ z?IgA#Fyj{m?fT)tXOFGLVAyM;4^Fdl#v5gvvv$7t?jnRHR7~toEI<`|Pb)bvG0yVf zSeVM=#nIF7O1(gA&5s__ssvwpJ&Mt4P6r3YA!FocSW9 zbtQPGoGW388O-LC1*sb`QN`P_X~l6HjFO%@?==OxuH{;S;UPF>tPW*PKHLO|bz7;w zN!^qkI;gQwB%XM@`Eb$Phcw>Ah$hsSW^T35lNAVxyjgL5IL#_y7|a{KB>wPV#i8@Z z@$((uczg#Btwo8y;JDfxgO1AP7$)k!K{JT?Aq_B6fZ#Yp7YMyDn%c8{iAxT1DaFWO zqVp*#A6*EuKzGsW()b>IR^u21cS<#$8$qT-^AMba5lmYQ^M{DlOQGlWnpx+fwDx+^ zEoi&OSgnk)OIWha07vA(39$$xs?--H*66GsV3TmMFsNuL03u2Wgf5Y`(L_#}>XFX= z1ass2Ymrs$Z}UA9QVC9(koBC9zQG-I&P*_RrL?kK0cl4QVG^Tn+$L4dxde1aF5k}X=9 zlokTPDU|b_a}5s!UqvE4*^aQGxTF4Y+9w%W{Wzp@g>5ZvE`62sX~YQD*qQWQw9E-S zGHhp)!g*x?*Pv@;paA0iK)y7}5Q7UrfA`>?{#;+7cZ+!W%U)SB1&k@aC}T`nUasgr zUlah`e$)?=`Nr634#ex9ranEw6-(D0=NUMJ_Ey=ONv=#UzTa%8wxLFWaf$FNCKx8v6JMS z@d>#FLO%NL9@jMB9-A{U>gbh;(adakd$(+rGzV<&L!1&=5A@n{l^mj4B_1E>z&H2t z=T^e?i?zT;Rc#WFA@QH;EfZ&m`E4_UJ!+vzuQNF#q zWet^F%wPC|3#fgvNfqsv8RvVHf09#}it_rT1C8Z;CU}JWq|kyei$5zPtbPFTS~IP3 zY32bRYh$feQ5#$C#|IJgCqRoU#>aJ(Dr62~XTfg3VsHqR@d?cgv8|t|S}q}Ux{tGL z@u4_ni;oM{)$MjwKyhMG2UD^xddIf0Hr(|gWiq)s2D^+c*oxXxx`d0N?;}~|vDj&O6mvg)!#Hb_Q^r{v%)I~-?}6mO>yDt~ zppUCO{?@5<(g%Kw3xuGG;yv{2Pp?G){qXDujn+kBu0j)ZE~_ za1t|(;n`r5b!Z;7^!<}n7Tf9X+l+0|##&{IUhuz*5tK5{UGO_L&r})~=#P{UaS-Aj z@F6f0BBg@yoH{Eg1pX4-CXDh6?C0;T<(zc9wMW_b;#D?b7P+rFp5gTcBu5Ycw+WLA z3GW{b?y^75kzT^n#tP#nmEK)8gq1-ls8L|0fyfq=4!N0K-jjz7@I2KimmmFubHic4LR#9s^U%I<{ zwJ|S93LQjUn>@O(650Mt(71E=Bh40)5->R!^&f4BTQ;u4efaFNwpvA>&GIHBw{N}i znMvuXJPN7qk)u@U#45pawuQIh@6TKve28ajE|0GziuodEFxonuqcYk$GZB-rzsv<$ z4?K5ejv!bBIk_aGG=f?q+!4xS=Vz>{4g=kJ8j>16SyFg$Ek{zm;Enjq*?C1zIk8#O42M3Rx*}gblF=m zMpu$%0gWT(3Ty-B>`i;US&QCSf18~IAEGWQ_z;&DJzS9V$sD1J#jOg-LXzw;Ktxz?0ktj(tQuUw=PEIt)JwQEvo$g0fJvjv;F`8ABzYC000000RIL6 zLPG)o3^~Pp$#P^nlHI<(qHEoTG|WS8N)XxvQ=7y^Hx^QF-bONMp<$!{H`zVMaRKs1 zWHN%mSEwuw!5|+T@ZtDz2ksc7_t9!^qxCv^YsddvJzlG$_1?$v(_UMxwH`mHt+&>D z9d(S>daJe9+WPUEfBDD1{Oy(FFaPd8|1tC*|MDOI$@%ifznVYZ{_T%{{`dd%U;pL5 zXrnRQ5A)N7?2=Y4WbgbR|Led1pa1dy{^!pa{`lYj_rD!)`G^0Y|KVTEU-}_Vt+kI) z2jsx)TOEhweL$E)xPAyW+8D<>dK<@w-s($)TLKvqH-Y}szfFO{5A!qlWUUH5r830{ z`GYuh99u93tRK;A0izlh5e|}y zL@ zu7_u+Ft#xcJA%cXZ)=q<=XewT_;{u8zaDF8yf)j~oYrU(cHU>Ld<-t0)|f7;%-ufJ z7GGnBkNw2@V1*84fRaPzj*b43F>baPckj5i7K-bAP(EmVPX41EV%-m|Y;@xtj{W!= z8+^O~=Z_cR6CuD?9O7-NeuL=R1cpMl;H4RCkLY=r^zS8qWNg04+nbL0@J*=%?X*fI7-yGd zxQ}t=5OYY}6NJzzg9kuqMWO)>KSYzC;RC!EaFXmj+!p@OpmRS!)u9ZZ*!x$FJ>bTh z&g`%WYjX-&9iNs>xQpkm6D$o3c(KEij1Gt12#`K6+@_u0-_4bZbKa}s`~tDY=#Mb3 zH9DhXS^^Ci8avS&kPSAY!&(U#;El04$L`kS{RF>=$j3XO0eCxu&JlqA#Ql@8Rw}u8 zHvpTIeT>Sa9CAL_%6?SxL&E_y=%@%euz5{D2~rv;tY9amlvpfyy3@N2tc$=CK{FM9 zO#VXSdLy;_Y_R*Tu?2`+Zi44{1PEh_Rnge6^1#ay);46RIuq_QHHX;5(@1R*HIexe z&AcXESfWI2ZhE}~q$FF4R>|pbpJZsTWkx8G2710FeFQConG?RnR|t9i0eincHgQV1 zMKTzD=(jexcxALHekC>^_Xat7n+SV)g+Z2RW^u9`9rE@5^p0#QRm|PAAb6)sQNcT_ z!-_s1^8zk8Gio8IYNzFaMwnRvJXB@CJ;D%VrAx*ehM+kySVpfVp$Kv9#WDDIV~f!? z-i^^Y+mMRN*+zT1ub?j>npu(LMj(igKMcaHL-sb^HrD4US+|Xi_U^{|tdkDv_!Q5L zjppN&Nj(T8nkWzm1N0VO!EC2jY1rlV0uFCmdviC&rWmXV>iCrPDM!4z3SN_nBG9##+Mtl_jxmWH}+g8-3^A(n-W#@HkebFra)#(goebiN-)#u^hT?1 zP5cGvJ;{g=0DmXOFOd7@>9W2H$fC2^C3SpSgsQ)w)nih0!*z=?&?mlf`0{o{``^v@ z{n+i*+)aUxrPa#YxKzd@^I?f+GlJ?P zASOFE2sF>=beeSf&^uUHmA?j#{*KKuBfn ziZVVMdt!k6(Xf%cA4>@ccSIZV!7vNP6_6DSt4wI6u5!GQbT>$R)>;Ov=rNspU@Xy1 zEO)b76U#xxC2h{E_6mNeDS&KDTag>oN~1^oZB4N5p<@kNhcp=D6*6w2#@#O&MH`LL z>i85+d-LX_KusK4$G^(`g5KjJv(*Rb`pw~n+u6r4K^sd5N!eK9BA?R72_ktA6YsLz z%%aIMcf8VNqFvJQNkHS@5iuW`{;$WDTIJjIt&G&lrIeIOE{8?zessuS1w>h3O=Kw> z%SA|>E52m{RnG(re(YEV@(NI{4!K_^=sq^*VQ**NaPZkhXOur`mFDh_(&z!X8lyak zA36pm(?=$GtOpqsgxyM?+$BuCP|(eulE1a12ADi08&x=}NN4o27p4^RW{_dL;LK5! zr5xDj4lxM9{A2!;^%NzdKat> z$_1NFrx&h3tx0l*%%#l+2D$;jpmq#qr_{Np4PtX>CEd4eXe3T zHxVeS#)zZRryxqqo`xgp5-hz|&cD5rHJW^%{0mfK3WpM6R_yx`Zlg(-(usCM_ zxeRSve0z632TnOSv%^_vZ9U$iL-Jarc|=**R;ni$PhFH)=bVO9(ndV#YF{fsKNrbT5S^=HB#) z`~qpw2`-xaPRD1aT)$h8uZ%5l9kW=83eubYK5R===f&sd%P*I_# zQnRb%B>a_R08vU!p0zOHrT}(l z8&G|sG`u+)<8SWK5o)5-QAM|ix(m{S&y)nU!%+eOk!^=jg85+X!`dNxugE@bm5CPz zmQ4xYp`Qh&rJW+ z5iZRuSL3m<*3S7~terPU+obU(gtXS~k^rEwPRJS54Y82uXJRj_)D)_K&cW=C$a)52 zye=FLqBRwW{V+&m$*R7*+vjs*bBghP#*|_{nl)3*b{SK-f)Y0DvBgO=h*kpl$?RA< zI>$sVEHpsLSYjp($VfK$TlJA%ndio)I_74(FkomX$s`rZR>Sny=AT~aQpC^GQO;@; zIEyYzF`mUDTVh$lUFyOX?X^?3=)+Y`O?Njn9aJQ8_Oo}1q$Bip$o~)b-pSE*!6`t} zOug_&D*lPrVdlX)?GKUP93&Wfh9it9?1zt3|*c zkm?>%wQiFLot=<)15XkRN#FV_{K2NvI^WMNb4k{yjy{CB@_D`O>%E60rXvyw9dw0lyx>4ckaZM&0)6#i74tG>LZBr%oZAv0KN7J(%^u; zA_T{_7x6wgi`u7bRn)$0?Jw4gG?NNC46dJvytJNyT|<;&&p{>PY&2M*CP%MtM5~SI z6y5-=$HN?Wohc#75&~PKRfpMrSu3CA31n;mE8Jg3XN-z|CD4~xg)Js52dEV`gtZH@ zL9|F>AhJhCHGu08^%{F5J6H9qOZ2<3*1))1j0vhX)+C>mH3zjljapwEe`m(U zf;NlQv}Cw%sZBBOLZA0jqOJMHeETfR5v+{M)){47cIIqqy5z@0kOg7tBzUm!h$=&( zD(mjjg~Q3y3J8d+F!4mS<6A38+jhm9ZY&^Fmv~T|rKAN)uMlflG=c~D3@nNG0=y2s z3kY*&ag9t!Wt@kXU?-!nM#nmQ;}T$Orkmp3$m){!TDcUqE{sbGPDoAOnyKhyN9YiN z#c91Kt;eI1aEn!<6ZxY40L%Hr*wgZIQ|v?gk25k}WmohGCvF@^Ig_muFVCLGCIU*P zSBDr0VH%(~X|uUpcq?j!ZP4?hoWLOYo#t>IYlV`&e@N5CI12C*M!lI{m#k@ye_NPMt3C>}C66{JJ|f+?n^t_Mvse`{U%;@hO~( z;4dVi9JQIAQBEH5Uzb+58R_d&M{U=1z0UW+nYP}jqv~xgJGPX%BAJ$w4LloL@%l`& zaac%Nrl`r#eHOrmY@pOU@T&~O&&c(_*wpqHDWgfwWP9|(*mQ=qa%pIm+6!IP!62~T zrBYlry3mP{$LG(hL^C9t>@-CXC-D!6BE5azyA&MTg5>)hwBb1Qm{joEh1Cgs$)ZUr zN}y^qUsC;|ys*i>e#}p^MvCP0RYEVpiq>~+(|a3(R^HpBS66nq*e0NdnC0N+3S%TP zAtie;bl@cT#ai}pSxb#Tz}jO$laCv|H9DmY6@ zI$h3W)8fw#C}wU=0@!TJ?DOOXwMtHO{fWtl^YO0Hd*`CD$~%{|zrPSt_7WgRu_P5g z`~Rq8qf%j*$-+ulwiPQ9t)u!OMErRR;X}Hc%0nPw zn4}ExZ%j8qz(56fP?8Ov%+-D);VZ_5!eY3&iGZRuY8TY;Dc|p96YxbkrP5rb)uvDE zHCtI(QTc+FZf0oheKYjh+N6$8)m4e>%!DPkm&*&iR-9VNAQX{Kf_`m7N9 z*tGI?vUtd2Vs_an6OS8C&S>SXt<>}42no0%Llt@pT@%8O$$1CXYq(F6a5KM@Q%6-2 zYkpe?oiV5)khq9!U?G@|zhX(gKGvc}mv5>!j+a?mvdY%26eEP2K1#sobh5J_6)P!p z8h!Cx!snM^vrK=pR~bhctV`+0I9xh<)MtKlImN*kQcqyfIB}?iWPVHt+cVm{t@7P9 z4mS9sfM7#dC^%iaLAZkO_>~Jw0)y3RLWRlVo~(v2T?`MXrlH>Oupqx1OHga>L&{)n z)JYwm(mFDC33`LP9b6>Ytr^0nVKER&JdmCjF3xKp;ih8telMQ&#yP93H(sAAmM%V& zhQQ-8a3QP!&HymGNZ6Fcx`})Z;KT5a4Sa!Q+gL&deV>K1PN!^@bviHLdhJxF3!QCQ zM5f3%<(iXVm`{IXalQk+to8p zn))s%(8F{rf!y9emm|Ij++df*lz!7^w)kaZTf#dRZ^5#IH#R66yveI_eeJ{pKw>h* zI4HftjX&xF0GN)lfG8deOZke0*lqPT821n;*i@7a!TE)0ua%SYXc-x{F8P(P7l3<> z7=~>*b*9^2y~>Sa1L)=U*+pa)*_jxX%g)9#xEOuWZ&a|(_N#XGjCP_HU@yVw465`_ z+&ogM(&j}-fy}H`u7%LYUzhoFV~a@TCY5Y(xlJ)Hs8Xz59Y~imov8J|B)dRUtV+eI z%#${axg|U^qtuKKGcltpqbStz zPJ}3wIoQ;bJMWZ#%_yKMq%cAGO(7_rR zY-K0(ZDy@I*woAa;PFak_|%J6p~eZN8z;U&azT#oOIZ0bL^| z7v+-m3)5bY-!rbWO_@Cp@Rjr^fJ@R&fvts-OOf@+S^+lZ*cIu0c&D$aGQt`q=9%rF}C(Bncxdi$G?8HpW(yq+z5i$9qoM9%4rwE zFOE=)a~I>P^J^q)#BwYQpuM`Xw#_V#?E*sr=4)O2``k3$um2ijb@0jiFR85Q6Yw>!La|Z2YMqq~Z`h>d#oJ zk7I`p;pU2w@USTdWuwjRjK`NV2dtrWVgPkOioYOf^cwuK!kVB)>^!Lb>t_x^z6<6| zNnUGZO7eLnDK|RVhWK3eZeUjPrm0T77d#<_s7|L1D;EMeJd58|e#eS|};Du7CNG=xzVp?Q@y|cMGQERnB>N z>U^ai823fHWP_wmTSW?~JP0pAD`pzQ6s5|K>O(i-etztD_x>f<)`Vh%vL=+guD`od zr=(cuh~aGo>H*45;J||&{IX&bzarR{Jf*v6&uOboQBGSO&-wcs>=&_HrTug%c(Q^w zbAQxvADi*!#B#d7$T8;-m5sTquHH+_7x)Izih0$1L~}*sY5l@NOPc zd33v;8XI(l*Jyuen_WV)wogvEup-k1bfaMl?v0L~d>hY8RO}f&97M-H!pHN-$ybG2 zGnXE%_J=m9r1Zo5%q2Tjv^itcY$K4U2Ci0ik{`I!^X}Y+8{|!IH5&VViSS#+P-B zzFb!qV4Wx8D%ZLS$Awm3=`H|i@Fv$^4*4w@3uOhD$uD`#a*W4;z@tgf=JuF~w?DKq z&P51sY*uE!PW8qKuKq^GZ=OCMW4y8WJ;A@6OA>HP3R@a_u}FYW(jkbfhgEX`3rW+N zp*JiRSpRWWSFaL3x(3gVwRSOXYllS9M{AW&<`*r3YJu zXV`=@o!ma*75U?asQ7@|JhfVz&7A(oX;;v>qKi}3tka|?LwFu-cpDP{i``30Y=;m? zWEe=0DE;Lh|MK80x1F)4Njt}`hhWskV22C2f~r3$hYqWxE>iIZc1*y$-6Pfsg3tGH#qm(D6) zbpqAoy&CNK7tn)sWP6gZ0g@0uH`TwrUs1mdQWubk#zYlOI@6g;fCn}MA^{v5XO}iI z@$+C(Wr{wC=8ZrE2S@>UM4Q4?Dw$l+G6Xa5bTr=6 zv3>0u4|r~(%HcI^qEDHpI+a^4soW|m5V#G5C`l!yKT*IA&lVHhFw=x?wykE*UO*&4 z1HX<)|6L-VW0T#M70@y~oi8z|pjSoDn2!;SCsk+7PAH*y1Q||_5_f?#5T1=2c+X%S z@x~HUlVYHRn1){mjVdRGfT3QvD$hn&WAnLKE?Oj#(Il&Ev@40fT<{0~1d{-hk8t%S zIlyH5fR@D_(DPzxNj8%jZ4+6-CEzW0mgF({?u||E%^A295nqy4$=~;J>|^MhI8Sy9 z@TCq2>%%uUsCQ>81lySzrzQcS(JK1w;tq3*4Ps`F^#E9h z&!eM4wBzxCK`ZT44y+(wX4zSq8QCt&K-ed2oSe$w^8H;F>RqmLTD>i$pr~PEw94AF zv4IzGChgK=VszG>iGis-fI4g?pg%(ym&x(hrQY^BE_aZzm*gJQtDd z3&CY4rwLWAgquj*kb_Xg$ztNiATws;>fp;W;g@#^d(I1#nAuZuk|Qtk4PO|Whg=kq z^WHJjS7E>I_>xeHZy1eovCK)5OKO4w`*=Gzj01Xro(sST`i>^cJ3}5L1fbKOwMd&W zY#33Of}0;g^eVf!vTJv_$4^oe0r)}&4vBybTmOKiZ+XW`o16s?VNy~yuGXJ)(Q9@n zZPjP2zI?;l0(XWXYv6}co~DDMc1txEN%`mJ{_xm?oBg=>No(y?(q=tE`TB&@CT7bd zoaY_-kf=;^CYi)G1nf{HBp-a@qnw8TI$>0#`x1NoKH;~qDb^Qpi>|UE1nRnPk_d_j*t%3UN#D{zJ7(Exj&YOa%O^XB!wU5XG%t^lvZ^i zUZ42RVl&|wXAR`QI{*=2aMnR`?j|9PXCl5V&zk%RrA#)QdoU_57WjHttYhw-DLL`SB z@Dn0z7QP^w@xI_0>oKSj!g_M`<#t9kOf#eEbj)X)JlC18phXqVs?m?n?gtj!xR1O# zSekaf@N!KLet`I_gmKW(x}8EwFwfPHA?9)Cr zm$g7)&PbcBE6ynEw+E5sTYb{>OY~5qOHk?pfH6n%9)Q<$2lU>|5QHs2AB2edjT?5` zQRL)sv2Ib>uiNe}&vbxspL1sIlhO)|YJ-7?G|;@0urf0oO@7q)*6&D~H!NAU{WLt9 zm7P^K>@2pw>?dZ2rihAA30>=x8)Tm{+y{K*;2Y(rGdv6n4qw#E4`bUkt(RObvBVpa zRmR6H0W>!%VnoCsYdbdxx?7hQ!O3yTNp$Qp^ETx5@K}- zB1h1M)yR<()RIUne^!8VY_oGKSuDn}n=e?eY>exw%1f#^Neb)&532%)vx420FGKLE ztXNfH#!#nWrGp01=@?(BWADc%ugTMfOe!(qY>CavrB%keoR*$ogw~4)*6GQrs8^j{ zuFb5GB*5SXzCy4qoeFEqNVpcAa#2O+xB_vys1%So&jW#3C5-`khTWqLRuA_?l-vX? z(uc8!6c_isLZE$Y8)W^I&SZnGA)}pDMyLCS>v)tx3W$OwJ51*kVb|-vh z;xKhYfi*X`prHaxdw z76qf{lk+cy?o=8!6Ya-oXSGEEwxNWVC4o+!PWnf{7~r+;`H0yTmDP zFa~wmP*PM;FHh$#_?6h3xRjJWyuhF;eRl2}oLIeKHWd?p*q_FyXrnSdrS*I)W3NxM z;Xw~-L>K)Lorce4cmUd#)3hBCp5c*~Yw~gcZsO$D2MeimS)!2AlZ5}^r$qd&vBQP* zF<7~vgL2WXUQBakv>`LfC@9!)@cbj<(riE>*Nrzz)vXcTv!w?3wc&+2>r|3vV%4Px zfzN-h72A}3b*{Qp5ZFEM(O9<{T`v4#;z3$%GHonDz{4_~mKHCBeJm2AJq=&T@BSUx z=qB6-8v}y43(BwK*OxSu?ITqhNO&NEjnnuboHs=xDN2KAe3w{6dqLCsyKyt_IhO)D zsZ0vW*sa4x-*{vzqcX79#PZlAh(>J1Mnhu%dZPQz{bIFIoE*R!-J580r(f@{Z?O37 z*iqZ6F=wCAN^E0L-mNC=3zJl_=Lo!Tn1BNU&!E~JQpqW-CUh7X32AqLuVsBpc>X_! zNz!{oJ^iphOE$r)lI@BQ<+e~?N0OtPV~dbmlZw|MqrLM+dB0A7-!KKzXPob<(?I9@slyPQ=@U76zJlFFbVt_( zo6u-Vl7T@{SY~+5Y5#}Djz7<}G1h{Oh{dUpmL*(|B+im1QWd6>UA~5=u3RFlNtJ|} z7jJw`&@E@#y&E4?=uA?^uflA;1-%+`N@T#?8+H`YMNJ$^W_TVZ8^S1|@LV* zFC1{`M<5JDVhCT!;J~C;8gkq3UBWrGoMQpF6rDlRk&$$qel1@6B8gjBpyYYlNqqyJ zN}~ut-diWd!*KuUDbDeJSvQ|#x6=p_2Z3DhRx1~RUe%1tLL#sVtmZ6-2nuQ_b?b3g@z_{` zyX`28LxeCfrKn8ItEZrZizi|8C>Ryi&Z?jnVm{afq(s%11*e7=`wZx;pMcowG}D>n zf3x)Oed%hbcAiD;XhKoZu8K;&)-mAu2eylMsbC@K562`$U@nu=07FirIbT7RiiVeO z5qU|uj;}fGJvu5%*2?N_ldl&q5PC}EFIfuGvE*mDvpfsJ!yr;1X2nc0b*MHo+)6We zAXq;&Hs7~(9C{DhL7SqL)pj+Q$B(&7MbZLwMORGa2Nt(^7J}&+&?~#=-zv->3-P3M zyYJd#{g!RIjDtSbdS&-Z^*>U)!k{w&k!(Y1HlUmYkB&E}B`WwtF2FX(Fdx~Y&mB99 zTiw>BaF2kMr5f>F+J+(bX7<+T(@!uZ6WbAHyqbY3Qx7w&_>czohzUJ6cKMg96Cyu(?{VO16%^8? z=ch@}B7M0Ot!K*vsn^PMh8@%>GDxN)faQhU>Xs^+rPe&PW_(OW8J{+D^cQ#0yRa(6 zBK2e>C5^#H{^)%1>FMug7&nlO3pY$qM&EA;WDd#2mwRYVA_41-%tLyUSSA23*x4`3 zeM2tBcC?dF`hG%a^OJ$x<51hZ4P#;ffmdm zWv#Nm--`?vhh(l(u@OodS9-L8e-e1u@e2wLzrV)$`itW<5=q&(q&z<_R8hOoL)A* z64DJ(*-ipo2q<0@fWSo#`6<7)sb*egm95jba?Yr*kp}h>O<>SSaCoVOBz=gDRT2V( zM=ARtqVOH0{>AhtBNRcpb0AumFb%Ll2w49-uyJ$jK;53UoI)ZJGg+CuPDR`ZSmf1^ z53(N8xNt&C@qQwFO^91R->i2X+idr&7u|ctSYr}y6kShYxjbi#MHm!m`VeRfE9Mzm zruA^@Y|(+QdUn2Ry1R=nn5_-gC1q@IOC!@|c^OzFWyAE4v68hK!sFqfH#=Mra_6NM zjo=RTr)NdDIX3s2w!U%O=MCa4rZtwKRqZX*UDzG0sw!UCCc_ze>I z*dD3MvX;TjiXEC5{94*fNOZL}-kxzQuN!~eb-3saeSo_0!IZ3guUungUM=n_~NOa*A53@P&94u15CWL*Ms)XJfmT|*(Ji7uyitV zH_=A$$vJ<1Y|^>yJ~@rH^nhsK(>m04L0P1S7|B@(W~L!oQX^`eTFAB+f*B%nDR-mV zh9A6K!oR(fas_F1{LYd8zBA`F3y@K;GARLUF4Uke_#B%lJSF)%;Oj2DDtv`>+^{E}sDhph(NbDY zM;De@ngYl*e@8R+ow2RNI+W;A#7byY)-kto2}=#y+{KD{P=H~Wl}z&HEa1Sr+0fdk zI*r*C>pX(8km-D<CjQ@{cM0mkerWK%9l+%cWq zV4P;5gFkp8iv4aZ+4M)0AFTF81#7nB**C7O9gMvdB9Q}N8w0*$h-1AKCXf6@N+A8S zRQ&J8rjULmf^s}QCL2{ui<0*@C@D4vk+~tKOt>zHzC8niHoY;6YVy|bddOf@DCJkr zuAS~2?t%J(#RXM{Rtlcn7|%4LuGwX~8F4Boa+#v6&8v%6UzUss3;X(kiGhpZ)a395 z_FQNQgmhl^M(gk6l{Y19!D-dGEO`K%kgKM()HfQ7NCLC`Hn^~CBxrp7#9cjXs1b!>U$$zsUaHhNaJ{^KTGNxBvnPrOOOsxqBz-;&MD zu^H-ysp)T`4k4?kx9i6)FoG4S5F*f7lrX+5$fl7i02--e`lDoSD%q!Uz3otop z5OEhIz6nKv-YTgnzV>ASHVw)f2;ucT#u}@PEel@Vc*+V={K}w+#Iv#oNGKfQ5#bV> zXc_%s<*TgYAw&JLIG3^QPTDf3;0c#aQD&>yU6~xz8jvcGr4ss3S_N3elmj1ReBsDt zRS2DXMuOC=m-?*k&@*u|r7IenZxOvO{$DXYK+M zatThwqF1r*+GBG@l<5iBX#pE&Mk1sf!V4*1LaEtFNe&c_1Mjaht-+h0z}ruaJ-Tj} zldxD}jJ72xW3*fGwOpTQ)Y%g`Y2Gm?Fw1^*LMMWw$`S-m&~&^J2|4(R%1j-`HqTW3 zdc$8eb|1Pm&CYeO-Z*894Xbj0_I#WtuSuT_VID}E%z!Qak-19e566HFO087tFctWO ztX#))8onbdmod#{(}EN?o5roZAzSTL$TqLT2mYc1D5)`tWSLj0R){79iB*zIsTx;~ zK{aWJCaiMtjMz8Hyu;(|poK5yhxu88wOW+l8ta0`ihtg|*!`=?cE5slc8>4+p4eA zrxOPo>wPN9SReIv+{52kc)C^Kj!HF?lo@?sY%(BUz$A?ofq{u4(7_9LN%E%aYLb~F z6b&&&`!FTP?C&y->c9kNN0RWG&SQS%V?Pxbtw$Z^7TlG zOSbJ;25{|^t~A~zg-JxXDs0h9X^;<~csiDpS>a7a*%)};@@>NlSMH)GpBt2aBbX!4HHsGQarzzem2<`!}1 z^zbCEY1Zt7pJ(>iqaa-}wSTe~^_OD{ultVp2nOCnqk>&^?CXt%Olx>nPAbqRJ%X>~ z92rYha!LaGh7uk<^w%8Kjj`>?cENM@5jK^5Q8q8?-e0MEwt39P8-gS01Ez-nc6eaU zyOyj=n^M6Yc{YclY*{DvFTD~{+9z$v$VS~DUPFUNm%4&9wsipj(#(h+iN=V@G6VqY z3smTrW7Dtg084hPgc@g+vF?of*C&KSG>SY}df=@K%(>{U8$u$Z30tCxiljwnNUNr> z+~j)B(r_m$^3BWeeyl|a7c>xZ4nc)n7NosA9iAwM5S=-?=qXBzPzcgo!UYS^TsWcE z_t^JUW8dv9HE|ISJa@4KW%k?S%C(1>{(2;^9Zzv)x0LS;5#*9GY7pYKXOe?O2IjmQdof~T$=|5Hkz|#Kw?IRypj11KCzM_ z;o&R6bPH75b=pMz!Dy#~+0Fozt7n34a-T@e5?Uh40}xE!5TWRqneJX@TUH*cOG%fY zQZjDcA#zb9wk`~bh*EcIRdNy*h(9~CZ8m-*AWPz-U9wd^*_9_<+I_`?$sK8(ARS#i zWLqmL8-%crTkE!+H_og@>w{4y?zG_L5CBpO9+hS@i-6Bg5P?9$=ZSXy54}eZ&vcIW z!SMr+siTWp86ExF-b-sB6SkS*6KG;>;Uy3ecw5F0V!KJWks7}^(&t6Ejx8YQOFYOr zMXgNMd0owS>rfb~2vuAdyQ}47C|cqW=->i`j&2Yh1(Pp}vJ0?1Uc-TgGd4wK+`3}l zn2(SeE6YNZATZ|L4F%Ok6Bv^#0HwneNJ^`SU+kEY!`5@xn7A|llbYt&#eH;a%M&jx z!P&d0RrdZ@+sj-?*g?r@c?Odpo=t(2bQ|QMIi*QOx&tTHy#T# z>&k4xo>h>J{UM72GDyy?41unl2?{fK$VZJvwB{{a;6Pt#i}%M`g>?m&%?4%YXp>6% z7iW1UJ4>96dO?>8GsJ9=m%5HMY81RrT!&csYUSM^m(e>S#}l7SiYje4iNsr_0zu<~ z$1z19FG;|VObpsDpqBt{BqlG}w=IU1#T}P`-bIsgR3@)e*Y4U;%OV9^W1y4NHt?s| ztojh=wXNxPyR<_U+xy_N@;=(7DpzV0!5-lhYbr4b;fe<|nlyr*ygoBJNpOX_d#R@E zSoOpS-kS2m{Pf0a7x zVv5eHn35NVbps6&X3bhY$pbkdh}2SU{sDe~wF-v?tDrr1pz^N@a~YeimF;nP7H4d% zcR|^$v%1_smsQdvL6A})YLYi~;f2`X#B_=J#tsqwVw-#cok5$Z>g$2$_hVZDy+3>s z2sVdURF3OdMJ!j%B-PKvkIuGX!^8o=Wz)=~bm z76do5i{>Nd$S!%KvP-KaH{5uBz0~PXbUh#}RC9=p0qF_CeoESHo^F475bn$H$pz(8 zapx?r4`zp5cd6R7RW~9!m4122#K98@XZ6L+*_3ii#B6W?J<%&0%(?{Pas&c&cqhq6 z_7TnIOvgmkqyTp7^z_L5KIJKd2iSzP)N&P7z>G_ zjX_1{SKmXqdJ9&v+#nO{4@Q z-3CpSTkycd=Gf7|#&bJ93o~o0QrRBFeNAh4K)lT)tjSp6tu&!Xb!mBf16$-Tr6EP?=BN%Hm3~(~!jy^Pg z$Ta}0bFs`pzE)^jNq<|Hzf=FDru92xb0_ODj`I<8KDng)4z4ayh&2-6Pq;x6%W#Lx z1z<80p0Y9Qd3m=DwtC-SluVtAD)_i{1%Kq9{y&n!Mz0TuqQU`fgcn9KMX`97pcvyDrsx0 zj@jK+Qc0>_d}L-sWF}YZwe?koB|L4DIt@XeAPx{~e zi}_o{wRFMdmDZ9)@y5Z$okaUTmQ+GS#vhd z{`Id0bGA9U_+nmD^1-W=e7R=r_06pNsJ)I}v5RB0(MQEH^ic<pnL?i1 zU`q)4#k^W)l}+|~9CNz~@)WI&(FRAC-`f~m+E&Mx7Ik|dcdbzh&b^pdtBq4u2QweZ z-JXkHaroUu3byg5?sn}*uLCm}cv_eu zJ{^7V*(-h>1KzLod5UnN7)~zdfk?!7Bwm$&-?NX~FUDqPUSHepQc5r8)u*h2yDTi+ zT3Bs^krIp1VE+x9S+U93bZ&kd4bGsp-oAD&-;edYDb5`NcX=BtjnuIdW4))q=YlJs#z(vxPwnxwA=JJePPid2VF|WyMt&$Jn!=r}7Rfqi6 z>1=u(h`RtHIDHjPW>iA7$Dj5e?_on(u%Q$eUd*eD$tst8xx!CAqBKrQ?TpnpJUBYA zl)>2DFb9}L?Lb2C3!@F}0ltL5^^JMlAKRe`ahqL9FZR_&ZIzAg+7IUs)30x|4?aDQ zJ^UDa`H)!u_ka9yY-?=vf@ZoDtZ{TnxtQ#Af{Q*Ja%*i=tS``6yUuX~Fl_>n8jN(* z(E*T}7<9!XBtG@lVaM?BPhatUZ1c|UHWGOkqgUP~dwH^O3%D3DT5Y|J-r!y<=1Q*7 z8(lMiVg(lO{MN64uzO>(Y5T-iFw;vhAwSnELq&?RiZ-uZ=r@0D5M z81^4IX8Y+{*x6eI1Rsm?!C(0D#LW$8o7{P6;OFhsA1O#uE%)7 zQ9Q=xleM{Gq_@T+k~^<_+)m?($6opTcRtUxE}(I*&iC zb$run{C@1w)~rLDbbK+dF*%j=+< z4_yNM7l|g^S8Jm+qAywlPToa|aOlW|2&sE(7bSS|^w!*BzNM`>JFjx_*TjszMQQM4 zty9mF2t+5)@p}a@9&qGj2p3AjF(c<={2HynRz{z8MGn-t+0S-{zZ=`Gr@VIELF&ud zsbVkm>eGR@D;^&>bcoNyk~Eyw6#&89zdp6?>D=;l+IszBUQO0PE0cA;BJqJhAuZvw zHGvWEQ=+u?&$8(C94>6)pbh24yoRWZO_y2NW05Y#$YX@f?&O$wFh~F*g|?{!2>e7W zZJ&P7&y5{Wm&+b>5@FFfWnEm0dPs}lc;vaj(U5FM2T%MAbX@=c?a0{>_ld0^l~4$&8&q)bHBxc&|J1tCDB=pir+kVd%JpEgPvTg1uB zZRxCmWKvAZgnk6IOs~FjE>c1T}12!w!-TP+4jq0-(?Qo=0r=*JDSY*CB8& zTK!^PqxR9LsKdf(`H+=Hl_zG{Aq=BJ#!VCju8J$_RooG!xhAn_P_XZG+|QooHFi(7 z6AA}V8nkl8*=w?gqDU}JHHk_RD6MGJumpcn-U&;1{C5%mvc z*ER;S9GvssLa)d+C>L|O;%c}fKu+f>NwKH#7$(^=jor2nQQvlo^U)$JB>MyCm=i)+lih0wXmr zN-+FUx@&4Q_*XPqQQQB>mVaw(%df+-8V}jio0OEd3t@!Ycsxi~g@ATY1YvX{Vskw! zHUHlUK$qj318^Ot?h|f%rfLR+OKk&!5USdm1~3qy&lPE~d(W89HV1$5O=GQ&${1@GIXXgN6`8Yl*#|r> zWhPKLVaFtWb;!T{n-kdZW!mK2g0p3lOUmY@jm3B;gfx;P#LkBELPu8{eD)+$6N^Z6 zWjWN7g6wV}7jiP$`^=JusG`;%Q*EH326x4hEAT#MIx4B2phXsMRALJO6W2yOlkV*y zb2)SE!QqN=Q5Ea185w=52aM-a8G~-rQ4)c`)2SaeBBjd1#!53<5jSoy^*$J=sA&sU zt`8|Q501^pF9FxNWI$~9*xOYA`YYL1?1RX1bJ*Osv6n~@fJ z>FUH~1G4ZKbrJ=tq@4^O0jS~cKoYe|ki!4svom_q*cK+IP55BOyI7;FHrD|xCu+d# z+ho2>DRw#ty0q2>Ac>60$Ob<@^>$QO;NW5fhybB+{-IibC+o$Z=dGJE|Sz*QA`(83HT6MAb0AoGTatST)M+1aMZ_aVF&ufhhQr)DlquN^k}L{93&mn_rJ^ z`Slpgi+Ro3dzH;%?D4RCLT`jR#3+e*bZ$G6dv!`EqBJtgz(<{$E+|H?y}q?E-o6=u|IYt5^zGahQ<6bnMldR6 zz3BMu1|TN{-VH!Oe=EW$V~of|02NZi^XPN$Ou?siYCxJ~X}cl*WZ^`_SGJlaDIq&DIYYepJ~Z$xcIe zrx*zli#Ubu5}~6{n)>~+j~$qA6v#TPa86p8vMO~?{ioAm6Js|VBIqLIIgRI163SDw zVyyy&=5J2`W7~nUj)^bk#k|@Oow9L(=x|J;0wDJ`t)Mb`i?%DucfA5PUBkD;fgO0b zZP{Z$zSC)|jCQMz(jS3U^6?$9lLuUifl$aGl6CE06>N8iwx#s4L6t=;LD?Ly17Xrp z!wM5aMxcx1piGXgMg9qLs`!kl21qcSvh5HB0Gc}gWkCUyDiRlXF(&Jz{7b$Ku2>W; z7R9lM8EGQO-d!Af?cY*L{t07?$csTsQMb|28D(@b9~VCK`X@b5hyD96#+t6n%R-7l7h5VhM3qXhmwt962Batz1rRI&pik}8 zFr>_mwI5AXc7#04>q)d|n?>3qI}+p}sB&47zmuJ%CnZus^o2oJOb1qmNcNTI+#F>( z%4du($rfdNNoBR39C^adOgn%Cpgqah%q0y$40!BL)e=>7z#l@5o>`i{p{EtXoJ-oF zB0YHJgIjiS7B*8TVsx6&i8)+Kc5+S_=q?UIMfR#vodwVBtF4ir9($0}*WMW)9l%h~ zR+$i1Ywx*p*a#jfv0t$YQAAi>+i~dRt2}iG?3B-+nc&>4!}=?37iWNbQ*=e;l;RZy zjXj)N=M$osh27E=0xGSU84s321J^c@Q)adeF%m%&XSBilQ9c4f6s?ejeo${aF?H|% zY>N3lCT#VXOgnn5T~J<|)##J+y%Qk?PE6MeRe%+D;T1?0wF@3~QP*0PAEXS`_%%f5 zA6%Gi%3F#;I)t1F)+*ynNY|k`sGXF5brB87eXbHt$?vm>R=jP0{Lrt*%|_os(;RfP zDhIRNQ##0Wqdq%G?IdIi_3wgp!~xS$_153|%-8WpS=;vL9PWqr4Z?11<|!n&BNK}< z)~}rFnL5FdBPX5dW5_@=ijZ2+qf$zP6T;51J3vn1Xg}L8lbl(`C51uB=BP|^i&nT( zy{!-qD1|h!sX3eCYL? zxB)mh{sCY{zKv&$^$qYCto9*#B$4GuU&CQv9ou2t%AR$x7H+S2W&CPqI2u`NlikAnYM;Oc zai5c65(vZ!)plT7V|OwVS10~sdFD?}`rSV7!V2Vh>vA^Ax)N4?_FjCe+*T1$xXFxk zIJ}ZH5Df+_lUf>F4}R~GZh!h*x8Se}*NR5rTFJSnvdOFma0M2j1MKpw9rKzL8BtBJ zINS0V&{#Ivgm2RT7{;GILyT>j!LGwQi@Sp@Rv8^!T+t#PbCuKpBVFrP$ZN1a3D|?m znFM!=Ao3+H)M!r!CmV>};)F{&y_nbFOi{rv_3waS@F$IOE9*EWi6UF4j??+@g4yAc zK*89g-6upxkR&L3@+|kU#U#B#QuGK(#%pCvUdmNCC(Jr~xZjB|sSgW*@V@ce2cZ%ZH!bNDvf9RM5SUP!4ug==^!8S=QFD+nfAA*27|xv78LEm zBB@ZN)lr$8Kkl%sk~(4n`09UQ`wONj?LI7LLBJFBmiiEUV8?3b) zKB%}Pt+PcAk|6W`QvN`&gHT4vze|K>Qc9@G7;h*|#3$d?px?pcEl?Z3P;oTq;m|rL zw-GX9&U$j{=1AsOEII345WoqVS&~l?rsLbOT|-zZ2s?#Q{A`7xiH5-}IaM18htI1( z|N7V?{C;tZM_o`T%B=us%pE32C4f`Ig^z=GMnuQ%Pp`espPCm z*6SLdy^KXx>9+BnH;OqgTa4i{%qh!o?x{*Fk8KZe(M4tT;GC-rsrf&11MN#Ip<7m>g47#^mJIB{A;wv7`fZ984jxPzrI9 z5>OS7Db*J&n)<5Vet&F`aq9{<$QK*$iZWsAnzR1)`9-6K$LGDEE5+Rr@)~DBRg?W5 zSH&bVgqOl4q;4=C5M?8|D8fBJb!XxG_w&u)9Q%olJNEQwZ8lc9y!AL80Ru=zQa|h= zWSt62hOi)r1P$BX@iCpA$N^%1V_fD*-2De`U|4gvX=P?pG&uP|CuKrd)_PuJ!kLml z2{mLrf2R!8ugFIg{hOkADsvW6vI?q)NfW(K zIgh1rOr>`*WYK7Tlm%j}xfi?DF|e-NWEYevW_1jN!xK}1K(2-@x`K2Ybx7&kWhFtQ z!7{kOH8sj`h>t_S+GEG|6JtBsdb?J^LCQDUCuL07q}Y2GS`InM=)Rf#53FnN+Dh&i`sc&ch&V)?(0H>l!{Dv=XZ)B?D;dbR;j*acDnVVI+Z*yiGx5i~?lLdwYDlaAJ*Lmhcm`TveZ&^ z6&!PTS%P42tXX#{A@@7Sc5{?_Nq9n+OES)?WZl*Qb#|#r&V_m$wYv(NV~p&bo)SKB z4Dp|oxaO8%1E;E4hk%SxXXW4%*v%)$250lTOW5;^d5tC|6}PBy?`j(c37`O2C?Go- zb0dSnwD^sKo|W*4_+I7=XZ3TyVKYNx_Icv6c^i2R*!Eh4GeaP%KlFb11(QBW5; z<00T-hzUq}A7#JiPIAXO%cahHjk8Z#*&OV8*~5{?>Wm}x01lFZzx=P(rr^d)qHWOoSm`aK4@#^#~jrj0RUJ2NAD(WFImhCi%1QgMy!cTSBD{@NEmb6V zd^8DcqZ&9wSAau@294(G&b=8T^spEa_=;OZZ}8Mv|8lG)$!Vj22KSrVpslhYFYjg# zTd(4xaQcbifhO5xBYcT2TYx=LmoTJCpjr7nzq6W0$C_m<>o^;o!E%bx%9r$Up9CpA zZE9BN<8vnAW*Wb*>Up*jvf5-k>sp!3KWtnrd*(-tR(X|=p0a5d2gR~Vrq~%%x=dmg z<&!0Jo@{*exw7e2ORX(?*<!^xe7a#gNT&`VGC+k22|H7fr;eNGxc{@;X-ErZI z!Tp5MDZiCA`ok#T0b$)-eX@)()0sG2RQ^DU8QaC*VefeGo^ZCdu>rPl-1=*5HpwVs zvt4yZ`A!yBRA%X55qn{Q@)9knEzbgEBvX3t^{w&yu|qI1`oAa4^TSq+HS3brtfh>_ z`(%_43p60-fQSg#FX98? z5asPZvn1EpEF&)}Q?$!3=GB#=mDld$${!NxHfYMs!;s1js@2pNsHJ>$Y8&3nt2<(L zwwMrORK|p~w(bt4B%r*Cuy8IVqVakRaxqj?^Xrt|`;^9jQE`r$TL0=SJ~uX7-R_mp zS%Y3Vqqe5lcy@uv3eUDid8Yy(CbDBl0(JQYO3ti=_*!hZH`bG{=E5s^tDP=I8STt^ ztI&Dl32_k@e1-t#1(>`W+zOBaxyei9n|{$oseFQ$srajyb@_8e9%~`c%p+T9Ec*hA zG7E_1gBy_p1IjQbiJ3{1fIUeh^*Nx0CdiI8QTRb-5BTFhv$LDyc~_$hl~wzqyje9AXTcY9 zn!L4GvhJ+x2&ABiLH!(7_xvYjpnCD|!smxDF>cx4A8 zS|{S8aK(mMM)Zz-qL_)Jq9&#^&)>!p*ykf<|YuvMybV6YsrojH)I|ry3h`?05O9iwVKLIW- zJP;~LpRBbDP9a15=3Ku%wrwpdTaj}_m48lJh2qc3@&&qP?**708~}tm7P?T_A zAavvaRiHGcEXn`Q1sTL@4O1Wd>T_rQ+p(4=`i)VffV!R-vI;4$$ZlsCxau0{(;*MR zr!(nPTkUTo4pOqxn&cs+(Fh-4d4`}|w)POM(FmY{Q%AUJy`{p7$)4ZVJpII_4d>X= z(RSloX1MSsDC<|SxYMi4xGw5H;1K;CT{iz%B1jvpzdd*j)8B6}`6e(XUa?_ZK{>~T zSI?{9wnD;+=Oi~osKdr_`v>jxz(7!x6f36!A5SFu$v)R}Z046%-MidOZJajBxbksXop5=PnDBeALUS7cgFt-0 zwusC@?)4%7AZvVsCDE*yX`wVj57r++1@Ff1EpI!C-mjC$@&==AR7S75q6qYMeu|?X4bu_$@1<{a& zpsbG+r$`%7Nsv4P$gJS{b9ux{~@xA#}#~scIv#&$}Ub?-G#B*GS3s zTxEYQbby&ytTJiqf;|y4)#J_sfe;Fp%S3vm1MXJ^j6f}-PXK4?L{dNdo1pp7*v^W! zd;6Y`%#sA<_SX=fg+FXyf|DgQ?2|fH5(E|ybFRz<_X|9W!p_`z>!OUoLOw&czBTrM zbNR7sbVk0>d6l_8! zP6e@vXZ)DXyGONKu0|d2PHhUYC!jDI}L-y$DC-4paW>@*lzh zZ{;FU?ynhW-wnK!sMDqEeA0iRI!pghtU9mHZp zGigu2C7YL8;m>JAV&j6zUKtncmUgIrB9(bjzQ^d(;fsw^-=P+W znAd+QEhA%dVEHuX9RQwRMz2~pUSI1gGYAoX~6GO=?sVl}Po3=M+-FfY5mknkXc4;I- zys}i%bz(wscQ6tWb|rs%IdBFy3NC+Uh2E`!A%4S4gwe^+F?7g!F}b9biD|or$Q>JrdMo-U%B-Dknyd?3{Au{G zo<>qh|Mr)*K}Vm_6j*!?K^4Efu`At8{;y0f|NjIwLzsXNfzA(Ev?3saxUxQFX|HjY zEV<&nyo=cu<#aUZ!vHGS6;d@E2t)`RdH}R30`u}A3KTd=q`yJGGJyu9(1DFqeWd z#;-K&y*KYv9-zyQRl@7Z?YRw=J0ju?;n0|TS2QS680m0kT8t9^Q|dWCJ2oD&`W9?P zKV*(6shn1&Zq%nWl2YLVy07K#Yn|kj-yoe>gs|V8&SJo8bo?SDgD{ouU(%7xyuoTo-X)w>{yDJ>sXS}Vm|3A*&8w$)ITtIo zp;G`iee*m#Wo(qS9B0b$GJU7hx<#~{sS4(Z5PFb068r~uO`+9I(I}nKQCnqo(*EOc!j=maLR*G1RhM z&?>s}aor&K+L&hvCy7Wwq&xiE<%?f_&h>Dsi*l-{&SYnlGr6qpyhBB0Hx*H zwWTZ;B!8;Hp*q9YGs?f$<3}@Tg7Mn8$oIIr=!^<3ZDNc*cmmq zTf+Wfb;yLlgU#C>q$mVxI?yI6djxVe$}G^Cd1!t#2CjLZT3U(DDOdvjhf`->gsHOjXguG^vEE`cUaSIbscB2g|D>NUT0;s-^xA?iCbDtD(sMejOC@`>S4pUW{jGfL_-=bFFt=Vt9uVp zt|=j(7OXDOt6+^b7bEd^+S#O~ri%E(st-(t7i>ZIrt5jAHh6=YtEVusJ1b;wg9_P~ z)r+A|FDZeQ=Uu2HV-z*&j{hiCOQIJ+ShlP^T-1DLY-_&ChnOtkrM5Xnnvuh?$iF%LW@cU*_Oo8+{_~E`|-?^t9={8=G%6yNOE)YRt+Qv+h7UUpEWSF5PgD z7dw$I!J^nWo9!@N`Iz9NeyY9f6Jt%o>bwOrn0~OuY87nR?$*0Ceb_tF1QN(9pOa-i zbXF|e8CToWxV{y6FqCvZWi}k!oUWa@>Li@aS=r*8TkiMNB4{_L&4E6QvqcOA?g@s< z$cJ_vdEtobLA|z7S#K7KIIf&!mCa-ayl;a54`HK;-CSjB1b~C?VN4~P^g{OH z8$skZW5Z15^vA}Vpn^4iU6Xg`&IM4R&YURrr%fGf>VgEl4_tt^g+N;ltfX;iSt-aUC`j*fE4x33->Fx4F|WznP*n2HeoSh{5IBRt3xF&SK$)>JHf#=- zrFO7mUU>5GfxbKT86Ea$bS!+`uioxfF2~wRDuzK!ltIo5Uzl*YA#f1YK3$$Hjg3Ojn{I~@3sV-b_OsrqD z2Z)hBH|IT;9K^`wXtP!>N9UIcd`N%HXrctCb(u9wk;p($qt&<=0u$!t5Klnx8*Vq7 z6CfV*CL0yJ(@X8Q;j}(M>vRGrLBUR3^35!oV!t*Z&D4zLKT;|Dkz_+AV5{?Qp8prp zTrv4?Pyd@^+y5iIZKE|QDjTg`5zXDcwMueiy)vaurb)U0uXUiFk5bZ`({X2wXfj1- zWs)g=J=Z$WMKvx_#&Oh&M;gty@@=CoW zxnZR?`jI_-%}5{Qn()m7XLz2fC|Mx6yd%n*~BKIRxd9Q))JTgZlQ zh6%bjWrB&<%wj%ghPXWlzXuTl`Gb&|sZ3JDsQi=&o(%d)Q`(HK#GP?up`lh;Z|rst z@aYldd3o&GeE3;v1#&7A1g~Zo#c{2&b&LZu|Am=jM|ny~v!68K&x~zRoL;9lc+VGA zT9Z>y)|3SXkD?-}s3S_Hy5Hrzwoei5ojIjjJneM}*($F~T*V3JTWLf+8{|jAp71Nf z)*IL~lIxw}OTGhzP)Lv=f)V>reER*9KNh1m^nIzJvjxIhubr}XSE28`#Er)VLM>e+ zTa(0ZN`a)b84q|vP96>)b7djn^P4fZ6SZFBG0|}-+C&wKUYGvfyFUc{jZUF*qsZ40 z4`h=W8U_Qwr?%?eI2{~|AgnJA=ij?%l=XhK++00k*QGIBXw)&_k>12}6DqQih|IQ0 zWnq^Pc0Zs0l{2;5&Xt0(Haiaw9g0^b#H2qwOj37nsV8-^=qa<$xecB#A_q|=8YW7r zSAQVNZii{3T0(Dv)iD?qtWI{#@4V!S@BjdUnV7+V2?&2V=BZBCCi^3M#A=qOO>En* zm8-l|B4=ID$~f!&RdjIYjd*BL0=N^L&Dtxr_|0A?7|##@&%_{p2$BLjo`@Wn=4tdG zPn+lmW1GLXx9-6v{Wmx3-|G-EHcJ#k0m01Kh`|sN@+_` zUo_cS70q^S-1&xMN?!8sf^*Tnwl`7U*6^mP{&z)DC3nSpf2Y!QTNS_WFfpDA&tFb(F0%rWw^X*_w zZ#5gtpz5@VUO8?3Y8$)96p*BEgXnri9>r;fDsL zbkuJQ#tz8v@G00ewlr4En!?=vz4)qhNAu<)-eDy1ObU%~K=EyVaCNS+vyHgH33)HG zHQ6fT?RE#?`3fZjA12OFH$n)A)bWtY+fUDJ+qSU78>W9va<-^olK(}^Daq#qt*j_$ z;v*YXRscC}90f@sMm*8%QlcQ(XpX>kpPj=aW7~(cXOt}8!4SMr#zyloOsC#MC&F60 zA^vaB=My=w8m94&FM1C#eSD$Y`L|=6PdQS2Ci#?=NnvkCJ!>o2Y{$F4Nm{$mZydDB z{gRsKfi0CcUC)gZs3U1l%$&Vd{FdiU_t#@BMtBzuEnXoJlk&Q3?ThhnM3^F_2$sP} zu4zF$I29}kvm=8pn}bE+_<%o4l~BH+!#+AgF31lvh{!WMk-0rOb{DlbR(aqgACihe zuh-ArVLRCW#-uPn#o#J2*l|5b;vO;b4eOY_vl1>VTC0PK)|T~_rUUG>!R;Z8o7X-u zni9Ifq`52fWJRMS2KZN(hY<4QVo)h;M9-h;3iw;Z$ia=l zffXEIyD)S50}3seo{%9CgyGq%9P!Ry*@I4R2ak?8jlYa(#sLFD=$h|@>OXdU=J&>0 zWwI){lE6w<$eO6KT{2Y&XMErxBWakgU!qosGsb|;M5O%l8T9$l*v!_vYf@n0V=zG( z6U~+`xKmXwxnODLX{5X;S|KvM3gX!-3m?cD0HkxoE~Lm?{+=<*=uzbT_yoT;b}x3^ z%4AXw#VC_}5TVu7d-fk}lIy7h`FhpJkG-9X_K1>M+*r6>g9Rxw^S zPWSlLxoyBEt}2V|mMEV~R?e68X!%YuYD{!PJphSp7&)jfJ0}poI|YWyZ59qA`^rd- zQ~RYke0pr#uwG(vc?1_@Ov<{LmPfdAN|_J=3zO6i`G^n>nFD6VhHp`7xnDF%0zWPT zuN)CL*qf{eaR1M&!iQr!3-%V|8Eb5?%2?x;Oc2jJS>*!2ENQ5c?WQAQsDOoY73z@i zP(=)U&YU+SwMy-#UYAT(E^Wz^JJ%0TT&xo2L}iv_o^0Kh)W&UXv%PhYHaVTFvdNkC zzVthNRScdppEF$mt9&|ZNF+1TB>lmZ0kIN`P@gK$ZM0y$B3VR96Lj!enV_RxEk3s| z6Cp6?o#m72vx>F7NfL-AMCpU7Ta|bw;X(Lq6{5!ve?7~uWRK6WroET8aw~mt$tdfK zU)9|1EStmD;knsvK@LMLwtu$tZ#z_p{W>=t>E0Hbl<`jM3vwPQ20CQ%Pm*xEMjsbZ z6*z|>Xq~(cVgmp9)MI~sY!mcXFQO|R&7jT{?UgenueqIfyNW8->lklRU{D*4WhNR} zbq%<|6#l&0oQV4>$v&s|y<_x`_eV(|!h$o}daIn#ZneVPdDR|>Q>U@;VvGt_OvuDL zK!+qwI}aM;F?NoYLp#Lo3r4D9j}V&BSi$w9==vK2`@ykAalf#%)H^s6QZUMykeB@( zEw!EVp*-L40rtL$>;i#|*LV-<^6K9RO*_a+w@>ViDNcE_VPk*pFgCSa-n^10LLcf< z(LezeEm03V>2?s!*`)8Hk6J|+!H7pz>GI3IHB7I zFBEhIaQ_{r@;d|FcBYuam+KHiR91(y-kxx$dK10_bH#K?vN~o%J~D-fCRbom$l$L4 z7vGrSKGtlEyPb?L#h0RdDPg_O|0J1w)<*tVv15Sfav2S);zU;#4h%NhMPI^>u_@&{ z`*wHiW_0DTt{%zYOm@l!XX84eXWJlLTbn}4jC+LeMD{c9Fv~CC`KHi_ilWBPnK=9s z4E)mA=4;Z0Vxui_EII~RWd?Nm{a-n%zkHD zYwXx})j_P5l2nYgDisqyzKNIx4`hlII=FQmf7EG&%uu!!$_GCE%|t#oHrq;H7;mz&WcARm3PF3#a;d~nHm!Ew>7Ff@d^MNgs zu|X@Bj9XXC=2LWRlC0_s%Y%6wtat<3pfBwF6zG{RcmYZogwle*v2Xp;qUj@J_n8-A zkR9+gq@=u!ewB^8JExKH495!+mE_u45z{3d;3>?Zc^UIyw` z+4!Wa%XZz1bMLNT7BNp2C)MICX_4mnF_R1cmTbU)gooY7pTipAZ&~Uhbg=y~wQ58E z+1~^cRG!6LqH=NT<~%MBV68wC5;Pd`-!KhwfG&x}`iqNne&21HHpa@^er&e5A~dgy zyUxCaMt3~OLFnD8h#u3iQ4gUH6v75aSnGGL{&_dnJj#{Jn$E-eV3StXhpl$;jyI#z zrV&+=6)@A8r2TvXm_A<6`C*{;7HzwLw7p9H}oGibhPFgV0x9*+W3`*a=)xZO2dRLTp z+touM9y<;6Fq2Mg$m3q&OV)Zxr=%5+KlT3DE4vr92cmSg7^|Eu(Ol20Pba`oe-PT84YzoTgvI*-)pX~(d@dbO?gvrNpg%2|;3P3t9G? zXYh0`nV?)+uMu+Td@>RIr5Xcg04vzVw|;)*b^uj20A=7kqmNdZ7|gOBdu}Rd0E-7` zDvfA_mj$A*3=ex9(9b^H%~;R+J|WIme6)S9hBEg{n@fDYqX=c>O zL%m~B9Nqzf@4;7rHX5lLU5AvbLWOv6ZeJX`3)#v*QU<#VrKq%D0eeS)ZY<4Y4z05N z5Ohu)A8!btm?F9}S%K(a*Qukqwx6s+-Yt5)GGA)djMphBy!l>{6pK+QEpC2v*)s`E1S#1Ji3b!HW_O=V zbRkB5*jcOBzThW5HFhd+)l=!@qM_$?u0*Gt->>~UNIQ|TY>G&FEGHvmmgE30sQwB! z+s5wo*7bxUy=Gh=myOw;@_cE7q+mLpXGl&%ZW?E)Cz{{CZWia!xJ@yY5S0nr%d`%s zJP$K>n=po;rZ!qI{zxJjfBWKN&aq*{a4e;d!4<813_hJ1$%PV$SKvUq;Ba77o@HvF z^tVl1F-vx(oQ|6z)z)Abj~|WCj?E`s7;d|!Jb4(gPj;d8bnX(t8^rnExo2|;SX%RG zu)ZDX;8#S*awh`btrX(w%s5`j&Gr}xYn>gNeT?yjy=ZWsa5=wtqJyFR?f(JOh2{{- z{r~_UiwFb&00000{{{d;LjnNdIn8}bZ=^et-TwZH>GgmGz8|&eA!wNJ!dlD_nC0Er zuor%8{QqI#oZv?)nNnp+S+|FMOO;Bcsu^TFPMiqx`wo!A(f|2x`p>ua zr%tw{@WcGf*;uP`HX;4_zyACG`5*u9fBtmw&;R{@|C`oY|I>fg|Maisk1YfBgM{@yEZ+shDIjm+_~Gp=AHV{4^yRZ8VW7Nw3Y9F=t z&Uf0Vt&P#RLIZz(Ih)(DW@l5`*C+fiKZD8Ms$h!IbAGYhu1*_c)G_M7i`vH+wYOHs zs7>DG7tDQB%(}JFM(<hBxUK^vf zT1W4_);{_ekZ9D=TCKg;QAd9pwU0)rdhK;knhH@HL~R2v9+&KIe}8oBQtChd%}o1> z=7;%dz4I<8>s`>7PRDe!YjxDxMytJ!HhLX>wBGAzz1B*Ff(2F>VXX~swm$gIXuUnJ zYInzy#YZ=H%%e=Ewn~aYHO|4Hab+Sw$=xJ%1?e_(%THR zzH}<7&v^?tNkduy(ECr7e*JD4EB#P zm_e_1m{Dgq?)3?`_NB2&Ul^63<0aVa@(=UVSZ$M4#%iyxO*8h?a>$A}-FqLkL2i0@ zI__3SgNO)TkdW%yYR5Ws32;#NA%k1bA9hAO1h{$cW*7d&DkpB zZ7F_v40o($AH5TEAOK9Op0-VVf*+Ku^{K5Bh?jo5$NEy(B1e>jH_ zk!*>|<>cIj!u_rP=&jMYcWg5JM(-8xa*KvQyQk)SH=ZV^b^c*~`jm}v%BO6dU52f1 zrzQXe6N173pR`_)AB^7m=&iTbfdCp}mTU<906+o|5Y-JP+$(+srVXE0fn!JOt+(Ev z6!f)Y4+!x#sWQ6QRFu)h*$XU%+f@S|8ogKX?~Pbb;5!!p!QfKjFUh-Yu+jTW-4FBA zW@|!HHd|{hLkhQ!8!j6T7oMaE?k4&m#AdoN@B!u*gnwU}@-=p|N!#236MXSHc;$;X zx?FRQ$J~1t|5g!cn*>#8DsrDrwF8I}3{k&<6?V6^qGb#wqzLUuCKzRsHSuy?cT(=g zDZdc_ieqoc(U`j-DWaxy1W4v|2%I;%@^~`ye(cV{Pq!7dx9*4e8MM|`1+CqsInEzI z4VqIK#u25e#A61W$8308(O^~}U?OQ_wpQ7g%jKeyxt&K7C``yiBqnIT^2-bYf}a^# zfkgV?uh+*W`_R}Vie?9tAVRFyJ}6_oS*c7qQhg*Zu)r$R47~_dfVWgmALf?O^(Q92W)!bX-P-KR z5A)ONpq15SMc^~LZQ}h#Yn&C*M-UW%qr_W)sNc!aflvj8=t`tLM9Z<7aDg1XH>4tr#z;zrc$VLuYslE6mb-<1CIs!32_f4L ztpmnPCj)z^AdX0}RPLBWta0U%NSUW&7<`X@6t|TF3Om{4Cjpq)PUSA`M4Of~^vVGU=hJcVwj)Ggl&$g*@oX67NXSPA?d= zjv%b8^UAxpWzFe!i$!6t+^&;)pXxofSIlJik_^`v^aJu4Y%~3V{F7oQ{09*g`5Le4 zGmPo)8e15N?$4XtDQIJ?RzVxPc*$JOHSAcBHZzol=nlkJg*65p(Hc#r52PQ1PI2;Y zqfg2LG|unMiZ{h6dJCT(ATs2bl?g?s4+AJ|8N{-<_J(K*pGLce>w7|oJ)~b5d9Yc> zALgeq#YbgK$?=+#Ibvw9GmjN+6964nho$Xg!=9Mb?h?G&;<^WziY_H(qF)J)I};q3 zKZ8I=Bm`mI2o-y$`aC|TZJicyw$T{m`!QIQ;hZA3Q$khsK6bXpEq*g7-Nm$d+_eE++p8lTqIYkfxJDeM-VF)KpL{q1~g& z%Lb`!*b`l7fk`PCWlYNMa<=(|oa7b=FMIFcmK)3nc7$&bJ(&gf)`gKILXr^N#&{d! zJB0JSfrZ$lEK^9A4Gqv{Ym~8D0mNu`dWDH>8nukDM-&eGKu94W5dU@lSg;h{7geNY z&YI5ksn?4B+1P-TzEsk9ZG8c-cQ&P+sX64D`qVL~VdNLo?QZ)54~FyHH+HVg#8cSc$2(x{?&=WADQomUUSzwGxHAZe2CtbALgfzr6`}$HR*KZ z!E?eBSaMnM_H+~U41k-14rRQJIr#C4@cMu#AB_)0Tms%}F-h7+WlGZF;tVg=YHvGu zW75P#fRx(A$%}dZJT&cKX-iasMlzpWP{tK|nRqz}VyFWAkOUUiy_kr@H%Vho6)^qO9Ec3dkC+f z@5#11AiIGGBpb##laeydS$EAn9{#5j7*s*BeG8Kve>EX!goa_S$Ec`~d~f>i!=c2L z_q;+5$*Ua0rFYq!k%jfvAte{2MU616(I!ASG`OnHloZC_E4mUO3BuD`Z!f2eZg5a^ z`gWsyE;bkCb8+#K^F-N%ID|8u|FNTs6qqE6#C&7{8h5W&$q0Luy?(KXTSg=Ipvw=01ADcE@1bni9EI081~>}i zQ;5nKpZz6fafg_MoPk%5rOVTSVl=`*_&X=N0a3Ou{C)#M8;T55X zZB}p!1F{Z&I|NoEW4MZn$SlYfjox4F3b$Bm@~w2yco&k2#{0M>5_ifPEV_eUK*YsM znhFChGaz;+b%GA5$zT;=J}gFd=E!g~;v*-~{1k)olCf|8fzOTBQ5hXpvv0cHcnCx7 zoSe91OAXuEKxWl9QbbP(C%|#rzVxm&n`omH4UAY8+Bhn#DEao*CQHQbKxiB{=do$6 znMhaC4w`i^Nf{mT3N{DmVgDiAEW3$YeQUx@0jc6|G7ogO6Jh}7Hm2GiA=A%+_WiN@ z*1Rt+i^j=lt!zwY(E{!$8>1M)dW5gN^Xy>1`5OKk<4K~JgFHZT5K1fHwLxY&}4|jA7r@n;z|$4z(3r^Z*aqpj13Ry zQwdXwCMlCrEUPAdr;&O>(Iy4rS=VE~M`v!$qymU_a8(ECAA%wjx*pix=fv8Z z+cK^5HnUu7Y;i>^V~a1V1gejs5$&-G)l|iZ=@lDSf&vfG4yFOKk62cwL;HnEn?wnX z=^;w(HDmK~rtEs-nb(=O7=;bFh!1f9BXOOFcxNOk*`lft1Hq5*F4X%{Hr5uZj zE)~1>>x4ZBf^fNv8bEX);pkUKWqAOtCZcHh;@v?uG(vuq9_@gVS#Hd>&x5 z%4s*IE##pq`=q-Rt4J3}v&?8;r9?M_)fi_X{|=4X!Ds~k5f-5r)8t@~50i1UQ` zY}71P?^!L!hnwhM<1f8Bh;KM0#K@9c`RfOm+P=(Hkc=Zb% zWxIx#+sNxoib*+>(Vo0twHdMJ9ExO3%6{OPRgd3J~nbWfdl)HY8ibJ)sD0@+rv8K6+UM?+O_-1xNA1S zCY*DP))p0Qi5~})O7dAcpsVPaSPxUS1{vz07^G*~EZ{tv7XNx|_{Q1I0ca})1FMX4 z%T)4-0nyfar6Je{fpJ1=$`E3&b9d0ZL#Kc@CSCh|4}5oQuti!^x0A^}ChL`tY2~qJ zOFLl}fO<#fiJ*z%6srpJEF6SEG^yev*thl)xt1KsZ|5}^>FjlMMj5Y@zYgpgb9*wm z$`&B-Usf_W1pwSw%=J_ z7OJ&J`9W(Pl+ij|sQox8->9%#j|q=kur9=dEyATf!c*Ul%>i0}XCJ*QRx9uI%BRbL zqq&1r#DTUC_E5mm#x-#y7lKu*Y#953Ysc^67a5;td&uwLvTw%bdi+%+vQY;gz5Zc- zCaaA~ZtEX5_mI-KNi@Dw%Y! z5GC8_lq=cAt!L^sRyJ%oJErNFx=^mI2{Q~QHsmb87mMN!_yHLG!+<+9{5O4EEatusj zPx@hg=3g30@FEYgm^4?2&f@)$gcQjtlvF+|EYiU5ePg#C8k_qr z%Xhh;ZHWb^dyP{mF8msf6k|Fd;66s--4ihzN5Byv1tjrx!8W^jmv$g6a?!h#m5bi5 z&ewF@UBkjG5w#rc?9?=zjb-a`W&X!zgjQ>RV{fnMIeGv64xhvzC?!a?Sn_+a_6&lfiCg`Wlxv#)?hOjTMx&JpHpUCVhdXH(_HX7` zjA^{RW|pk01oA58_?5}NpKsdvQ?x4CkgPSzhGdtsJ1fzHN_QPen1`+#d$WWqZJh5H zCc4ehTmeb@puIzDxlPV!mMX6$z0jWvpMMZa!!@C?|WnnYDqAX6cF39<0l-Si`dFxWWw&r_MV`kkWilqL0Rg zgv?&krYc1jeO5NQxGMF>2^^FI$?~8XoCirr^s=c`{P!~wta&B(jvZjOXp>Q9cdzFi zbM2}`Ulm#autq#mA3svCqs6_2lZCllyiUsI;^W5`9`qr;p~GW=_C`Mwvvar$m?Zfa zxD9X`&#l@yHjLq~67f7=m2y;hHNNLNw<67Bjc`{CF9 zKZ(p$!jhEgI*DYVcv!+?$NlBjur2M$C~%I=3f9eG`=UD?qB71buJ!18VH=O|Zpit> z64($TL^)#w>-v&xpt)X}0NMm{P_^%F$Y*1-F8{9U#Y0}JlTpT5v#xrI2ij}1j1Mje z=>z}?I#Fvw6D|3SdbxV3(8A-r3Vv*|7u!s)iOwz)8&k+$*_dKlWbkp?23-e|pAf#nm9gtzicQn_A<%Vu7`y^| zocoo{No&cs^7RMC7Drv)B!_vWWTHxG^9*;8uK)n}Wa-StRsqhylMxY;u&7_V*aTz4 z=^<`7T?ZVOGdL}G1)a0?Le`qG9lnEQ2dc(zxjk%C!mSIQQHgL>A) zJ5)rrL!G$Z>I$MefI2EOf@=N!Q zOR{E)KIVqVR^S^cHB&&yCD5Aio5vC%`b%WN*hA@dM4H!rx#)6KF8bxu513kKX-;|_ z+8g#niY{V2L;ORR6t4~eaezR~52QtcWt{tT#f!3s&7X&K3(lR<-Y4aZ4(mR~12DB- z-vFw?TA;{`$V4a#9s^i{+Q?RRX`&soE{hn34$crTpDZ}AV2SYg)gZs;$13s~z2X6Ou>U?+X*xtKP!CWZx$b8cfkG@ zy*Zbi)5^K*%7V;CLdxT3mD8@+M+hJo6E2K-L$CbP7**fUA6@%58f5?e&M-EVP{E|MmgBs@rBQjI+;Y5su-b$!mBDj}bzH!!@f(=< zz;DlAC;s3+0=4U17W6M$k9WD-yBlh8(N)YgDHFFdaH}?VU8BJhStPc>$KnN07&u&d zKV0j;+c2e^I$1R)d5w6XRdIi$5amNm#fb`@TASB|%ncXh#g|I%WMfXsCcEz4I1pdpU`-E?uJ%NY~%(`dgfAhnE`DAw4_ao3YzO*@B2%Z=j3vd7b?~ zSQkdYdbzzSLt5B)Qk%@VeDX`v-4e(1__0e)+n`)>dX=N%ogO^ah^5}cW|Tgoo`4uM zO2F?)9wL$KNmIN(b_jOd`Qfc8S}Si&$?M9D^Nc3D!K8*YyJ>hw(>&1yn8pa!J5Cgn z%VUl>xGBOSy(}rbGnTwgAN~E#L}#sXCc5+?Hj!S&l%Q1fkTMl%j2CccGRlxkXk6&T$hlnXnADg@rys-Ux7*8$u^18{W6vBvCiC9^Q_ zPJb%$Zy+Uw+qF%>grriie#M-pnpQy;#B72 zB0N2|XnP&NoOiVrZ;L8nJs9Cm;aNHKxpPs5N2IeMK<3^@%H&7;PbJ0HvjH%065od zj8@qsdu_^*hqo(nWbX+e5SXQTY>rzZl5oQi-^NS$h7C95-818ePSU=pWc(_4o(

VQ-lO^n+#$5tz zUlau#xC{gIfjsI2H{Fo^nvoi$4o`mf@%r8RaBNN{9ORaB-WjKy^KSLJ<@2Bilu#1N z0Z|$yGgrKk|UT-i>R5^42d`V>{Gd;wk&qiW9pjir8O!Vis22lUpmV+-s#WUoTp zOIi1Co5!RZzl!!&iUmE16*vAP|K)lx2fnBKlQP0RhBpuYC!|zdx3w#+Kduk*S%O zj4CF%j~`+;UHPgsbs}RHC%KJ-O`Y`V@B`xa+N(O}Hc+x2)o8QkmCnX1v+kZcAfjN} z%EX^noT4j2j#u(Zz*$maV#!)MZ)!t<17fuou^8LfbkV%KJ`%;%>~f0AWcThtvgc8U zCcPl-B4_%|%Q|0DX@xo9{kgqS+&1QgP2d{lgEV+PVqljWmI!Uezq8T%7h^42T3O%q z{3so=Rz=6fD4#wJ)plAbf(JSOG0m47PVEr-fn_8*H}T<;C$`H*>hx~n5nrw?ACE0` zx#Pr)i7Dx%OiWpS0^51v6=5nH4PX}J_xRoHRm3{TqEtzj*?}a0zW1vrf;Gke@ZVpy zCL5+p`vbrE(5aMiP$6Y|RY=_FI6B2b8Yx1wHkAOH@vwi}W+MmSZ;F}LX`Pg@POn27 z{v<3AL}ABB8>%$=Ky^tzqpAMc9B}hP+au0|FOS9=6-`|8x_4-_3L6PGK_r7h7y=-h z^a$(gb4BWFY|-r9$vG){WfP2YCR@D{>Vw9*?r*7*N%LAH2COcIE2n>X<=uCv>&;PF zb8pj)4#_KHbXd;9zX>zViTiTEg$;vr1)=k&{ z^hvCb#wLe38p)#xRworruEF0%$@hIV%&j(c7g>=Uv%jl1juQL*fh@BIcR3(Pv0U z0Fx7Lk{dR>Pi>W-T|S<9o6uA!gg++Si^sNWIo;;%#+KwgIuO&!+wQ2(q$BXZ*+L?W zJau9M8EWOi5q#Fu$p1TTsBhpgV6vAMpWZ_UwIpQBdB z`t4ah@m~2GXPRq$WBM~|zu>J1n&of@W8Yx&2nep@?t!oMlx-2^qUW?T+5|jSHydqK zHY=Ua@sI+g7@qx{Js#YBlHyDbNJq%UCYMGC5!Xabm>RY5s0aAMSn`Gi;;hX9r>RRy zD(lr-y)JoMF>BDS>n!<#Ozs0OaNkFt7==>HBQ5G!Zh&S(*eAT*L^${vnfNc=f%fgO zDRw#(+oc$^RW8L4KJEl!Xc2Z=?!0ASmm`eO_E~}GU%jey_y1edtZ}H6YnN3r>w%i( zd}NuFbuN@U>bQ1cG%24-RhV82i9YKPv+0CYg$AjhyF7GRUqw~?YHa)E)3ypa!F;1v z*{-vg`L<0~L~b-%R?5)~)oGeRF?;N zYU3P;-38Ut*@M%`Ma&$6PqN}gJnVOXFJ=h^O~VLEyqulPHrU&2~I>#9LPCEcSKUA3_FqR$>pDiy)>HPDcN&Hwpaxz4YmTqu%8hjq)xh z|H;E%B}@-&XHBBF+DC=%X;d^lDD#Xz2jV3d_z{|ypv{>JPb5|T7~tCcf;dmhKp z;7tsGKNX{6pq^E)-T^tiQt_=&V&sZ1g6O5vZPCOnYCBSQgR?~ix3ZceOYE>U9v0wk zU@vDc1c?lC`h$T)q+_&s)n0A8qu)J&!u>Emld(msWVUC^p9enS``}Qx1Kb`m8Xd-n zUS;8pz~?c3qKmmnKJ^k|FgDNsF3IEL&}=b5D{G6{ZXQ2!ygI8Q>@NbR(1kwae#zBr zPg4w=2lwH2y|Z^Fsq9^eA6k5a6PqkLNkCGYy$ik|dkVclsRZv!e>_(k=Q;T_fhXtx z$k-tBx*KLfW*fCrHl~l`ZUZQ0CnqM(C(TfS#6t`EYHxBTcZfcW8=S%+`Jq;z^}$$)tW4v23?uZGaf3c!;RydT>xTzX~_I<1}Y23~iy zAm4d@1IZOu7ny}&%1mS=f3K6^V$Gt-``?=QjaRx@OOv!K#*=D|U|N?AyR+ftLY>qN zo~vQB?Da8PW%DKLLFvV?Z8=zv!#_5d)wX!Jd6sxcS9JnsDcmxqHEK4&2`m{L2HQ*< zUXwxm{;J-LO+oS{Ty$EVA(L!S#_PPEA#>gy%kb1_tmNqA>>ooli|}kOdLzqCj+@a9 zn$GKJXara(!se$P(~}9pCjKhH=fs9uV~xwo7;D$&f?nMC_IZ1 zjOL&?u3j^!At_XG$Wq2bQbZ(L86)L*eXk7ta3Ep;!9YI0ZCssG=4V&oi{p-SiKQ4^ zN*0o{s)W2fmHJ=?Mb+6lO&*K=yY!RPlJ+)#06a_W0pZHNY{p=?(mEIYsoUnhwpg3& z*Hr`F#z-Qs1Q(UDC9LZ2bra`OoHvGQmc23mE~yJM7YPddDFk|Iu4{^`mgb_<8aH^D zkd)VUH4=rpw|I2y2>up(23^s(M~nst1|aetU-f-#6HQx`!j+F!t?8_@5$<1RI*!}^qqUA2UVHj0CAs(_c{|8EMdb35VZOxWK_qyohmM__p#|e1{c?JX_77Jhxr+^bwS1K z%u1=wmPdNS#%pAm%8HJYJZ9Vl6sC}3m=YkGB*3q4cG$M&(kpK~FUj?xxT1`YdfDuG z!6;b>qDmlkLLaeI-bF&C6JCe%^3xx@`C=)raVN~VtV_XD(6ZMmy5c^0Hb@tvkmM1$ zE({&ingBv6dys&`x1A7>IbENxSwSP98qa5*&yOX&vG00gfstI+B`f2yUFQdkxeaxL zk(!k{X*3oRXC@FhmMyEqE>-@V01~3V5eG;hLdsi7nzNgtOC0L_wU@2TQ$crMuyqO1 z)EAplQ8uspx$~Vay2%pU*F+v!ur}HN$H$PDJp03 z_PkYn=aCuURCwl(NT|+4hKvlbDP0^r^`IJyF90`7^eV+9DmGR?tmPXLK07uuUtX^G zz>CjKGFBOD(mKh19xVh9zW<$RA7-e>5xI3JZQejR=- z=Y8`tsx-c6oGc;OguBo>lFn>`&tFifqRUOqpmtYLxd+rL zxCBPS-+qzYJ7;jY$EexcQA$qAXtNk0bMI;QRlJ*UT@2JzsWHnjoj*cgLsjv{H!^?g zqBnG&RkV<%)+bknFEn2kyMFr`Jv6q3G>bBp6wLUbfs~E;G||aL42fnb%ZVB7qlxo{jeWS1#9D61U&h@3A5=mZ(h3D=#wU%pFD(!RM`8d^s5- z7!lzQ(PowQ83{r(MSbb02e_^iMy6zR73=%5& zqE$*;msPZP{0ZAqIWAwEvaj5laYULAfz+i{1YbXt_GNj~&Da)abs4&B z*mNFU3Ccvj(vp1CBB}sy+||pnHIK&4#bLWyueiZ@QY_eM9;f1atV~q=BhPO6gNw7v zdgY9hK=(Nnt9;)0z56#Zqu|11afkv4H^#aX5a}#(qlu6`LiBhmGb5UX)jlil6JwKk z-QN;YbjXuSc6fg1DjD3lEKT%UI(i9yq&0@;NMNdxO!mim^N+DP!K5tE}JXiC9imladVB z*T(OfOnEeD6(SV7|N7;h<+$HxV0Qg40DA6Wn?%(^~w>)o)CG0^4_+?mj zqcqd=_<%*#!8)Ui4sIQ2IvZihXEo7s#0%m_9@T72aVynGlmwJ7E48E)zJPc>9(#7B zFHcp9v5+c9tCi7tdsa(0$$3!%N@n&h*JX6qnHN18HZVtvfq zRG=C8H}VFMxzU^%N#-4T_>I>|w1?@mjKvmqg}9)DGRB2<;N!SxhjnLy=Z2hWHb+fr zko+#obzLYji4}zCV1?MD3;lbUc<;vU81{$$pt_T7@m6K0SChb zX*9;mCI-d;DUl!Q`E_I3$C6_`yT}!j;ooeC&M9L<`n1s>A!116VEQ&Ki?{v}XUczU za~q8+gN<><=1dO~#K!C6GNi@(v($E3?+@&|-tEW%a zM30=*SQB+r#+tZ@ihSH$)OpMgF^<(ObbMBEcC#pg+cJ88t5tYoLd6D6W5+S+pD~(ZRg8AsX5#Oh;6sW=SIwMkFs}9s;DfGt_)zN_o6f}D zo+EviFUpwhmScB^xn`)4G^2|Xlb+Q_9nl_|*R2N=#T65bGR3Uhyj{K%6Xq<4I!Sa& zogAR_iS%aob1O#8Dt<7ws2EK7S8wc7SRo?lw z_}?7c-lu#mUrtOhE#0{_Zk_Zy?@bUb74`+aG8HQVH~;wIl^x~#Ta<5fwB9JAqfKir zM=h&Og`?JCT5`>Ds}DXFe@EwQO{B3d*^skJHhzMMNI8KKy?AeC5nXVG6cU(_e3kXy z0`a>i&Y__qc!x&>d+(QfKDJI8g6V_07_PK`p|VE~hea#=#}yR>3pXbpZFJ6G>-bq-`EDtYc{}`?WBPj*WdS#3ipCM&c>l+AB z#OdE7_J$XCz*Ba$L}A8 z%0;N%IeaPHf>eyj7uE^U1q)5hWI{W*Q!|@lD*OF_vX2djo7*KX#z(J;3EQ*Bj}}{| z=`-_NegWK|l+Ig~gtdyB;PEncD3D{6YBBSa-=u2qO-x_K$%}AwCR(qIGqJ3Ds_&&9 zgI}Zy1aYTL^*(8b#y^c4JGyM}bx7wiU;X&lz51b{#W|x~aZ9jx9r?=s45Hga!?F0oqw~GBBe|MnnADw|4LB*+D-g)Y{r^ad|*5bCfTTh*`8c*^c0E5 z5juuBGq#rOIW<@PE%jt3)hWacUmh z39r;~@RN1E_52aHN5>|wzG#_Q_R87oqH^~6ipWQqNDv2Ri((fm<2>oZJphZuBP+~} z>X=TW^M&-gzg)^4Z)|-;#2dxtq*bwH^=X8Yq8$@hA?ckxYZs0pW@6Q=(Y=4!Ue;{a zQLO2?V@f)zn9_PG_IVPAq$;rtrX}u8-mmk0mXe6>B?y0c(sOK+zvezqduWq^`%T&S z{iELa5UEGl@HwgXjV<_SY>MPA6fxP$5OYZ?#IpA0s$Oi5j2!gDEM0e`G6W73M-of; zgE2;Z!zBsGvU$e$tG80z3s0LoivhgYSZ_nh%6J=Bz56_v3D3&B7(`I#3&95s0I<)X z!|Egxabk3qlF>&u(-R)g9}j1nUmrWzU8r!KSBWMlgKJeTD1JUVf6R8}CVI!#)GkyB zQ!m2XuVC73kCyKe2D#{xwJJt`c5yJQM=~E`(<*i&r5EU2qr(sqa!g{6NKW(2o!;-kH|~xzoz!@jl%sDVz~KnaM=DI{D8P7yK<%3BPN?J{8xHv$tz`UY^ zt`FbgombnzCf(wOF6!Q!lA<#H9gTgkB?QAlxOY^AD6VI=6c>@XzPNP#x<{9(aLL|m+k4Zu>-EV z35X$*VXd5Z!AVyP%S<00tNR|cHg3$y=t^JKTNypEw1tS6gJYazr7*bFIU;=Pa6H7r}O2G8= zB7KEY{A_G~-0dELCsty>6-F_vLlt+@9cfg69ZUesfQ7ingrQ0pep=%DJ3N~&LNwZ| z5Y2ih^?8K?wofo_WzgmRAkA!;CkPKfAZRg6UGf#~y08a~+gF zn;5*xCY5FG{?Kt`*OX&0bLs50!y6sK!W~q?3nA%e@a^K&s(1vHQf$wUaT&xgE#HO-j7ZM~shfZ|Ss^8lFv^!55_5hcF{<75?_s_VG zpB*x06S)wxV&Zb<4Sw%20k%N)o?FDFPBwU>qK%(0;nLAj$)*mvbao^Wkc!IkEB0hH zA&c9dM9qV9ethiGQM>;APi?$5F4~C2_TDCCoDXZUjXq1U7s15BF_99qTzY<>H2_nH zEkj0Qrcvc{lKL@TiN!MK5K`~2^GY(d6-w^bR~zd>jLKLS^~cUh$N_1@Yhz}((nvVk zc*6=j*xNc?!wxa@EyRdAcoof-79PF{9Vc9GsvyE#pE<%bAEvQvRN*xs{pubC-8PVC zjQ*%aJv%lzbNcn@(b*@mCVgq#p zaPl=0@A`c0voASCMB5m&N+zxh+26U1hzbcTESUgHBCK8W#WNeUS$|niXO`1jRtFc9 z)ln}N;(W3p%eHI_VDDZPOB!EG1=y5$4=?W(vcq+}PYD%r=4KR@D78{-P9DVAhU4@t`fuCu}5Ue=lWq%vLt<4;0 zcTZF7ZOAglXrGiZ#;glT&u-BQuDH)&1x}1aFNshFDK-a4&cPGmq=DKq)zZ($Ce2<5 zKnrszz9^%$wjVd?RnCv3HxCQbtzg?Kx_X`NYo3PC~kv6eAM=aESSzvaLYp_{Wb2Bt=nG2cMT+nHrl45qIQd^akuc}{{!VV zi=pcN001A02m}BC000301^_}s0surg#eGYUV?C1HzJJB^+F*h2M{U|P2PQnQb1_4p z?b&=A8}`DFjsHIeI45|?)V->bQp#?A)mfR6vYJ80-lX#u%fH)<(s*qt?;K7^BxQU+SYZtX#v# z_$#&d&Tsn|UEXQ6)=}H2qkZ)DfFLiAKYv<`Q2zKAgT;uYnE1o|jHURbVky}l8INczP_Ez1N4##ryoj z{PZ!Eq)1kCP32zIK6>qS)CSw9+0@Znt-X$hKcjYR@o2EA(Oc{M zx!2KaZP3zp%6oroI-S=3MyEaY*ZQPL(KAiWrj^6udy^l6}g~+wGX>qlW)*UdK;7dVSc(8v~tPBIkk9eY-7++YVEal{M|-_SL3GPOM@N`L=1e7xH4L+ zZ!@eV##-Z`wMS^N&PJz$N?;yxXpqat?MbTceD3 zIUd2z-!5*YC#_tk);iV?%HC+ZSbMJH6H`0JzW3pFjy9L1Y*~RYgwyA z>-0Ma5m?$k|K&?#TVqSm^VdJL@!Gg(8Dw)tkadTZ1${ehC_%4{wguy_y>& zDK?j=iY?9_=6y1z)(&$T9Z|4jtFhyqQ0>u4?MT+n+1Oa%HA_m$Xq%7iJb~CcMhED? zngG921u>~M5X5?`bU}!CkIw97>|SX3#bitTVSYMqy;aUTe|W`n6b5|gm=e(v5E5fe z6QGM1JA5QVam6PGewX^td!?lzbRm>=acf@`?a8sNggym2uYC&2>kyBX$nmri^l|{Y zZ8YG;O4VuDs6Kifke*JP0R)%?2)Xuw*WeNd4En44`unl@%4l|E?|zt{-j)=UciM*o zRhpB*01z`H0rG+f6>jGk9bcRLG-^lSry2m0y-&bRq7df}x@@%jVSd_>i&r+36;IR2 zJ@vVHRNpR;nc=FnQQK&>)z%U7D|0)6GFXNxDe?P+`s_@~;Y>nK337RBl=Tb!`*M~F zV7O5!5rDghh_C<|kivI_kgrUBgI8t&1@9dqgUO*N<4n=^er)J451^PP3*JVP*f9D` zBU^jgBW#MH7c4lEMiY%uMw=MzU6^p8F@n<2Fk+SXp_kVo%VvwR35tl0*A zfG(YlNk7cb;Bt;CxRMSKlP_Iz6)(cwtpt$-|cvS!-wh)2B$lzk=Mxlkjqz)d~u(n5YpRU2@8Kua8jf zPC)_StIB_a|05X%0;1LasI%DIfQ`Gu4nNG#n7m0UreId6_U9GCb~CWhmC@8X)~jNQ zbkF$O##~eI0*Au)L+|O$A=HCXe0^*I+WH0VO(;m=e9~SS>yvZGZrtKziqq(ta zVq-DNc$3nRgJyH>xIqbZKvBtzg=C;5FgP~yBu798i9Ns%HT*lHeh=}wZCg4bye~N+ z0ZhSI6;nuuo4KM{K1c&p(p=!Q#I1wZB-6z;fHYvnLDZ8Vqg)R~s9%iTNXw4F><{xZ zMCYRl(Un8}{4LAEpoQtOtN^q^HoQp=G!AIio~SMyV-Gd{c8~=xwzc=$w=Tb zK_6qKv6=+G%pQ@PJz)l$Ysp8@KiJTyQ&1_IwQk1TPN^SZ4pV6$*rkjB`y{13L;)~= za^Tc!qLzxuS4IY5x8aUD(_sJ`c!q%=pAhlgV}qQFH5IfUoHHu8e87bhH`O3arTPOb z0em8ZYjt`uLI&pHeYEGm!{@PSolQ&YbODQRqL0d(6zGS6zWk_RcZ(uV?a6O}_UmBZsFLGwWD3ejw%Wm;<#-1>3XP9Yp*#c)9 zwy1THGw_wmE~>>Oa^?!XGcn@Q5y*VIT3wC} zCTD*O(tIwtC|`6~C5v;#5{V|o?u`5>BcWP`8jH}so&Io$L&ck@x_l)nU5(Af9k9Sf zrE{D-I*djzE`vzynS~YXIG1?ckaNFFHZmDZyQjA3zlhSI! z2<5DHf-R3w3SATL%-T63QiFy{s2X3bOB`c&kf-z~dF`}HUT>)2oUXGnOngi_vo?tV zq{{~8$`Die-IM0?d2D*&7Hc`lDXUW`%2=IObc|=_8Ci_*JEVI6=GsSRiJYied^g!z ziI{AU`Q`i{wTC51Fb5*@HYW4K{ESWqr=rvOa0~91py*=dbw+Gd<3)#H)(@@o76H83 zkruGD57w&WLpcKFiP;{qPBYzLI>>-HOX-;51S2fI_0BFA$yR>7s85Y84usn{V04H% zE2Be-$I_;gNdhWP$1n(e(0xO)2Wbm2BtdcKpPBg{eMofJ?-Ol~J*I?X(+b0O3E4zd zLJo`n(XN+G`$IQ7Kb=GfM4xsM5VVsJL982oY`<)S<=W_uIajwXCZV^+k1T_ZzC^CUs22<$9qjc?|S*VxQ{`BCYj$v&l^vd_WYHIYGvq)Cz__RXS*s1QiGDnClG z0)SVFc36|aYUulg{)`3}85Vz-pGn&sRnlG`7IJ~Q$OIjeCPtECvq&gFjF_J7P>p2` zd`rS$;MFR2MTMb02+Jn_3fmRG!CO2$HlnlmJ0d&Zw{+PwOQXLw3JXrq!3eudC;S#KJh)LtuzA1E!5R;y3<5$t)w zDkX_mh&mLbqK@{ku?zlpIs(Z_rQFE!n&djqn8G$AlUEpL`O^mzln>=7?WK4-pFYzR zfvt_rH{3AVJq#9bnl(Sk!Ww-vExOmYtLO%z{K0#A8`(~8N^wycQ_9vhX79u;a2dk9 z6Ou|#FML>gwi>X_%$hx4u|LdDYitS18n+eN&-Oy7JXd>&hizbukQ*X2HZr!8r{p>d zNSa*cbL#T&*nEOMWDHvS$kajmpo|X2AFFTlEp6Da_$U@2;&<3&C*{SqCdx(H58kq| zkE7w2z*`eTkgDLpkUl%0P=I@G?_L_)qLg?niZs+X6OwXv1&461;Y#2XxC06h>^ewL zBC0Mh0Y(Q_@ENyxJ2q8aryiu%QLHIW6>H13hv95OP&aX#2y9a9XtPoP2O>2sM0IjC zjiek}A_u#inI(wwi#iB^ctOag$F?egPV=vSXzQZM!J|TKbkfQgV^@#zMO9^b$I36@ zAE%cYb*>x$Ki~VJjGK=?*xbpQ8sn0;${3f{Hl8$ZaIo2E2$hDs7vYEwpGE7z-64zh z#R>oA^BQZr1#onBh2nKkq4>PWlzcU33F2Tc@dKSE=@J&H@iJ5nHC5>iXH!ZS#`7uY z@z~gWf$@iY(I$i^mvk)3xMWu6+KIN}!I@42YJ`D!Q#~28ef-+yoGUwQQQrS*;(7cmL&Z=bcmMNLj{0T7`Ec(GL6Xmd$gGMp# z3t$8UZ7lAv|B03l$Mv#E7h_53@+ay9?Wx*mo0ZYV=*145PKGcwVz+1QjQNOt)5s)A zY>c2C(N+3wd2*2b73~eX_IYf3=)!W*Jf#y08Uu?jtCRa=JZuUaJTby!Bl4BN8avb} z9=2-oJDp#!-}tN7S8F&|V{;JpQ$|nMXo7dj7!%zgV{s?fNDmF{$!#LZFZKT;mE>s) z)Y6*7D!NY`#E_bIpOBbJ`+kW(kIl*0qpme;ay}$yl@BQ%DCgAp$W|U9Y}iX7_5J?H zQJeMuAMK%GGgFGjg`%SIt9Rwht+L+{k%)VBDI;o4g=$uwAZu@8SsV$FLDsw=DqfSnoM1pYrgRX86YsGD!&+zpB|fWWqs>DP0&UcWr8+a?djr3d6hgDn%gBD2n8U0GQhg^OYUNu<96)5 zn2ZXb3qA*BTnJ{hEKZbqTuLCC2S&4hASQo~X{Tvj6@E8ES%ls}uG;8>R>sD#Qm%9h zdBg!=yTuQ~T;yDoINUaEp1d<`hl<5e^;RR<9Gv?^ldzdkYo~(KTW7hsWBeo~JM(3P z5~Mu8pXz3!S+l2t)*1?c}FV}aB%^J*M4Iw8q8f5EDR@wUE4-LFHIL%atK@sU29I_<& zOhfsFjUWeI3a8C9YA}$#dkvO!A)N0Yi8>c$qSzCsFK_UV$XUjPF$)D^ZE-&z|t$@GF!!X>~Bn_ zm6b|<4A&LNVF5XPUB~wvZnzy=1o8S-zms-0tEAmxIZmzH0FzQ~fu|*cWO0uC7d;i1 z1-kvU<_Z~`zbR|RQk*eH>yp4vgw?5mzgVW}O~Pp#LE4BgM?;if4b9v4zL&CJLeHQi{c^l#*ZF zljiIs*y)S{g_JU}oNOJPJ^B$Z*E?A2_P5D+unieh|?y+JL=! zcG4JUJh~?~n=1hju*pWRY;wyi%Y|0V)g}8jW8TE0M~+e%VTcjfkql2NVe&YGAbR!P zS5d$9CLc6bbI6T+r6J$5E;g3UW4XQ#1re2fqmKMz4mkM?Fh zH#TT+8z_8CsVE<}mcTR26THSh+*+wWAd&5ZBA|jy7Qb>&Ays9&9)A0!8p`F^RChJe z&u&?hlUAm<)$@CD5lu33-oPOBAaQbd6TLff(4QrjCJ+c4_6~VA8OkbINMmX!v3M0q z+HMFs-KiuH6xCtu5BrZu0WDZ6?ip+wefCS!-vau&5MbVVQcO%n6_eJ5JMpqlT>9M_ z-A6^VX6MDAhQW4-QW|-zdYmqMY5sHUfHK_D0@3OeRJ6vgwqSc&e}a!HxlU!}YDiZ| zr6BCQ0CC5C;(

hw&C^IJWq?xcZQ6K`I_xOezGw&Sn~Y779+e^Y2-Etn=?7?EMf% zhUFAA@<}rS8ySGNW?yIJF4MhZiQXvkugA8@r(PxF5#)?d&aUFv*$-mI+&Nb9Clk=b z|4-g(ddz_>e?`VELY8 z-%Tdv$PR{5R48HN_HIKh(rDQ}z#!SyMv=zD-u!OZ;Vn5)siSxdo&#(;c)1 zrZNIkkqrx$!#9MbRj4kW(42UvPYw{t1pX1pE=dACCexe7=H$wL{vD^|oYzjdus(yo@O#^}Yz8go8pB3Yyu z(4gNR*ci0CaIvA8g3lVikVar|peWe9sn*j%`8SRJaoOH9))J+4LU#7qhhTzNA=tDX ze?Dol2r0OF<924(3{!EcI}b+_=1Ag-Wg#MEqn5l`FJJ5o0{xq^^e4uq@m}9*SIWr; zm2%bxGZxQRSq}-n%)kaOofOWq&QzZGuwm`kgbN(@gdN-)TYBP7U7R7hU{#2IyAgT1 z=%WtH?#4Hspkt8z!cuC&mLrE}r}V%%-YVOBBg3B`KA^jQYR5$GoK%G3y)r(O zvhJKc>u|%|Km#`FtkfIil1HJCz&W#p^UJonc_kK3{`!ZuCfX8XM6-S{URe|3$|f$H zQj@SQXWs@UJyTeQd4?BOjJ`D4HPf;evn;O54nA1rLRkHD@v4wKXzqfS()4w>14g>*TL!ynuQ{|-Lz*;>PyDo82 z$ap4H{bFozGOey&spp%5oVmDli0-1tpK=_lJ!^*eL+Bt4OU$Ja(Oz;eYtA7sJAjfW z?Rei=Ohv1h*A>RzomE^GQlce%NrP^8YI!3)^`vfZ5pP`rKl{&I%w8*(^tyV`q{}u@ zSxx9hotnVgKcvGOB{00jSvSldUxlD$vy_yv=9z`wB=Ql#0r*O$Nxrw!J5l9^;6|cF z5(jekRsCD%Jui>Vlc)2czocVUIhl3rIiEG1>CH2Kjf96l(uh5djBQx(1 zZZoOX3ouJpDQK5f3VL1n=Pxa)PFj;~odTaLjYoX!Gqc^a$?k3wr^RB?TA5hV>VdqS zl%$W9@O21QW1N*dg@KkQ=o{%rRw^h1{)K0z{OhqhRky`s1BtB92A78B1$55sC5%(> z6~Jk2LWfR#jtGGKa?Dp@J`j>uq{?}aA^Y+^`S!8N>h{*Wz}s(pQ7NpDckG=xqQ|63 z2231|nr?Ko{xMA(zJhILuzl9Z#5+7v3U~~yev&7<6~yJ3p3woEfezb=W@FE7`#e9v z+6FrgNp)ds5IUHalJ}r%5VK+~!RrrE@jTA=A>pXfvcbrM^+20H^R@c-z4(A*TSC3O z%)~)nYwMNq+N?WF@`+j-Py%)wkfs$5O}H`gD^ffac8OfQEKL_hlIn@@!QZ$xn<1>S z*vvAcHBqZ*_YaGJupBP{*KM|XHP_4KuSR=cqB7ct&F!8T zYEmI^r6i=81+)8&i9bBo2c#e)$gtNBECr_QDJgz$$(#PI2923f*pQ=9HWas<(&<)H z>1#sBST|I#b&2FRs@#pCg;q!+kU|c@l{Cp`qbu~x;FvLhP6MV(@B%IK8*a)4)wm5vXjTIW6qYH3I9jsyrk zBJGI{K98cKqAVE=6Uh1|7o+y_Bt}YLXBFRit?Ru?;Cztfi%^G;uC6ptBF2cv}wxyxxC~CJ1HcQKmznm zGQcC?v3I`9dUd+h`WO~^cI?}_vb}lS)JGjv_A#&e^a;#1sh+UiW>aX|Cr|qU$uRq# zx%%uM!lIDYkqqhWLSigQomofz=5=1lC6%{hsprF3GZwOGfELRwV_bxIP2MJ4X9E%& zr+{e%0=`+mO|tljL5{ef))l9G_RBI)h>V;@7p(-2W#`6m++_B4F#iDGA4y&AGP_wSQ!#QwEAdV25(1p+%S*l?I+3!~Cevh`U$F6TH z76>J6e9%@IA5yw&ONZG=n}($LLpt5a3<+r@?UGV~n!o`|gMa1Ojrq-3vVH2y=gGYs zoK+^|xE?jeYg^x?H_EAlN%~gMMn6?X3NuXr7|JG{#)J0 zug4Y?kE%s7Df4oihpV`RY6%|0d)J$U*TNo0B*dZrFV!YYAI z=zNWR6;j^j0gS)LLT#`p9|s)gL#3=X#Vf1rTBhUt{A7oK_ay0J<+=*_JK1?5jo3jm zEvVL7KN=&^0W|R8CLW=^eBAl>j&Vt!R$tA0j!X&K7*&D}_n)DLCW^sYGUOKThM?N$ zHiWxmvH2?!ZI0UK%~A7dH!d0LlyS+fAZgqMSxM}cY1=~Z|xkvKC2v!-#r7E6<-{Vx)c{zJ=30J zAJaK$F&ce=DOLalKn;lC1X4Cpk3c?}|I*l8Z94L{qg0$r(aIIQ-C^ZUu2xt*p&EF|h5Oy9wPa)3-2O3W zq2r(j>4>S^JTBW9qrZD`mh?WR-C!ww4q3TeR)15_R|b0)55lqk<5s*ciL@!WTM90B zjYaQlQqlYMWRY_YDnu4rl?eQ$_nnMCh%YwMP~Q>lk)V>0mCB_grTFoy(mXac&CKpL z?~W;Fr(!Cr0kvGvw1S_7_LJlWfwJ;;OZJ7cNJ2Xmv@JY?82PLuU}N$7-zYf71}?Uz zC(bJ*Lk0xO>yoH^+qVWvgn1q`4?Y?NL1a#3dw1C3%;#OgU3xD0t#qj4g^FY9lJU(A|Maxi%Jh-_49b-{Zr`5c9@j!>#nb1_)ccq7e7~-la zJ(HkAoX2Oof!26_epN}vDqpg`zdMb=5_xGmIt1xxSob3>%Bm(QU23rC@t|nT_Q??f zhkdt`T9R+KRL#?j-Y1)t_uF%DPS;~FffttpV-%i{q_&i{7IGp4hT?VpqExiO;IWV` z(HFk&oh;AYu~wm&?T}D(XfVz(2NiN!4PEhko1fsp)^EOHKOC}mA$$ac3RhmINxz2w z_pzi2>rVRPs^#R9a(O+n;&iPi4{ZqP(xIc3Wu!LqG6Y`HRQ6#q^t>j)ri-6$yn~mt z(PyV@jQST(VUYd^xJouV!4nD*EV@VqllUonGB<`M2r>z{PYAjypTVLCz=gHbkog3| zXB#}fW9%__-7_JF!(+-xtC&i>p9zpbYvTZuKogyS3l512EP}&}@u>BHhO^b7Z_Ecz z93m)v_xfzo=Znr8ACghV`?xyR&zaESo#DS&l59LPLJUbjB@`TFZ_t-^-p&k_6cV@JX}xfb(XOC^5D3x&*qxhb6liYq~b%4Kc_qC^q8iMjO+L zmf>V%>{*i(O;%qlh&%-H*2dl#FfT;9Jbm`~uKZ$ba+pt@jwt!~?259!#1(Da36f*h z^pQgpj{v7(_El2tA%9b-!9qB@ANhsAehBOl8j5`ZNZaX329ZAh7Mpy>LcBgUzoSon z$H!ue^0BPbi{}SJ6UVc>%r7$*SFVaw1YxQWeY|wt&j$GII!-8^4n_wTqB1&oy&jTt zaUBU76)RfdNU}&XtMuc*ff6x1Kh+(W``eT;SgS%=9ekJ1z(Wk5M>6EfGfs;D57(1b z`c5H^5U!Y8;sfk$czW)?8(W+%NB^Gj+PG*Vn-r~6Hsn(GbFU*dNcL=qq{eCSgbEgoa%PPdQHOyQ*Af(MuD<>)GL6%Sk8)tE~z)uUoE8M5UxU;^g?SmVq7P#*oPpvBZh8!Y|b@s4p@4=2zb< z_L<{JNdoI2zz}rpS2S>k3Tcm7{)hSLT*}J% zb@STA-CPVxY?Wj0#gH7XF&y>JKQ;VBKt;O}AN~I83pXgZT=KC4I_eUX(b4WTpi@L< zja;6m)*5pXu!4XVh^tlJ#b$I#V0hv}l(u&vnApG#3``J(P~2rR(UyUuZ(rHVw~fu4 zn!VRZj@vlnJ+4vL%bA`5q&%V@XoEB{Gd=`>A-+jS4QWQ40plHZxyhi(9sl(YZLBFa zTV9G|yb5_0M~pr{Kv?J`Mg!OyW;X#neqy8Lkk>0eProW9l!mwEALH*x=KD-K@Z#9; zNjA$J$&C=M*o-422a|rjWDypNyq%nP#~yNzNomM)76%OiD&AQh!IB}#gQuuW;RoJ* z$8P^>Y>s#x9y_XeJ~*qKkK5T9eewYn_Af~JD1o#-Npm0@mJUE2^P5HxDuU9D_wRW` z+P1s?2sZQFfD6HS<-+!`>@!72vY-7>gPlIC-81te?xgz8;|2KKt4(toS)Ux6 z3yYunodTCehop> @?ZX|*|Hp)qHne<>C8n1tt0#jR$V>xa5zBktlHp~&sjydog z5@(Z9(YbZV<@}%q5U`|Z1cGBj$1Ke;fuhV`0p@$~IN1Bipu`-aQ!&SNp-(J6%GjhA2s|ZDGt|kU z13LTTrfP=DDQBhcU>M{MzQd?CLClsng+ip4ol!=|V(wo*&kYbT3l#!10nVcnltd7a zj+-cM5!m*ynNH~Ql??r%u{q4RZVMGc-g_O5@_u_(Vmt+M>Aez=Tc&) zOBTCYmXEuCt=8TtW3@5&j~nn91gwC*Y9Ozm?g2l6V<6?n>;u`wJPSP-$l4or=JQyx ztu_;BEXq20qq5Gc_wRfR5#0a+68PY322r34o_s$x=EDTO)5V_s6iCNGO!mI4Wj z;bhe4R{NH1d`MSl#m{6pzI%Co-LShKSC^*|+N4udHknm2I`wHo2)Nl}*W~$4MQ_`oO(W-J zGDb(ElG&oksZSi`qe|ry`$0e_F+YSO<;e$l7i`^&CtNo>TBVxfQDR#Aq>R>!+dbWP z#da2)#zAqPo?X}@cJIOOKYgw6uJK0{o2{ZLmt<5bdR<#^^xzzq{IT0ch%5N((aC?1 zVV9N_sht7z3g*Ct2Os@C1`WO0BC?6M!6%23oyu{$YUothmd;Kgp_mMAkIbTTmHPnY zyeUb{X~XM+CAd5OM?SrM`9UjBjXeOLB8!RMXk}tpDBtLFu7c4e$O;K5&0%ck9W0$l zGQ-nQvbCR6lskkwk0cOy8rLUH@&&z3~CxUIvV31z(XqyD) z(k$~2^V3iyY`_Fx#(Xk~!iYesS8Ee2aBeXXr36%$cl`)%U9{(g#RI?MLxRK&UiR0E$Rk5Rokp6tRvdx7e^C zA^2~6JBPh(M%)bdvx_lVr(BfDI{O8`&R5wD2`Qk{P;c$^gVsq<(&?WM#v0@u9Qa)+ zA9S&s`Cf{_8}Ds#TA5(Wx+nas|8OfEs^6wCLz*AKR}Dr{UVZ=k_N=LO0vqq5`lh8= zGV9A=Z*WtM_Q5Hi_4cgi(_sX`#C)73336sdY*d$`@GQHKsOu80SQ&WZ4MPt>gW^Lh zS`{DCdU)RHb}aY|xm^x%XyY)42kVlxMU)x!O_|QNr{OLz z^*(1~l=nHO`_(9sh(BgMnH686BIn@k?IF zlm7^1+y_|yo7acqj)(gUXtN8}sO+NlcY_tWSy}Z$96z?78s92wm3_jedC?}xE{1F- z7IXpa8@lvlY};(|rP1KFj97FoD#T*eky2l z_n5OS%EVljNuDc(Y*R-12Ty$9df7G}KbM9NIVD9n!Yp!d58>LULq`Tw8Q6Fx=WoML z9%I+$D+|`)hxuuX@hK=-Q~ZUri$X3PYf4@^hq3IQYr3ROJ>qmZ@(MfW{+YtmgU z_o--`luyO%T7Eu93Yl2F1bR9M!l|edyeWn-h@H?($ZA$0xV5m7V?lM<9!c_00Y3B_2nQzpg|S57pwcVp5zw?hI2cc67# z{D!1miZ-B@o9J!jVW?lu_7OzCS>gSR-9~FlR5n^0*Uir7OG_qu0%3^en7v9i&ZLO< z;UBkEOF<8k_x81hk?U~>3VqI8L-yKg6|y%QT0b4$s?zmEfGWr6c*2<6=U@iHSUwr2 zHnA%zk8nh?4C8ykJ;oj!uPX!|C%cT-Dp+gRl|=DmEnVO&G7zL$(&0uAAp*maWNVq# z$_3EGd+oqJ2#wz*_b#|}WnT(jVu>o0?OKfU6E=kmB)Lx>n9YoA@f$Nqm9(u&JpvN) zZZ*g+`KSQoMnz}aD%b)s@o!s^d*hDTe+I$MgrJLZCWN$TDt|T&UeO5?L8BX1ZFbMq zO3RSSSYs8IKB8WoFnPpneIC0%E_ZqMlCuv+m7IgS-#W$&t_deDWR2_<>(49)NEE@h ztX0ZJv-mvUMGXGN4c~X$mxV!n8Y_~(%)2>UGmB!39mqtv)Lr&?DiGd* zzCTX}uogvMBvOoKMbAlpPLzra-5I~P^a-mM2b zo?;k#bQ)!t^f98ZoZb>7%=_gCnTQkLkPq&AV=vP{1hE{G)ym|U!VwzW*`8ac-U_6j zTfxcyeyaPbURVAtD`v(=Wp&uEqCe#*g3-|3C@F>Xe!{_E1$hOQ9AA;nI%*43ItF1m zHcT^RYYz`QO=|BASmNn%2YlR+EZ*vvl<{^uwGz&ElvJVVTb;5?8_cw}Cdmn}-eq)o z^^nev1MhdhM(abeDq0_HK14XTDlv{Aordd^2*^Sy-(@4jJU7AC-&Z8qP}Oz+5~`i4 zIFnRP<>SMun$3qqJ?8Bq|kUImzbfvR6%(%>D+YF z+y%xyq?m*9A*Broolk}^5n+mnMX7UpJHsLbmqwS-g?^Z=%|f4X&%Z4Ho$(n9-61-I zi7u&N(thgj;^3H=*yQL%L~JY}AQS;0g1r&arG(eW)I&j-o#M0P5jxpxmLlrkxSsfz z8$-X}=W29{nNLG>t0($=JwH|c@Yc2WkH+kK$YEdRd8odS!M-E#Z?*bfaQqDZtW8!& zWo@!ck@rGSeXxODEYvtD}1$S=Gj1zDn`d^g%TqrLaa86DP%y7MDlS>9-L6y)T^e*%QF z-p~$qk{l%K3$#XLiC}HN&hh+WY+l7)?pg%2G({D&Zh$K3yl2xpQmF>QycC~N#bTL+ zwFc63O`^%*E&~PefDD@y$f-~_-!J)jthKmP+rnvz7@f;1$GBZmcrdXm!on{MF+|}n zr2Bfdq*uzwZ*YVB5HI^haXy(tu+PM2Tc`&51;KTF=et`yp5KMfAjv%yGBN>0O*=}2Cb3c1_#yFLnUDrXC zljj?Pn8s|$krHDit0HYTvieQ1$59f;Mh#>HfLt9flAWpmnJ*yBr^dFaE?p+A1QZ2H zt1fBX^6jqx1$l3fD#YQ~R-{ENd-I6TbHeSYCtspqoW!sx1g(rsq1-=-!2_JgJ;@JC z`>SkEmyCzK9AAk^zeVg=&|-WH$`rFbxWt`YQ>Au6i+EuK!)hl%{Gc^#%NOphp3lK* zuY3;HFJ23o;P@iE(&m5x|n82lxGqGbii{0$VMf#kl?tI(8DP{ z*N*jW^NxObYx5HoEPjT+z_KB0iQrUzS;YzAN&YGLnpsL zU(qEgqb0KANK*IlYJKy!S<1b!DMj&jy`&FWJEMHa8%0$7$xA{Qb{u!9^GaQJ%(5@m zX?DS~#Lq+d{2i(XKM9|3koqsJ&m&_~Ab;6TXW@&3*G`$>^Dpj4BU8_GbKU@3sRgW! z6INnLgw%lvLCs*&jUiLcQGJi_OJILZt$8@97^78Q$GBq8$w{$46=pFHlS8jru)&2A zkBP8tLe_VklnXh8tX#-(JtzMJWh7UTCXyjcuApFM)CW5xC2r^+-a&o`p9bx$0_d9b z?n)Z|m{6~dZKJLeTX3KynUYj2$);86Ked`jyCSo+j_+sR7|TEt@ zEDgDj9uYZU!$Rset-&6YuaO!eQ4TQ#WpYT1;kjsjL16&@6Zbc;jq4H^9>JjgvmU}Q z{kp<0LCXD%A$U`=R>52CS5^1+wjyvbf}kpK7JN9kTy)Dpe~*F)^KdEgzzD88lfQ(V zHcQp{KGw`B<)~av`4?>*m{_OQ2`x$=j2A&U(LdoU^Ai$|Jowp;$o6)9+`O_gcM*b3 zq4=U~ih6rWTDsl8KC=U{D{(f!c^`6qWTOq(HTpoS>#sI&3Gj*6`Mgcmg=m7ZF2wb; zg44~MokmhclbVDC7UOvGg+0B}Wx)f82qF!yJXG9%Xl&bJewBz96OA&ZSho%np5p{v zKD*)27so&^8c2uGtL$9oM_2A5kV$$D-X!1}nrx0$x?Y z0t$ph^J1rWheweQV56n^sPiX6b6(Nd@Qc!Q1?jOqh^}8@S6&+1IyrllyMV#;I)QIU zU&bT~(>nF#Gl`sY<$FknuQiBFOA@w9)Hmz4q;k)_Seu zZF_T!)_SY0wbA?bRqwUc(b{Oew^~PSfBQFo`{Q!_;~!refBU!p>Cd76{FndmPu9ji z|E~Xh``17J`QQE1fBBdHtc}JnznR}-%33?My(IVN|NL+N`@jF+|M7b=fBvuk^Ix|g z`G-2oB2JIl2TEjl)Yf9#M|C$+k4ySeQclC(Kmtc z|MpYgkY<^FyxtqPO+N+glGNer++lEgYR=++p;bV%< zFAMx$d#v%!Shc;BeTF&742{eX%ZX`VnJbl|ZEv^M2NbA{@mAZYn^A1~gB921!dyKu@o=v-~)zKKWy_8+MvOjGPtN>axwwEzBBj?^g zkG8M5B=|$&;2p59b^GCMv1;#ca43&$eTbd(vgQBrUqxyYH-{0kaVo|f!){UT zgUn-_HB4#yztJ1C?VZi4HnFg?kPGj%Hl8-8WwX+yqWa&=@6INjjB+-ap!dDf9~HG@ z588O!JobRyG`K#DZR8m>Ui?NucOIMqu!={=# z#GIAYA>}m1HClhv%}woUt!)=$i%oFko2d?pw|xY?!>;n{I_BF9Uk&k$&QnyoRs8I; z+xp;G-PN@kFd*pURVc>o-YSL*f7&1+!db`0Bcyfg{eb9Dinf2x^$(sDNU_MiC%}M8CnEtAr@ukYm{m>o3FeHhpV!3Px=& zInL?3kJG2BHN>+zD*R{L5J=qu1J(D7Q$40-oVoPt@D)0_6qVD-yM0yTM_;k2J0fp= zV7Uc;3Rym^9$ww8n&U#07A%9ekK_@UZ8=!7b zRW?Y0w+Mzd;~o$bcJakEzaEDOAuSv6-ivu_vs2!>!&*oJ!6bf1u_Q?BsG2TmqLNn)mIi?FH%&SsFq0*Uj|fIHsNBr8C)P z?Xrs|s_iA4-D=OyMAQTkdRt$BE-FxObn$(Ui-c`dAhF^nWq3ap70Tu+irXz(8SQgc zMu)h^@T||AyGKg1Fn3Y#$(^Z?FV_dvl(!`i8%Ow#T=e{@qx#&c=Jl z5@K;lZ7-$l`{zFHU*nFzLVz!rhvJRerW<3T+PMUqBO8o(-)c4lX)9RSf2J&dq`XaG5L12Q!+V3m69oL2lweCuB&40Oig;70B*Ak znnPp2o1hL@9!U#48N(hh|C3_fj76nPxJ4yCq!7K@Udrwc+$o@Jdj#1wfF$B@Q#wK5 zm*&1qDVkf8^}fWUe9(GVA6HKJg6aJ>vBnpuJM-Ov{O=(!u_EJ7Rx6f}lJc>{xEo+T zL;V?F>kyuY5V&$$P?N%C9$+5$f@mY8AgJ&#W%x~R67gONG8 z(I)V}Pql6|! z6#-@1y5L}>C&())(L+jlOxH(yo8cO*gEK*Guih>`>w;a_2vJED;lGGwV5-O|z={t1 zlz>Dg9Fr>9J_87 z<|NH4mW)suzKQq`a7o}a6?l@VL?HNxoQ=>S+fV#OtFvg2U6uW)fNbkxO^jR3E18|N z3?CgEIH*l;@C7Pz08uEHvh30E5%hz|xQ=gV!2*l3x%JA?ZwoELxYPV zkP^nYlT~0gB!nT61}c1TSN*jPY4NTcGxC38fP8KcE0!bZ1N{1B-$=u*~ z3Hsq?H>B8zHz0Y(ufcD(8JH?DB^<$EB%eva_U7vr;-Rsu+70iLHY-P}pp4Jj9{T(d zW78aw6*u^|DiN4W8B+yWQS<}w$G%IsECw0kl|fPjT|(LrXo+!m=H-k(!L4l8#vY8y z^hUfC*`!9*mv=Y6w%2B1vP=>?epl0#b|FcrDS6aMI{^4L6+x>dLINu z<-J0)m!K+AaFR)j9mxS~q5`k;ExRH2w9E10Bn z2qE7(c9xL~fr(@Hkbo82MGN9z;N-(=YZEs>DGys@pY z!Ttsbt6(U!g8+nlF3)M)3ApS}ahD-7ph+OPxHSoAy9<@hA+mB0I7Ql`WPZd=bpot5 zxoTD!*hBHFJ^Jc6M7mFBjLk_0wY`MHOMa}0aME;+eFhPchw-sDx<&|yKTpcA?1Oe! zc4FLSCpMR$iYJkDGCKjjqBzH7V!34tt+mEzwY`*`FU%LsSlbS7 zTMizMSRgx~w%cOfe8Dl9hFO z3Tq}-uoJ*wI5Ge%L7m&L2@TH;M+_GtU$~>qFT6_hUyjB0!aW+zabuuuj?wQtzzJ%% zF10K6MG4$M?V3>nRz$aL8rb#T1gs%A~M_=@UhVx<{|VRLyE73eGH`A$KR0 zgCq*!1b!C|ne|w<(n@;&m()m#zNLRkaNZWRy&Q$l@R67uqPmcaZkHBH2o3zj{l$;H zF(Ymdw%KAFU~5rT>n;T#Gh<9B$~a?>4vkYNZ8RgP8tlpYroJfu@DDZy+e_cfiY{G{ zG(MyE2d?&cyz=X@c-40ueD8b4j6rjjG07jrhMj)di`IKS^M<{ml}c};RDxRH^BL^p zN7=pt@%ORr+jVEn=3;!*IT+=mF8b)K`B>(W0swojq|L3;LpG$<_?kUipoBMH`n)4q zY$k`xsiW0UXXm!2xa@U2g|lPbS$Y~n7(dB4DiRHr_{)`ibTF2GlsNfW9AeqyjGAL+CF?#qSxjOhs3hfq|=n-%Rgbfz$y zI4@30TeB*dzY4X$7Cxl1bxIVw@5IK*eN4oV;L7P4X_0S466m)< zZJXKeU|ga`N@IGR-wH~p@cks@Nb$5LpK)tD7XW_oN%3De7SQ6-?e;rw%GUDitqw;~ zV$Z~v0I;XuLMnhlXe1T*?zY}igXygDu$8G!X0Q{uNS7ImLTYj-Lcg)dL7tOk3>Ida zvO<9A|HIM-KF4nrB zO0k>6+?}C5&4|4Lb*^Xav}tHc6URt=L6D9f%E9^?d-f_fXiOU)Qga5W&4zq{K~`$$ zBEBN%4~=C*bH2nXdDCK(qgKh3?2gs@sKzWhLSyLyVPOJOCM&UOlWrxr zlz)L;lMG3WLv)hzgEX91HAp`{78H@LyTvy+>yrs4tL-K3j?9-2j;vu3r4d64g)9LM z$>A%rdhj%FPnh~YzMJqTCzqVl(G<14986m}L5R*0R~Louvgu&WI`)rDbd{Wq^o7Y(nX`rcBX@SAO@1M(pFATY6(Fk5V&NS=;~25&C? z4%wo#9Y#p`NG8gOD+2v4PJ*XE7)Q8qYx9J@>D<6_VOvzuwqti&K|-Gkah@xTiLH#)o1r&jle`~QDE?yT`c zUTkuSR+$ZQA8lPHdz2!JL{@2$X8P609a1443$Ba(xU~ZDzVpl(gCy4&n+`tcTvZb0 zvC5x;zZ*Qaq_%Jcm8Ml2J;y^6em|BKe%C_(J`QDCsOa0sN)XTu|M`ysyrCD{z~ zrBYvv72jSK{&93Lq_}Zp<~TTePO#W2&KovZ=s@VDtU~hf=r7)X&O8_260iFbaS}ZF zn7y*er=wUJPsI3OipK_k2B;x5rlF&Q=4kHHRl?G;b4jb1oezhL zIn_t&Wbx2;CJmR=Gjhm-P<6JVb;eUt4Xq2Q$rDOd-gzPi`SMuYj7_(~`>0*QlNZk7%%VuG zw@+Bh76*~DN;1}oIbe1ZxijgSB>Ze8pG!m%5$eLKmGlWnDf(I4eA!ri(tX)AnGn26 zCiD-5;}bKC72q&ir6Om|+mkaUq-Z?J@_F<;Evn-u%f0TI?cRV(Gk@h4$7c zul>>dbUva=uD=Q~Js3xYpcyP=RJv%aj3gG!q=bBCp7Q=N4;?~qMVS!7(cf@RE9Q}#ojVyUlEC8t=CN_0 zK6wOVfo$QH|A@wCom4bF$NOXdq;B4jqe&bP=2qAp#*Z;SZ8P5^W4zD(iLwaCq5}66 zi8C3gXb#8zpVS{rV#SObu?kEbyj7K5__{JL8ILQMiww5Y=47<;HYcC=sg;jYYZA2T zWL^M`TW>qSZ4V_eivpx;LK}UdNynU&O*$Q<-wFGX=@(2cSev-0O1*Rl1_C^!aj};L zpMHJTw_|mJ{?hm&(#sgLGJ09*{INRS$#>ORIviCfb%uHA7$B3vPe>L?&*u;ju`?^b z_8U)(MYY0xIlgG0bx}q8e4IBwoxPBW3fl#TL+ZA%$Rh~{WMl@-tXskX-oXJ-Qo9U+ zpt^rT@_j65|2pSnZQncNln>tPgS0;NS)gZ*EpiZnR>qVXj0sP?62muH6lSU*AJ{R= z=+EjLBHs_nzvz3oKZ;?q@yRHg&2mjmNhk3kEt-Br{)|VPLnRG8HV7enY=MIJu zVl#4)SCY{Avw9$7v51>K(hQ;;C@5KTbh)20S?R~4vu&`98IS4D&~7PBY~WLPK&gxM zkWU@Logr%c&;!4KU-u7Rois_*9_>=fHlMwKLsoy|uR=@y&ny<05vs zjIB2RW`55xs^ad?;8e=lcMbu3Ee}am>{f->qMah+Kn-ed@qL!G{WuP3;`Kp4Q*fnS zNh+EH)SmK3(0Iaz(4(+Eh&C@oR@xmtZScjsa#paH1k_3fsmjv4z8d;&EMexRNwMHM z2@`|z*}9|u^6CH*mOu~@^FlHW><&Xvm9v>$?l_gh*OS-&);Z+U_>er^n5PdZhN65( z$=#RKpqK)P=mFW;hG;mOb;uC0vIxY)Z>8RVKiJwA%80S}A$Nc0W%fn~mA$pQn>6-R ze314E33gLJco*OZ5MjuF+2sx7ZD%Pu<^&!j23y>L>OQl)SZr;I7AX*1)l+`+< zdscS_9@#|f=9q|)ddsAUENB(kNN%z#rb#4tt&}V1x@YKu)y`=ZtX{6lDQ9R8N5R`) z8gU1L?vQ35HU!k#-=uOyx(@Z@Hummz;^{HTp7AJk^Dx7=;AnHpQTb%DQ9jw@9QCP7 zOHwlylDps(;ZX%tc7$%2??XcU@je=uaI2BQC!eAUK854r(TiJf8S-FBtS8dAn18{S z>={5K^*6X3gR%4B>0gZn8U}N#f6nNll{5AT3C5Une4Cts^z<;^N#z%Akc|uo>-09f zvxLbV7#T!%U_}Z1NEOB;9GKGmSi|6_WAR5N-0Equu6R|fPe)WKr_E<;H#ikw<3V#} z>+cXzN9S(OTTrVYOKIkTC$2wo>UxPW`I>i1NQZ3D%4c^(n2S3Hnd`OLt3iZ-#J&x_ z%T7?K9I)=z_%`cOLq6rvLH0ZMJ)3&eJv~1b`@d=TFGw$ncPa;Mk8`2+!d93JSLy(} z{;QaMr4dN#FJX561Ydxl|rhTkDg)#)#*BwbRN{MkC>c`RN*Uwcp#-b=8_se}X1yI(jR z7oIg9#3yNp#0mgU^1g;ydV@plgwVp?PL9659#t>~aIxsa>@R zo7x~O>{@y@SOMFg#YNU@GGh>&>LHj$>M}D?2fUNAgq*k@-#M83{8+KVB~i^vl?ygm zWn6GaxG?(TnchajU>?PbC+RihP$7GhpaT56@o(V|@$0p|NmG6kWY?vp&o1y&oh#KuY^jZLmHFn#vFw`y+jKPo=?m1ek@Yu>nnymLVYUQDxXuy z2Q6^MH4NmuN~KD|&l9k1-ljs^hmb?EW#JCkfJY3_UU-qtF&5o3m$(L3Hf2*nRM~2C z?BMCvm?m-plggP?sV6qtC_-JujuN+y&Mo{lURj)ryML}=PQ_}iaw_&XryI^tq;a3v z2_(T}%G8O*y71C+w*JZauQB8rKcRS+qfJqn9M@3kE>w*-tI_;PIx&GF87nUpf{}y; z=C0FMysRr>AB!!Sd!L`Z3r?Br-SHFwA5PnXjgb^kit>zcwF!QLz|Z7D3ubZp(v`7= zR_9by%(|rA370cwA?RQU1C|R!28`Ni@}o)UmQ#<&WSaaZytn)dEVtId?fofW`+ls; zaebj4&n|1@RVw;ejFVR&7MXx_KYK-Z)@1{QprHN|)Qw4ukT?1^%=E}PT8o<0k&g22P(k5 zDqTOq#IS#dPLR>7^$7^Y*#lud{{)%$V{wf--R2L@m|_f=rsclt6V=29r78h;7E(A} z&_<)Tx7viLZ-`l}v`CoXIt)VPy_Z$I&}65ixBJUX+b?kMBV*C|`+GQwwys1~v|XQY zbUL{@rI`=U6l8)eM@HWF?CJ?*vZ|`SpQ;HiYE?||;V2bewd7RJ4nBufFh&AQQVK6@ zx|$8m^f^!+0oa}Fj2m2HIf9Uv zNx6(eV4JQxJ}mpbk}WEGlfAx=ydV=KsxqpOEP#fRHx&X4hvbB0IOuH2Y=w@*e@u{s zsqCU5_>tG~c#n)@y>ht4;zlPIJdRNuchmZEQhjVIYcb+_H0VVDs@{=zPI2N)3LN+~oMfJd!0y9G?#Q134wY z+@;UorMK@d^ziS-Y903%;0JH5SHau3XC0@*0Yn&t80^s$ZVn<#pZ%k^$Si13=Uc^c zN!w_YOWGb+g19r;NIXAb&z`@GeY#&=>vs2m>?235qAklc4i_%4&W6sxDl|-0 zTG(fk0#DLo!puXyU2|K)o-Mb2JVu{PQZf3hk2oJLOqPWg^5dYKr5IINkneZ{t$}Px z68Fe^MLm7LCvDHb06fIAc^y!G$A$T|O8AL=ufwddApzOv{xfgNLM9 z;pP2hDJC0}y)xO@bnMN=d2KX1h=vckQji{G)`cpm*q^iqn#JGovj-{` z>$;))&?@IljzI-ymRos4KC32GjCr59Rq3W?`X_LUQD$b0-^yX%?cimx$^ug+T~tm- zhIjG~LMvBkJrrJt+cq0n#z47>xu7&cJr%^)v4A{#ed+^rl+D>YWo=$MHct20!|o3( zC;Z#YH|Za^{BX@gQJ~r7J8{~RduB}eo_wE-W$Qk<&(S+=Tvpy`dt3z{&&MX)WQnnr z;=hG00^Kwi@d@|YtOMlJC4+d4oU1-w-+KdA#m8Wy@;)y8(5IV+U_&6an)o~R93oLc zNkEcV;U1pct7Xd9cO@8&gNrt5mCMpbcs{*6X<*WLLekM2N)e5i7#X%;d&FbZ+Ggj3 z5Q5U!4a(su!M-|{2p#TkLNz*s?3B?Vx?|5i9;89yf`jVdwB|h{^cUj|c{%&S7!TT) z@_?I+W^o=q-D1k5@f44wU0AL&D<|i{J>qoPv{vQ*yn&s>?(jPv#uj%ewffFanYlfL zJ-;@VT`Kp_l1AO$E0eu9$2EuNC+^JC^!&R)5;^M!r~wy&okF-KtNEmX$ygxv&E+tG z7rW-5lCkNYj|8zusOPD%}xM?0r2$_dWzi1?MUz(RAm zjVKhyVti2{7HbZ#f4;3!-28;>3~Q5gX0yz^Ba1mV&OJ&U;Zd}BHx7x+&G|Dlmj)lT zQz`hEK7FJtoggw3T2vR;FZL;YTI`mSATM`Z3QTz=reB1+c?2?f^jwlxITs!8Au@BY z#=QY1Bp_tXlcvYZnxq7R;u$Ot%mZ{({t41pQ2lRNUNT>17Y>y@ik}bwtT?#C65WgS&ay*p5xGPZqht~pQv4>c3FF6 zTu%4ROLf|?q{V`XaJf3Z9TKBD*Mb@^E|2^FDv1{#m#;Gs5|YMyt86gKk+Jhpnt2*( zUcZNosy8Ma+-BIfWMMD@2~bi+lM)S2Pe_XoT>~5M{+gYBzb-c4X9mXFpt5ntnZNUs zEx~Z0TM`65Glj;;CRheRZ&Kttm5ZN{FjwVtm6XVNFp}B$K&$p&v@Y+E_stET>>?>S z8D(85N60t&R9@y*w?4UB>6DcmV&H`UPH1fC50iXWL-2#MxnxXgSgP>s{QRqw<~`Dl z*GL!kil zGe{#k@mM*&?UL@!t^ju2wjIuV`{@HqhHI`5@`22>-juAe_4c>|`otX#E+Y`~PB{oO z#?OeZ_^n4@Yy?OmCxQEXHQPG8lk%Y@TlIz{NyL)9i}<*Sc{p!&mh3+4fc-5 z=^nD&hsGgz@Ynn3NUqqdaVTP`E1v-nyP*hsD2h}77`Dg!pyQ1vr8=hUgT9?|G9}xh zk}2hAOw8xw&(uAVli&vcK4g-x`B}9PQkg-B>72ka1X}pFrv&r+%g!?46g{VtVIYe`Go1SPtsgX8r^j`)$%S!LzphVMC@g^oxT;xdLN=y*86ze%i+$wIJ{qi-jS^dbVEpyptTP* zQZ5eNTtBJ?#6?NAB;`wT$9?@fZFgJ_MpfiWA}a+E!zNeWMpLINL2-)yp8iqrXX|g= zC8qHGr3b!G;eK^M_h;vljy`&obPVC1wUjO?K~zY$Dj^`UddBZQn5}}Rl%_hQtBBoX zawLjNg7Uy-K0KD)*ViRIkLTQk>{SfW@BTOH4|`vkYGKYuCk3R)Evv#$un&VLao$*N zeX##%A6JifPd4AXj8sfWI6r&bS9*F_58Xs#I)uV75B?#_p}5tU5VqMD27Ju6G09Vy zDn2FD-B|EuxNi!xStqS*Hp>O2Ck}z-M8<4(G67@~kjPc7pqXZ46OXFPwLRaLYK3Fh zm(dh5{c@?8yp0s;$`x~W|Q*U6#Ngc9)xffK36zE)~2n|e&g_3{d)uJ!? zU%Y%g9%`D|#vE0)>EKN-o;-)Fh;S5^2$<4`I3PlEpm4$;>Eir`L<=VI*D=!JIlMk8 zqqSeoHQA3|a?Da{n_i_cC}1a`b_3$P2_G||n~+m%+hO9wyA^l@K~9VCs>X*zeKG^a zSa$X1j55N9Prj(=vpZs^JNaFD-7%#724n=;sK)ll& z0cBsbiB{R7?a?fAIwwYfOsmCeN+;lrID zo;Ldckpl|l#HM+C-5$7x>X?|mvJpO}#CT_nvc@kt#R-scz2+I%S|^*gmwXzNT7>Y{ z_H|}cEv4Zl>|dSxm&TIQ#oLGwy^cXeZw@m!7j?*=un~~}rb!%NJ6}b88|E-?5k{89 zMiv~TL&F0XWQf}UltGOQ!Qn@}!iTXa<;}e*eB^J|IV&5oIi7EDb;ASLY356;1q#!S z)nQ@gsBCw37qiz45D;)?FmjA%bB$k(1t7d@?0Fv)jEy!aV`Dks`T1Hs?mkh%AX=Bo zHcQzg;qVRgoo$e_&i5h#mz2uiKLsh7Vm+Rmf84Be3hdlIIq$?<7|=?Ftz}ysfcIXT zn+@>z?)%a#ma6Ylrx;SoM#Yfw(P(?hH>BHdua^m=rhV2iCtYVAPc>v--*)b4&+#h0X3`f!K*0uVGI^OTaxJL)S5x6@cWi@ClvECL%8pes}C!S9xG zGDmp)iI)*3I=^6*45(Qu{j)un-Tu8D=u&!UD!BomXwrDE>ihiVShW7;1~@zpvbbWS zGR5m7tuXrHfK6xHGX4|#5jY!iBa-0KCou-3l%1NurjfyDGAjj8Ei5aYHoikp`fHYF zAFKQNYi9HG(G6+jP>%M@YX)_3>c`uuRl`a%9B@AA|BXgrh=# zN{vSsUBp>EwD@6~vv~)uO3GT~xH_urZ_vVYUF3x>M6!3sNTv`$%B zqs`LWed^u-j|^I)Nr)m$l9CUCSnaaWY&{`~$r}iv3{ou_lJLD|5l-U}+nM`@D`Sc? zS{YMZImABoHj}X8nG4qK1ojH=C(&u_SsS#Pl{D%EOkbS)4?UuC4bS1)apC^hXhMq0 zM-$5tiOdDc#fh9?W8iet7#=&+Q|`ydn#F{B{FhBC%I4*IoO5jetFgBrAuSn)gAptxipwSA z+L8Gk%(t;YLolSUk2t*CtL7MxW2QYO|%X zQBr0@bvEJ%XFPe;+SuI2)_=*KI{pEYd&0T`g7Ns=cQT6CjRjo9>+49(Z{~LwgD*+B z7{YPeM` z42=2)0S9$oqVjCXuZ-Z*61bi#_(ewdZY*1LbKxE$wf9*&6}`{ppvcenYzeS|t&J)U zi~B%Ir8lugDFH}9Yd>d$I4EfV7(NO5KhMT3pg7%w;%rT^MP+Ns!7rU43wzrdLK7*R z+IR0R%^a=qMc6uW)z4t9_hX4tDcmy{!33X`2`0MxbX{Nuq6|pV%1|S9N$D+W+)Lmt zN(U9?&R723@p=2X3~fPbTHkM9OgY)4V#+D+5ae|8!>mwM>>*Qdz%(T8%)@}08H{0= z?a5qhABO}vTtjB?z$p}+l}Vu-y+)_<49S!xy#^#WnON~qjBuZi?Z)cNak&sYzt$g*Xw0j14~!?-4n^I93<~Y1^OLc@ywp zxTICl$K`hEy#9lJOR6lGeC2#6Tl>{HFYE5+L~J%5?N!6%;(6Y?qyPHptmUzXo|KO0oC_RG#dc z853AU>AT=y(TLR4=YNPsSW~L9vBFvnyh8vrsf|u5i-!UKx}~}sYmnGiuoQ>tqe(#- zyEL1g?;$5$Ee)iCo>}~5MTG2PAfvPHO6di9r%)X9G|dm+Ynh5DO0O=!?h3mFd~vx~f@ zIGCVJS+12kRpI1F7Vc^nNVq<6?OZXKGUl%H()|eNJa- zu##ZLCb5f5zy=Mo?fh6{phMV4nm-udE2KyEBL4lyGp|E#w|i`DEl#S&sM4{|S5GN~ zRx$^MHxb{`SwumaMJLM)1++VA<m zafCOX$E(nqAqI%fN5&%lz-*0$Lq(qqXab&!WKR$kn|PEK&Py={4g9A!{tIJ`=YC(n zk}|BqW>=K4#ogbh1kpR=&fph()G}>D$YiL7wAoYp$-T2=BV3YDj{uKc!|`+F=XYcA z4CYvb5P5Xe1>BFayYlmcNoLnhB}&E2*}w<_t&%$@o+tImxDBuHeE}CE&>yECwALzU zcb`k)?hM&HcIWW`2=;MCq_0l$Dl9s0WBkqh?zHz_IUUTdPN!$sO#7o6ut+0a$ynAV zgg!rR6Zev$1WgTh^vV=q!SZ1jNyh@N(I%&YTRJk%XNo~fp`Zq2h8CkLE$J*kw25cv zM^LXl2>IRx+OjZ@Jm-gd&JU5xv5PvpO#UG&YnDr>!^s|az_AL(hi#BYm1BNb(G$jfzM=Nx`ab8JKM1(Np&ZIY!UD)7>SJ*KmK zhA_t;WfDKjX!tRyL;scj{#cT1KLWgDqctkocs!o?ToXqAKthY>CjfL$`i+gmSnSR0%4c-WznR~Q)kYOtj;643RzCV!mgx{%#v8&n+fSvre@auiHIT7N zjf(jeJ5*{mfLQ0c%>4ZXrxumcNbjej=>A2X4ec#rCmyByG2#zPDqE^;^_Kd~Kj;P9j zGr3WzsgRc;XWe-S3Jcd}X_H-6*a4FE$#)|9q`Y^^gylZGQ#TDZ zweoL}nRN&{9^wKhcNe@im?0e}IGSXH(v=|ruFw1rPGnNij1H4eXQk@@4;6YB4E?f> za_T7KhRyg%Xn||wQTW+K!)|zznpjSt1kyG1PZgg4=CF7rN3=kGuv??a0x~oE>(*+~ ztGOH|>%v&;oHFHTJ~rmmeIgk@vSsAcm0bp%sgb0UbSZ;KxyuXNaT+}l^Y2l)7)&=& zI3fvwe+~faFI<{+EdE;`>*VKyO@p#-c{=v_sRKfw^K5RV|B-SIR*=`~ux}mMg(28*OmeEsj4;oH(T3|1GNf2bEK*DpA*n9eg{_F*0GLA{Rg9j)M zJb<&>XXUIu+G$Vidg9kfx#1gLM#BClW^L@T?ay34viOi=O>=Z873&b9GI}{}6)%oz z5^@r0GKpr#Cta;LS~mVN2us%aKq2gQyw~L!N0Y(5D8(tS7i@h-WD+>AszabKIbG>H zrKc0NU%;Cj9Al#bdr`n3R0>G&Hfgm%Z~52T`jUE>!&r=sAlGbBF_}G6I@kXR8;}ZC z0b7LBtlF|yO=9QR$&$eol8pm!{{$zXsD5Y#uCid8lCjX>yEC^cqUtbq7XdUy|%aPN}mHu6+{seckwb9xd-EQ!o2tS zB1$&i;o<#WxpIHq5c38G9-1~$F{$P*ti0qM^b5UF62K|YWl}!>zWe_$mOVO3U!|1v zoBchzQmo2eFP98m-t#F{I~KKhLnJ~L42BBE2BGn609!2MM1chFLR7)~qsJtij$kwW z@3S+h4*@WJhcWE!q$7L2zOlrRW2Po$@VCijqmnh#1ocJff`=vNf(Ly3Gd{PlgjZpc^xjUB^jg5S_>njM186UD^k)9G84|H=fBR@ z9zHZDFuc*Kc$^46tv<86o$izh5RiE19Gf_LUX;NaAncWIA^5$b3b2nAlPm>z<5-){ zT3Kz6YjrMeS{zjCN_C;PoCSB}>y(fzz!NiHW_Uzam%(j$Ta+*N4-jW#G8el^5S{(z zB;V9a4!B9d8>^x(M;-k{4j@K#C{7ijNFmR{@+_wl z@zad^p7i2dCIGPg=eFYuW7)BA)Csf8Jfvx&GUg!I{{ck4sMY2E001A02m}BC000301^_}s0sy)-yjo3fB)1X0@2{}W z0S7FS&5ya*g$h#0A$zdvu1kXCkdI6LKLWgBchl1=d!$I_F0`YWmX`JP>eVBE{L72Q zm!JOp$N2Iyy?m9Im~*9Zqx%-O5;jWP%Rm42@4x@|ANQ7C{`H@~#u(#we~RDzL|@og z*o?)5&CG<2MZ}Cvn2pWEjG2Yml-Wd;jg3{A1)t-GV`C(WmxvZlcqY4JqH~PFtZIXe-;14Y@yTLp}J4Bt?xO z#Bh(PseVLEo2I}BFz`vTBq7M9*pdE+-o<7g&)8>@&($S{Pt&SLIYi&EKx~7ZG zhEzmVyYUW@rs6o`_3n?be=#xS`kN8xvQ7(XIt-xL^NsGgQ4G1~BT*?m!lkmBdUmM^ zz!JSe(S1FM=jSG@tjdPJ-b2(25|xXlA+thJl#1r9tSWE?yn#GsVf)OuKDUL^8yuAC4c06ZeMBa?QBE?w@#mY19A1(a;hi|T>^5S+vdZTos`xtqIG1}Qz z@)d2+-;i)fEmI&R@{FHr)eFZsT#*{(dZT+vnLxfBX^eq3lzQnUQ0iN2yS<}aqT*Wy7&GdWmC^fE+#IAT zfEMpKIbvt8^EJ9IfEyHn9q-;5!MCiXJj)X75^r?hT1z=>t<`!^!AJ9FS24to-B49E zETke*6bbQ0V-||A6iWi-DLrq2%831-JQpTtjD30ggR@QM7J(m_ij=*1fT8&|+2i5G zCH%obSW>PX%_Q~Qom%D^sHOvldVTb_Fsp*t3WLKi{!#P?B;7v8fe<0-c-9n#Kcu3X zIBdWfPl4CF)@xt_$lGF%VWaIp|8^a!Z13exb9hpDb>Q{($LOJmA3GmVRi8%88LisK z25~K$Ek5$NR4LbxYKr+_G>-!UJ9z^dC=5Zt_(F&nwh9p67`P!5N}Rd9wVqyEi!Gy` z^d?ij(Y@ysLoeyDgyOZ(TuDF(uyG&KO`VK-U>pS$9aHyoG^D36s5oj3FYrrXzBgJQ zq&~>pXVzMzWpPO!H@cUcL#c;D^5d-K&}~pud^(vUsKd!`o3VDKQ;X=Sj2qo4raS`0 ze1_zrMff}}w(BIKGJT0L;H!EA7B;X5(8sya$s}1Z_~AV-q9=yc_jThX{V1Qr%muGJ zMh_*P1hGAiLzrmcXQ(KGDPYdDlXffYcQ)-#0KJ|BT-*oX)W2=x+ty;+V{@fcI;B9V z^iyfsF0>O+j^KIYnt6l{1uT>~7J*f{sqeL71+^pZcB-BzkC12_gK6FKp7y=E+UW4* zyZq|>4qe!xc*bQmSM|Z0U*iVPXVg+NTVHF2z*;HP*j~*cFlu-hm4V%&tALyWsW3{* z41+?{V~7ksbBUp1SUzCdd{|3VQdy!B5tY=bg_L@)hjkYL)fJB^+Npo_S1t;xC(t3D zKpIw_g*0vcFtZkW;u0y!?MC-ZrG}jHLF>k2MaU%APG6YWX9eH+-hITI2d3?PO2S;t zJf&oelrUBWdYCcmyDR6}wPY!sq_$V5LzHU_8)*dRgV@9R;7#?s_XxBWI4%U4kaN_R+2Sg{hxiLU+Qxz6KxgT6$ z=7&1z%pAYw?S{Q~tqgXYAxkyi=sqZiF;0#0dK!cB@ho(<9D{U8-`T;AFDm><5~+?r=F@i&rhW7h@ z=spAROa{*dXJ_gs6F#5o=jqW)4CyqqYdxA}QWtN`sN zEcvjtGPjfe_gu@3?vz_d~I^)<-!=Q*M{EL1&#>khzRvC%1*Y&sw(R za6XmvF_6Qx2igw)ayhi~oO8M|0p74DW!d)!a_1}#3ELbB~rqo0)f)F6KR$bN4_oxY*_fi=jR#nac= zDxpj`PWk+WxdzM-K!%T=F4#|73ljA6u13iX$0xa#K;^uY@Qq<+KMvtJx_BpZp0sOH z-fHbVCBCG3?@PBW7`IxNjA^vlx8d8|oBey^HR1vtOc^g$*X;7b}2s z(AQjv!(RdPyCWRM)ti9fGvzrXFn$Q5y*kSOUa;`Cb$Yq4y$}_!<-P^lNW_$zIwI&9$c*=!_qMe-V^IxrDG3u@qaI3a+Y!E!F5Ynb za?J_ag&%W>4?g0#`&Qn#09QVnbV(IA1!7Ly7E;WqAN6~=u)wp8$iz_;7QS<3>?w-B z`sdWE#u)9E?nK+5Kvdg7Jp1D@*Kr0bK6NU!$t9uM0vFid5?EU)Lyq2b) z-ul*gWSll zl$lBuU%x7qD%BmF0EfeY0DcpKS2Dvw$J2NZp=Ewy!PVTX%KA`YSzFA-)RtD>$Jx3a za7j2Q>4A`BRM-lWeUg2`@{>Ipg4vh@r$uGnoN`=*#9$_oDLej|J(}qbwK&;dN3b@8 z#5Lw*YEmTeN2A1yqwt8rzkyKW*CNBuVSf^8*W^lzd6I`j6 zfy^5lLE*b>GZV3Z|0jRzm@9E0{0CJJII;{TUjzjec3Z+!>r(sU{`wM3a930x?JX;R zNQwhUAJ5sT%A~*T;~}P2t!v#bSdBhpQ)5th%pHv|iz#YtQTbA7f+IxZF9E7#17`p# zp7(t0nZFxrPI)b{qyEP^o4j$(#bq%jVdSo5#&y86iP{;wNI#A@(nd@r0W5d?0#bt9 zEHk*&IMW>;^clxDbG$$Cd}}BOQIzART)$@LP0b2GY??ZWcVGfKZNo`&MM8zIA6|w! zPIhUOY%M7AsMWM3V%d`wh*p`K89Y$(CD;chVi>5Lps z{U7%?M;A>_VZ~@}7ne~WJ#V^D+_0&gfu`uKn29|niFM%PgTI2#=%gDr({e6Kb5fJf%~HMN}lUv2*_Nt zWfE6AIc|axsg2_)q+^&~4X7TcfIK0oWgvfm9b^iK{Fzd?V;Zj*YBSO*Wo^!9UQ}mN zTYAQ=QW$`O=y|}n;Kq^-kl^@{jHud};@44SVL}MCL=!^GE8r^IVVz9iOg@UbguIKu zV5->|t;4P3cw@8XK2c;Yl;SULhPs?d>0_n5)aMvc8@+haT~SJ&jGW3LF$_QmrST`D zOeQ*nQj>UyCsxKQ=cx9vsme4L;OcCMCc1E4@z%CeMFR7Z1x`35`89hXRn zXZe#ked_Jh)2&Uav3b;}MWY%2vpoN}?=Y__ zd}6{Y`sPgxaRu_X3Zy53z!QpioW@ORp@iWf!SmF!YLhh2sH-tSj2DV2tA;!7`b`8* zmsRC%AK2+ZoGT>M!w;t(tEe_R(o!QiHZ5^+sVT#De-5mi6ehBmh}jutBgPjtavSP- zRthCJ0{>F7H>J98ZRW;hLlJ`Hb!UeI;u3~r;B+V5ah?)t-}`7E#(L5iS6Df-?WMGA ze5p(3zkAzR>4=aSSs##NCy@mcs`S8sOW@)p_#*YhpA_AIWQiEO4S5!eBF4pT0qUqEr4%xihtbSlyWpFt3+Mf zO)hX>KPEMW3wSVZB#8eM-lyN2T=_88GZsZmdG^z)Hd<4wt>Fv5AVNCO?t;t7mWoz} z`k3Q*cySe^3TYh+YIu@wIhhpfijOu+%*3lOW^&vCWJocQg27Wuit+hIQEID$u0Rb~ zN1wf^A??Y+%MSD6fye-aI`A96#`@0M4X_;uvYCJ<`3Flp@JS(;I=%Ii)46M?{ZZ=j z7z*kkZ8Jfo3U^`u6rPcQ#o|k%9Nuy~aG=$b6qOGzF#_3GYf4zD+URbr{viTTVf&AB zypd!*cngm&wfcLYrA|aqm*1rd-<-VhMXBKSG$zZtg)f{MD9SQmvhEH8)atyedMJPV z-QTD1!dZtVa-FJnF+IWP-RbwP`UML+s@6QMyD5G~Of z)37k+?3?(=-0sa!=sjD9njN{EFVQ$<@iq#F=`eN@W0W|U%tcCY8Fym}!#<_59al6%VQlx#N3+a;z>s>qs z?gw+im%Em@mN$m(hUsKhw;^niCa?-46hY}cP51Vc{*tjsdgbJC3L%zr1a(>6(Ajb{5ciMZmS4JstiKQ-bA|= zG;iC?JmDBKJP>IT>Ita)5w=5kB$f;Ss{W*eP{w-tx`hb2#86Ex$zK8S-YFJ2Bx%DW zVUGm2FikWzu%0*KXr_CNFcWDIocBF?` ze2L<^1bNceS<2f6FDi9)+*rC?u}uBde7FvPR0^9ZH&;S6t}2+cRT<(k<7SMhpu2(y z5tMauR0y%Dn2^jcb{|tcxdgL!6qR{TT&Tx}0!m3Sqa@60ZY7&q?0VV8jfCUH!BDmX z%PQs;p(}3MkO20063?nw#g?^45yV2M)tS&%A~)~-IguQrSX=0CVljrU5EL9!1%WN2 zE$Q@hPd)Sdp=S_2&LI1mO%7#Qip^IKT8Wck10(1mPcQvTFgFRa&n^c_K6Hwi206_` z`85yu)1eWX>TwrxW$@vnaW<@mS~>40>zpL@L3}2(HY-U_S&}KZg*7Bq0?hUz7_Dx| zRfpiJWd%v_$<(M?2>5X03ZVlgQU z>U45l{v$6rv_BZis_FtD2A|2g_f%lrV=w@2>H+)AA$HtO5h{~TlR^%pi^rG%MKa6s z5mNHFI=^`0-_2Q3DkAiawzgoRZ3}K~&7P?;1Z24)!*R}wjZG%<64mxelM29qLnTc5 zqs8{$4s{E>61xiZoKy4OxSXvbLpPNt1)f9FAlwxgF-n&46}<=kfHj^ZSO4|*Z{WdcYR;P2R(!iF z!Dua}Z1EueAVC3_Aauq_>f+nS*@ik3DngUO#+E}ft=RQKlN**1PXR25XW_4`#=^;- zP>Se?su58xz2F|J+nQFbX=}m#aete)(KH`Fm;Di{GJ>W&77DOa_8Tnz1E*8_OMTW* zwi2p0(c9};c6mKR1YQvamb4{cTLwb;M_}`M8W+miTfXnbxsZx+PCe0vxQ^pZR0ed_ z$YWfJ50QYu?~x3m+ORtiLt7@a4P{=Gw;(6V}z%o6-&tuvw7`bA$Bpi8lWgIkAX zAcP|DALOmIcat(;bI!#DZ$j~Yb&lRk+sIrqj9@CFF9jT4=^eM{E|@Pq^%kMA_xD$E349A54#;h_9n)q7uh?t4$KAc0>Y=x zy`51Zyo-Fv5Q@7^rWYS2+0^-m^TE9A17pq9uL3w%m`<;`6;rhq{Ki`tsQ7{%=HVTJ z6lJz!JmjR_JyTA)>g#0Wm z>1$?qdnm^k^h-4&l>aH2;#Wb`ZC;t>P0Vj#SJ=9W9PFT1q|%wHP@Gu?Z{qS_I6>v` zoC>HTO47a0$r*7mmwSo>LBP*DOX7r;7?O%-Y|2CgAq)>Ng4b!< zUof3_LzynW)#Zc|Y&M~UQa&}u+?heP>tF~*Gdm7BcPHT-RpY1RVg@d|2=;%}GjtmY z2dx71Sux{MiPjmHN-SR(WNgJ?(pR`H+`579;s^>Y#@lpsst!;O-DM%9>(C3QhOy?S zcshj^OTx=*1!<#o}HS|f#04%u@4O8 z9?B-M&mmfq!|GSJ$$8)%rJ*?hszib(`Aizi&Ygb3eyGdjRb1-}k}SzIyO^f^og$N$ zki5@Htt}7O80Y!MDl$exd|pC2dbRsj{=0}l`Jk}z5k6&`j8Da_w(@R&K{?DZ8;UQQUQBq5u$=lm?U4ztl5Q&2W)YAJxf4IIpS zB1QjBD^>RptP{xyOM^*}jU&M4n;IpzNAjEhP)9>_K=}`T_IKv3OjlGdjw%*7pcdox z%WU>~3~;Q2CwFjn2X|eVxQ?wAoHpwTm~vqDfwC+n#}E9-C6?hj;a~MDlmBd}MM;~g zs}xtWDaGe?)AN4Qg=VG*2)llCe!UV#ND3Z|=_F-zaPm@CbG$weuI_kp8mOZKLTJvU zWY?Cvy+bMUAcQ-V{~mmF>^>#MFP{EA zLxGKTCqncIv5ZIIjBo2!xZMaI^wUK8gcp)XkszK3tWOe`N^NoRCpFhY;sRC`Nun8M zvOnAS;EAyo!#DNTeGv(|nv2PCqOSWMO#ZPH`sWyb*q0r}F3eNp-^XJNwuY z!ue>6hbvj>!mX|BtcL@%nIZ%U{;0jc!(%p7mvD=Sj7Wk0bQ&_$c~r^R8Y=>P>#Ffu z(0JoLxP&j{UnvV`K@>S7(kP%Q2;LFIcUm#ZAYtx6`u!TKzGkVq0MEDGv|NgDO&_>h z1?EVP0oZn?HaQ)zoG=*76Ed+j)1e?G`m5@vf_;oRe|&yZ#gC1%EO14 z>Y~i2xfU{vAO@dhw+)s{p7KSfIguPHu>%2qr-}L%CgQuH7O3TqKF#}Dg7Ln&%l~eS zAglWb@uZ-g(I*ooyrbg3p1^a;_9<~*4NcNn#;au3-b#i^5RqmvBm@~NJW7`{$Y>kz z03RL_Ii0fW^lDQ5Iw{VF=kn-Kc%!MQ7c?=dIhx#x;t~Ds`FJ{+Fo98-QXY~*j1!4a z>B2?o1S^B%O%)quY^1As1sGp2DC7PRzo=t!%F0oJ&?7T64=74nIQm-ct1$C6k`ueUqplnB+3r+S%q7ptW@-x)`Px&*B zHd&Ezz6tj-&L8`l_w=?pl3q_Jx1CpA4n6Ft&X}u5j!I|=c;ket>UJwGXm`qd%4hHA!Z}@1LWQ@IXY4% ze1FtLKw-JnaLU(8(l)jdj7xUGoa=?gZh1dka|UTdpvVTIU>u7tuwb^x5Eg{fBWU<~ zW4=o`>7kK!S@UV$k(0D0#j*>X7dGvZenrYi(o2{VT_64qCQ(ufXBQMJZUIh#XsC~G zCidh|M$QI>SPE{K3#R(`g;SKGF$w|>YFG$Y4qh)hK4uM=K{{mLn1kTz9N5NFh#l%= znP_CR0kipgiqNlyUZAXS0|Jy-gHbQc*;@pXOve^8<0L{DR^=R=^2ufB$DK*j4?|tM zw$W9tcyC-OpZ7zRT*o0BBO2u~(a9;$yJM#Twx9M<%0JoqaV@i}CgdLXw(%$c<$PAGR>}H%6j7^7(lQTHId37H*+$yBFOKU7Rw{S_3)dx%lrwV{A2tO z0DL->Lv)My2o=;?sot7WS8t`giy&!O^2yj0a8Fb^QS(IZb^qu;c1j;of zlhtc{((P9-3`wXUP{8AZzGt9%2=4*m;mj64jSD!GEiJl7uSM!4*lb+LpBpd)c@n>! zEH*lEZUm%~Rl6SlWc~uF@E<+)JB0WSf1%}HvBp{TQoFr*(Ga{K$eE0E$3u3^h)n?b z$UqS1L=^PNz|oki*EOL(n8Ue{z3mC-68%3+5IG6V9=a4a~Ek`Q|G zoT;Z&FRG~l5n8Ranc7xHcPm7d4s3FP5qlnViBi)+CEFtAF&*LMasP<`0Fa+z< z&F0>rY_@(=DSNZKoSSiFVS==QTB--wAQoS-4HC@2LEm^KABB~CZhJle)AsRBWbdLi z+55%%mmPa`fm6~|i&QE6`7!SZEA*wFg8%1-87&Lao{7jo{2$X8=LJ{j+D{3FB_Qcf9O4 zAq?=`u#!L?=^X zOl8p6@FU}xM(B`_i+*F^bM)aj9={xK{P*4qsy>DkCpUDCXw9~AO?`jk#DNV&8kF>2 z$JIN*0UyNeSPT+XG&hpp5O(Jf!8&OS@ugV4UpV16##)5>?&Z2ts!($d#@SlJGQFG7 z6Eq?n#o3SX#$~~La6CkW%gR!LaNKtIsZVlKkAma>-kaa5M7FNc?HAXKb9Dimz3>8? zcll4Dj$oNYlLN0$&Jj2OC%j+z5pgTzZm0w$$wTXnpZyp6`u<+~cQ4NLXdB@|Gd26w z_{Ld(V=+Y4(dl~tB09c*$lYcAloY9)lq^!$f|WZ7^A3{UCzG0zSzuwtKU$7=5F@K{ z1a`S}+1F%T4y&86vl~i3aR>%Z?U;u^sLwGexlZDzUo<3-IwKR@2^h%($EWjm{t%qq z?{RtiP>54g)GW@4r6m)a&DVnLRSbjiNN1u0&W*WR@SCD_qeCYS69#Y!riLsgyy9R0 zfwen@F(k_%6%zmMtgNBjgjGbf5D2zKXPj+{B>ZSn=pUFgWjW{}t0SZ@;)sX1s1Go6 zK9jtyBRFqdSQJj&>)iRD#*rNtKO@a&aaASp_i${cjE+_grU(n1VlXb-6$bBgvG|4| zLYhOuD+Xgc7Q!T-0wb}AKh5E&=PnAkH@>?%glv*3jJ@^3P1f0+Oadc)+WBOZJK~NL z(c*MJ^|n#YNR-*BCbpqP^-x5mV&`Bgg<2(@g&G_)3(Z}T+m)Clh4thV- zZF1@*yVc=UgC*cygK@pZ_*U|SOUsH*IA$7Hm>Yg2CYXP5$~G`x#>!D56yokjo4-FW z^leZ*r9Ey#E;gH7(&wk@5G*NSJ1G|-?rBR!^+YD@*=k;e0aXV_Nob{Hb2BNqCA6$J zUucEowiGeW{}a$NU_&nh25~I<5voye6Eu~BxBIDCd_C42b5^}4q&G-wF`Lv{Td&Nj z+Z+c;xXJI%B91{0OuC)G4D`qC=6~-`OI59=7?C*VQfNDW4wwPxiPdgTS}D{D8DMf__Cxt8#u)c=e&^LI+)@S zqPWYq5B&L~ADZNk~ZoB<~fY6NW0h9hBA_6U9p55EejmaD(C9%r6nl zKbir5Y$(I&Rb?Jq5SJ3FDP<8kd2_S01g9LeLxNlB`z6R|N)V)kV=7C2I4cF@?INLy zcj$!?gEu9uJ`ww?G(a=~`3wOz5^EDK5bJe3?+`69$~DFWchpC}IIvQ)Qh~NO+t#e} zrZro?=o=&i0uI=a<;RHWkm&49?ba8aqh`O)E3XEiMk(Xv$adT&Ar z7vQ>8W&?Jw&s7y=F*6;)01Hn@@(dgzoHZNqToD)@y6Or9g%@Dc zVo1@%xVkabo&E>LxoD)$DNMm~lxBjwgtxTjMiGr8d^9 z8OwoAHTq&)sxe<%d*d~%01GsuU4S2X2=3+q_jCUw)FpFP`OH~|@2xe?7T>OrsBQH# zjAd}x#JeAS5}ra}0s*HunRCldOa;s=m=zMTUdnn|Zo5l^$nug|0P>mG# zyek#$WUM%EWMp7M4;mDvC{IFCfws7LIGa4bLl))0H-2r}Yqoy9m(`Wl_?noIO?2x; zDjW7gUWG)9aA8yj9W&vAxnYurn3`FHMAJ*8_>&$nw}#q7RiD#ZgAU61W}I6cpThn+ z5O@K`PZRn{;cCCv;46bx7YL~ZNsZ`|iR#6#d&}-l@ytv zn2`0Jhx~r115)f-N+$4HD&CuxN?S6mEkk|uX$cPYuo&ET5+3vUXRuAlBFG~$!~;LW z6vZp-@w;);>saT2W3BflJC&QG?4JKYJFHvEtr$|>iVsxT}m zHANSlMvhrj;*6{SR46Auxsv#I|GNcJ3*uB|LO^qe5?eDR+b^=)@Y*aC6IDEY-^Cr$ z3W&%LPJRfjK?aDjc!6zmA&BG1XP^IaJ=A?tT{X+ZG{!CD5cU?tCr^bm{_Y6C=F@s9IQ{p9NJb3hYWgoqY>#0I*%b3~(xsNZ_ zw4nN2+$fBsC*^i`ro0)M9kiapt6=?}a{+4QG!SpJ_sKYGS0}73sVh8)q~md)`+-+y zoYSco>R>*Co`(F*oi|4vd*$q% zN1Ke~QZUJ{g!8tq=M}xf`H7D}ghu!zn2Brpq*ht2Ra4JsD_?>M;fW3Db9F1v76mw9 z6oevYT2}HNK)>*NU0gZ;7O4K2$KJ-8N3H&v$E>A538!&3xOBOp4c|#!3lV9*u!mF| zANRqG^&C!%3`EG|YmCu2U*oDWxN-glJv=jHcp9t}t_s%ko+o*?w`tj35zwU+gEc9o zs2HT1S$S|qtOEj3E72MqjU*T;Ig)VYmrbtDQ+pRZk!wB6z1$Hixmz5B1(8;Ss}^{g>^t)nluY92=P19wjfxT$BC0r<#FWc9mTX+kY2oL*y>k2*lC6={l_WbP_aUp)#qpBl z1Quc|fVUSIl>b-r$coDjg`MF_^x3$Q+~-Pb&}zb0oN^t68x}DWfGv&yE&=5Ul>dWm z5TA=B~mseLlkd{wW-E1k(~caA>te#K)ozc@Ko@k9oZKJZe)cSj|^FD0qYPp(d7jxLQVpX0|aNj(0Fll(YlT^nlFJdr44@qu{2yP~D`h^2J_U_-s zsM-c8X_I8uo%g1yn#y`ZI6D0mCUnSjD4{uNd4%5T!evSWJ;b7vdrW3%{FYN&v-Cl+ z6cK{EXj3-PsdsJNNDg)3UdSPwZ9Ll5f=WOI~V{2`9}DPBi~0F*UCqvso021K~Z>2Jn-y<`Py9_7F-!=ED1IVpyP} z?ecaB)@TR0H_W=wg>+s+Ac=F{MgT^_Ga^MH2kBYFBmK7J)L=?!`-y;C3o)D4qDoEe zlD)}dkl7G3GK4N8+lu?w<%96ComHqO!2v-6ZtgG4SMBcVJTbKqskUTN%ZvQH*)LsW zplnNZNDKvr5VIgK;8mLp*TLG>e#!;>S$cUJ>i(6LRIENiK@fuRi_qPx9GOGK%wQW% zN(WeCBt=Ecu~M{x&AV{ktJ23h4pePbiDOdrp_x>J{k+DJQXxb)I96oaaP|bck0BzD zF(rB=uR8%gL-m(T21B1Ub)TArRkX<&Zx??S_gu_mTMnKsxHC3WW04zX2O9Okhh9%s zvJy;7ht`^+@hyZ;@A;TaCNVOPwOsIncV7$_r@$EKJjE~~f`VU`@!-?nGt}A#ji(^J zcd2^g@?sP&AG;zMObS3^kODh7CA^?p$XOmAwBQayM(j&F^Cd!1K!#|{O+aQl5+p;5 zqyG=#IrW@~WM(DbVpZ`SE9W+gEEeC16KCK5|Ns2=X8!)S|MVZ?-~Tj!f3&|%b~V{Q z?O)brXX1jF6#xF8|LuSO_y7Ap{z~@m|Mh?Vt1-s>%YQWg@^AJZZQa_|T5FqpZLQuRQ-4r}svVzx{1ftR?(u|8hRW>=)-l zGUNE(ACA9n+uGU+DB8BJ>$Ywijwr|7wrzXli1Qes?rt&5F|3ItF3y^ij2&M2QHX$;g z7|*)#UihQ@5|FN)FSwC)1-;@8a8c)1e2N!_597w#?Q+f#fArDucWArx2Ly@E5f%Vs&5d^Q};E2k4B|JG$w*;tPjaA z)<;tn_>hlu^8peEYC#vuJpgR&c(eE34A_g~y`@|0*6VMHq2XD4lkLvTldX82OYJAR%Gr`Y;#^arWoq=JI=6ajpbG(N; zCgJ1!8$@Yadw)Ub&$|s)51dRbVgh87!(y}b;nDzrN)nY1oz!u?qPtpaE3R1%yMa$T zm=m&UTdBtSw}toh;bT+*lf5zJPy3g*#>TjKYn;vF_($CYa|EXcaW+s#yAf)GiPE+X ziv9pjC}{yC3alAtXfMcTKYd+IK@RN|lZuNu8sYI0sdt>Fl&;0TaG z`T$!^v4~d+DO?0N3-42zfkg4W{0NMLnB^Z5PQ%~Q68Ony0&jy;L6TkdQ1;fxQo>?= zGGYi)Pvwx>OA;4U;_{d zE(|X>=78u}>GD7lT;9odf&3cq;uLTfjIV#%zd{O2^z{o_*8zg~XdnxUF+eJE08}r$ z4)ivNL!l242msz1E(~C=ujtHQfaQlT?OaI)V7XfI61<7ildcDB;@os@=DLqU8k0Vb%Gy3?@$={v5DagBFClS z-;{SKDTF=x+tvJ|&%7$57nMwK&=AgqToz|yFqgI(Aj1F1C-jbRL8=|);ZJn)@CP8S z^$paqL$&iKpU%{PaGA+NVp~@Z$d;psq1j32pmA6$klyR?RH5Txw*g;x!5@Kf z2TgAcjDfdsC%9Jprt=GK0+Iu?L-7GllmGArtmjUr_2IzZJDzzRz6_Fb#fX?S1y+D5 zWiW+5Q4|gj(h#)>fk7bxQlk;@4ZnML9J@nKh7B8B%|^7?Ku*cW}m!zW>Z34vZ-MJT#xrJg19jlDa6&m za2l5r!h`&U2ok9bqg0G8xurJ3x=@rGWIlaSybo>pd$igP@BVlVHW;7XVuJ~BxS{2! z#~ALpQR58;VKnj5D6^owAct;91(o8{v~1)f;6cy}_z~p$W57>rA$99o1otS~6Kk)Y`sWX7*LeN_sAr;zgaGhufpRp(-;E-rW}1NeCK zQE~SO7pxjOgvko)ixFS=GKi|+8^q+mRrtBTD#&+ev-9jWOR6{fVwN1zS5`?=EyQf~ z?LQy`_8+}c&=lSi_Q&z@(1gJ&;DvC2oCh!d9KLq&rmSS@T#2y5a`AD=)sCQiIYx%) z49Ho*PhcA+#XxpoB1y#qNgJ&V=40WB0#tED8Y4$P0O$@vbE-XX33=rOFL?&OkFp&o z19pHYI>StdFod9D5)gtzVTsEB1VVux*nTs76S6W=KtLU2eGVoqIqtk0d$cRSLvrL! zs%=WOz#9Sqj1X`1?>2QGx3;6&5qV+M2p>Z*Vbl03c=_F+KlJP{Uw1jOBq{ZrOj&X^ z_A*YsGRM@nX+AUDpv#1K5llfVPDYcxz7kh;jcx4-YGniHYilVG>MAR@7mr0a42uXNo=_)gkn=+%?FFH3=h#x6-9i z!vsXgDu}LmR@i0VaZrE#?C5LeU|lf5{%QXzCA+26cx~7Bu2Ci$=U_z8*Gl6=c&~kk z!oPhF6^P$Jw7>>{Yytm)B)U93wx1$H_g$eS^On{3A=vk;0E94jq**c)ms z;v0=NY}DBJ9f<4+I39g=@Xln8bHyPBoK1F1wtmR`bjosqYG83NM~+w>h=)=MRtZgg zvI`Ic5f1?fpx*)54u)WcG%()US~GmDlx$plN>euFWAuj%Ba#W2(uh3*I@Cwtd}XXn z$qm1hNF0N^0@u5-H31Ael9c>RO|_<_W)mjMoM6Mlkb7gn$j+UIl`qgjzi!V&TIcza zImJbtH8n2QSvx}#sT}gBxI-L9Jn>G$Rn$GKJ-8^KrIiH&+x7wCfgtWwp-;I~|N6(5 z!1x_3k~~VGTDzoB>&S|fQ!;E9CTBSYgemfV!X`|2@Wv575welrL-&h6f+7J35)c>U z9a!q!M0Fp5HtroP!Jtnm`V9VwdHBEnY|`G&D@Xx4n77_En)?`jCMnsRk71vHuyS33 zHFciEy0fDT@&+A2z*43%_<)PW8O88~4TAqx`V_RXg++j&+Z*ffyjC^cgc|XGtOsp0 z*d7A$r=EFr`z)>)@74LdR3H7hfWx6{o8&<-bj1jTDDB`&tsx-*ZD{0wyg?FO7R&4;gAEH8j= zBBubl*wQz_Mkfcc3H<4M0+DwCv*D;~ybm^-#rxnUWY(NxK^u#ZaCF2AMlcJfhO~kj z0)bO}vC0nSOdG{Zaw)9jy4?c)CDEdg82H5x#l|1Qy!&)P%!j0!>|#SUVdg{5wh*`+ zh=h7laKW~so`tT#rr3#V$zV68Jtu+I9EXFe+3 zLCD}vfCf?CnGWjP`f>ZEAoYf4T#6R8gQ>v`xGd-x$OHTs?KL@!p$kubBe!7(fC7pb~;?ZKG`g=mt4Jb~FFOl77*X$PIyUMACt)SPv(% zP`)z#f{*@wxxW*KGrF%A6hchJECF3N#Q&&_2JN+Tia*cA|0CFVVO-!1X5+oN@5AwGVoo;7%BC%;UmVI~de|Jca`1!FC>)brB-f z#ab>)9agR80Y%_CH5sX2fsn_qbdrQKpK2X$P6}=)1vjgC(lN^Zxn&E=ZJ24GX_k}V zmk8Pli6gixfAjDue|7eJ@-$qsCa1+Ei-I&>W;vT)I1gjWnjY*7I19dkWafV5`^I<{ zGr#y#2xnk{ssHvwKh`&%9m1^B*s1X$rXYb9Ydi|DW{m=>w2n|iq2GXGVvKdIeH2FSDWU!;n`E!E!|E(g!~?dQ5CE01NsWbkPzj9vZQ6#4UxAQR&@vYA zqnvf1keMEac89`9p@t>JGK6zI#xQYC7VQhjK>cVBW25KH3BdYY8SG(eg9d?yhy3Q#xZ57_MqdC+D@C;qzu#Q-RPWN?(? ziK!%4PSr%};jHvkhZ+ZzAZ1a2V(C!`f^VTdq!Nb~!L$8t zf7}Pc)_u3R2q@=M4rOsZ6&o+Z#Jp^+N)yuSOka^fL7pE#GJu2CBHs&j$~)iS$3GrJ ziA(1|L=L``#pe)wxQ@%iF(xI!6lWRr%_!F*JkXe&{|P}d$tKnPlmUdfYAL2JwUj9t z;>prtAuCJ|@PvGWhq-*v&IdDZEDvH=|AS}!;}^$vt_*p`=?FGSLz+!>NAC6L0x*L> z3Wlo3@z{HeW8WZQ{;g{-9%NdFZX>7^a2%=tkFIME>#KI~gU>{vwM8vQ7i)CIBeH8l z%DyZ%q~h%QeTn@(M1uwN+8kpKs zPs@SfCKBT8dz7mO!;0aFk3nN~NS_;c?8;i1e86wsXKw!r__O&uRfU zkd8RA+KFJT&ceJ$&Ob3A#UWNCfeps`)^vw>U2=YLDVs~wvo8fVgUiH^Vv_59vM>OSsL;eq zsQ2VBg!xLibu?L57VBo(#JW>dP5!@c8kl1KxKBI+b?ir2S?G!5LL#sal3IFrS%4Bu z3o8&z37q54MhnOG_$Y^;cqUryWN95^5sS-l@v(SUuJst;+Q1wf3Y*wffK9R#u*nGzPkYD3Wrbx!kw zz1v#~($?mTHP$b9Dd{qkyOARrN5yOmgn@lPvFzqq>AbV>em#H}((%17I#df|GZ4|7^p{r%9`>FBo>E@I^jvW21Yr|si;5`4$=$L{*V-u;v`uZy?QZP6rWF3WK_4MuER(Nm+p6u1WdAC{u?FllH_ zG?F6#XI(03u`VZnSxqq`P{RF<0|c}<4IBmO2kf#71wX=~f>jR$bs&%R2XDvB1kafv zG_?Oa#DZGmSW~$Su|Y00)^d;9K^R<2RWS)PCV+wUW)Ny+LwwWf(N_%l$Kb3{eN9tc zM)Vk_u9Hr87u_&*!!ekuLS^MBB}On9PX&4fx!~INZ5En%faUd1^T|51upskdLxg>N z6#~Sq-mVsU1zH7!#(-xV4ZyIqAQ7ie$oM!|h52#(ileOhH+bdAXHSE3utkg^lp=m` zOdiTMPoL5HqlL24)@NzYs?8=0-rmH&j#Ghc%3?T%*1%}m3*Fez59Kjh#AdTJ1gls; z9Qc9D{yov~2c8`r)u4B|8x84DQG3}qKwG^t$*hrc(m3oz;?vz2T-pmf&Qv(LSAs2~0Xn5_`yobR`?rT#4= zEPnaSOK{~Vqv{B z3rrIb7u>O#0i%XPS@2Q@pN3<;5{G8C8NRVt_`-4wuECcC%YF02^JLzhJi};gGIhaA z441u0aQ$!$2*_<6Lm5FxtWV(tiS?-#@Oi>At}eP`!~0J$IyX*A{cRB(u0&L%i-2>oc!@leH`JOikT^IXSu0s%9aZybtx<*%Ym* ztDg&mPmo<5X(%5JVkNLXoey^LF8Fk9Vr(popp&D$m9xfT%y`)6oj`!>%-26-u>l-c zt*qOAyvpQo3wESIFjE_P)do}`#MuCxkIn~7Wze7Y`NG~7^H5AD$Xw8~+!H=Biu6{t zHL`8|eSq!=Iq$ojZfY}|irT7-akQ671st}?!~q}y;W~~Ff~Cm1sLsJFGzB)+6upC9 z&;5&^d;e@HJ}w`U?TqN8m$C$v@3!3}u@Pro!7) z@?{(da!js&W0fIc;S_+;G`nebM|4(eqZ(V=X{j}SD9f{hbmT$Qo%E?zv-oT#Dr-EH z>A+F|62MoQxYY_frlhIi2uIVYAD~5iSy{WG-DTUleKgi7{0z*Ws+HyiNWhQAN%FVR zO(mzr?*>o#qd;LP3>*XqJNAHa@(*s}(VWdZhxc}<-8n$sJ6oZ4T@0tnuW=Y{G!;V+ zJc7vF+WQB*G8oI6g$9W!>v1aFFKneRE2Qp%5&QsSHfUo?n^}Sh>AIqa%3qHUV04iN zzBGm&8U(gPST>zL2}#0afcy!r0sJNJ3Blp*pDh5ti&I-iux8G!w=g2Ib3=&KV|!NH zX6T6o25TOU5Y6Gnjx6RDg@<6`!=M0DY7&FqAZ`h_1MU3f4COaIJIc;O-Dw|R$f-uN zgq%&Vr-G7E3)R(TUgB0WG6Ya2E)Iaa7BqX49YjyC13N)js|kt zSLT7K(Jzl38>Xg^E_-@(;=0D+SRBJ)N#k7&N-8VEMpy9__=G+LjscxWH6WEu$_%y&55Pl$CCBmXpq!uUsGsoq zIwFxic>_-=#AM78V)Fj7mwsFO2M0;25)pQ03TUX0Ux?q`y>nvEzE{@yYARedgwU2Tv<^H%t2tapVRXX zKD+CiJ30_=fwLDNr-O6xWCYEdV;K-&UD>Du^Hf8H9D~il?s9#Mm_v%=uR7;(a^hLn zIhGLNKYuwBeqT<`VGP;DC5Ai$>Zgq`v}SL}iwQ(4Nhz(~iu;uQ=a|SSG zAV?nCpupUkJjYdrV`&G7cnmY&w8vA|I&7LR{QgwHd9s`ib{yhe)#n

Prfj!Go@= zlvpCeliVac zjaqJR4m#}N8u|xLD9ngboLNeVL;8kOHWPM`Siu{413DHFpWEG2L4QZwUUV3WJz-PG zez7Sgf7ySEBha6rKwD{d$oFp)YhMFCH>AuN z1F)f2bb{H=i^Bh*Mygz4<^Zl$|8&!`XPaOgOY0DD++m*kRm^ zZbQrggeehYMZ;Znm$UUdGcr`Vy2NbL1wh($)2P$hNV+mT$I2Tnn%Oux45o*KJ--gi zyzSZD!afiv79i@ZY+ORL!PaZKXS4Kdtpb2359?;YkN1jH!v zX0L)!3I4hEj`;OAp548$5bg6|bel17%Vs~frk$qjuuekf(XU*Y1bshNXL96D*ZOBj z$gX3#MxQZbrXZzvCWpQNI;3O%xm35*SsWja!Hp|W1kx9$ z@J}SUd{S2-lv?u=LNzn&5RN$sI9{D4fuvoIPX`p>NUm4h*h2iw?eEVy^7>i`jbU9W z$gr-tf6gCisdHKn!Yln7#>qTS@Z}Vo@+C&I;HA!cyNhj*BdC*2gEW*l zZ5PrHMEz8;%hyTQ%kL&okHlPCreY z1MgUqyf-L&2|FwGRQAH<$;@|gQ-{{=b;k7|FGWE>j&M=|XW8G}@ORn=d#FZZoZ=zI z^HelE|+$8E$R?3Sw_uSG5A|C_%-_e`;9s0?U7qi+i%>0 zmmDuWWv)x!cy{irgaYqO*8^BBxq@Z3vRD#dIcF7$;k{?d8nw@z>#NbKBG&vEwE*ChvI?J4Y~G^0^e<^*s!w!(l55CQC3bc+wExhvAN z(LaP&@K%zUfCZQDbO1!-f?cBV##|O4YJ8G6%(>c~qjUHsS4^#}2p5g~`m%-{UP?Sl zoIzZ+4L-y^mlXv|+si}Dj z(M=Ag-;(%H9&NtTozO^c1ht=~?m*}0u z&%KZFGUYw|UQTH3T42PgD5_Y%*f_m*Zr@kEpZ@ zUqq#W52Ujvf$A_CJ`f}bj(||*ePDHEt_KXDq3pN9c(2Q5@MbM0*2UFgjk&Df2kIbS zbbc)O4H#iN`^Najcg><5eT95JS&j(@^OL+z0dvT1op;`}_ngXJ$NP$|g61D{(m3}T zaXpn@6WbM=|G=mzax*m(Bxp zrVdXanZaM@1X+Qjf2;1~zQ0KW#)T5AUtB23rOQI7u@DK?8blM0(3tiEDLrPzEle%Amr5X6mk2xY2xD0u3(8%0)TVg0>u_eZ2zKG_uUk;BSRtvX!jd}8` z{^2`1zwXkgclOj&?4yZsu|8T8FRfyrrg1wpk>82nsc&)+a}!eFevy%8q6)sMMH?U1Ev( zGX4Z11;!EG$8Fi1u?kY5tsz_O*njkoK?iK0+uVdJ!bL&1iHP+Yc` z>q3AQNMPUv)lLi?kC7OoWDMy6Bo8(QEMAoaJNgP|2if(&|GpCix;q1^FY!?8j zLppc$cspk;vl9}LBKZLOE;bHEe-Vg#(0p1+ESooy3C1tUgqSb&CHsTbpWT#r*fPRC zpjl4JO(D-8e@8rNFb2v*EsNw}8pXM$9Sdm=*AFKF7u|HNoVI#w+QkmC7pn*f(v5SB zMjiPs!_KN2I+puCfAciAub+7-Hl{mUU2JxkN|L>qmd{b{X^0P~WZ+LFAa^D5w&vK1 zS4VNoV`H+$Kg}l(#>Q%MT5PP&+sjjn4Crby(B%cmG0e_&6OD`2ZnCg_-@(6o>S*0D z&u5JZ7PST@6nClRxow=&vl%?c8HdWpWjBt9f^I<&veB)D&S!1R3t)T!S2-0M1Rrcl zOYp&!VZ2y-w4UW|aXOCEWc_((W^d&XS&o)teVLAT!S^>ykL9UNw;gg7EXx))&e4O; zeF>2-JoB#7Y`KDZh7_tkhNXtN-O#$D3eb)^9pg-I>@izhe?{sSyR~UzjtGw?`!nSvBQl6s`tU2A{%Emfz0Kg}> zFL*#Yac2Y2P@v!!gvwa{*f>TDG$y4nFMCp><=3$nHW-l zZgw^Wzc`!C7d8?-e#V{~r8fhDEAtuLyQX=N-d|5j&BObtqY*0;8{8(dL}%<}0s{^! z=pEq&U1-Wc4aeOne!hj2c`D~V)gr+=bEd-6cBW=GtJ+SneNIH-bUH1R2DP!(m)A<8 zs687FnP;_O_|w>k2Kf@Rh5e60VLhp}Cw1QGxX|RnMRLpy>>T#T2s})0=^78+=LLg@ z4kgQ{;WYqeFqtN@0V-VW{_-Ner=Q(r#l0|=wzOJ&U22`KX}TABV3U*xhhhEQ-xTp?>yb&ExtkluVfX9Q_7E9=l)jm6%5tu`85gtf3(JeMxYc73PVXd(WZOC0AtBq@QP$>YY=(cta=XedSiLjIhfoa0c zr5dAMT-vwApE6IlbWj;rv2rta*U>~cGXS7VwCUOam^Cc?;P@F@hQKjPZDGLt4iPeM zfdQhO`5tV|=&H1}?8XfrFG2fmxvg$wubU2dzI_jd+jRH8F7VN{$J~j+d5`UBP4U1p z0iJE@zE}&rm%PEoeLM1OSo?e+*HInIjtH8eoPp4F=`6bsY3Z+wag17uO$XRQ!*I#S zZk#Rax#Vts0}*_6OPKa@&dZ{v1aVI1cfF3Mom1dn&OC1HMdR?R*-Z?TLx(;!@%=P~ zbyvgaY;p#3IJ3DnVOZ|M2o0wmw9!Jka_B5{AS{TdP2YLYncVluRZ+^(#ihnFmGaTj zVn6@NtN{OykqO)*v)mkRrz8Gg*uKt5^XN9XW2uWb0RuHq^%~4&u?tfd+)JYl*vfZC z3ZAO~INNPy+LBhJx^C+eqr4w@CX`sBHf_w?-Ye_S7Gu4$U#u^?sbdH|n1-dXIF~)mLaZ;LU}w$isuQT8+(oD}bieZ7c~WXV^6an`$9VN!m6|gNb0tlx{<3?0 zCsnm%lS>eEQPsB_V&<_z9ub}Big^9jRu6enr_7JX4y@ir&kD@pmGkKIc7Yo(lKhHe z9G;bn^Q>{#6UY&K&Y0rz;*8nVADwq<2qD8R7b0e7C5xMJR!}`;9>h0&%8?kMqlvH` ze*LDL;e7}LcZQ&~z}c8@10yX44WiF*R+3tC!iXAr9NWn-<<79%Xs}{eC^&-IQM9D_8m|Ntyy$G4Z7wnh) znMYu6guOksN-y50Jfl1|miv>6*#66QS}>P=zwU1UpCU%pcZ~ z_vY`6`Yv>W*#$54+TU&TowiY=$2c?hv5I>rgn$;{e0?BGs7LdyyC^eY$d zkLqMdYIy0LD;x3FYvmw&!iwfBrA?@2vChO8FKZ5Oa)ITYBIS19z(2*0EZ_s5!4T=& zsQY{+iE|$iKYJWBKY)>{nEMfvFZptc28#@!RYd1>H48e&&;T5qUW^dH1Q!VCVPXMr zt#7p=CVKK5v7mf!t8peTwwhgS)Y%cji8~jEP`YaqJ6u5UM&sUl7+sy+Y8%(}iERK= zTf+a`2MsG?n46FmZdqpD`!5EPUoWu@mDi$^TZ+S z1w&$ykf}@cyD>lK$dpJYc3E_YElLHvvJHj_IB*xY7k71IIO&gL0K`UbZ)lEx2x6ZH zj+E7E$=NQolu$31Q~+KAa05jZw-FD~(r3KEyyL_ zG){4ZE+dyQ*u~-b9AT^D;C17!h_S{kV0iE^adPJRYF6@@XI@cEqvTrs?(9>|;LqLk zPj`omDUX{jH0!h|$3`s*cUI+WDwaCaT&R}qv_vYCLKr3E5VyB=`~$Od@vS`y2c842k<+Y=@XX%~>-ct2Zn z${0+Uvp;+7yYLwfgV_dc`+)S}c;hzKKmolv7lGxgZTnc+RItb5AKy#8{&9vQe`;YB zJJ%Oi!{UpdMP>0w#Uqm1xCl~9q147-x)%Itx9Ww1h}#Lqka6QM9R#% z&&vsM81NX&48zHWnC)Uia>HbZ=aNp%6R;eg4woj&SQf3-UeDTw^PExx!cy5{Jr;;r zldQwI&+IPii&%og$zmLnxT=P4oF%QBdqz>4eDktapQpDRUvxXYWXe+reo4`k>u3=x z>R1lNhShPWjT->5%%&^IzgZkR z&t>gt<5Q_F*`-uJyIs#rjzfX1>AbL!U}O7o8~Y}?D<9m4&$CEvk-_(mQrqXm_Ah8L z<#=+SOz^cV&V;x#gWXYqvtAiQC|u3bNZ1;hAK7#=X6KZ2c;J9{7R0jbnOj!qu5yI; z%AQPo!?{Hq_43mx@dutgJLhAWxJxl&{9cO5mFxL+xC4lL=v0=QGHt>psM`&!V@)>R zhYQ~M3HIT&wjY-BlPY!(^**j6MIS!+QvHG=x)87ZJ>8kaVcyza2rzZ5hrHq!(2cKD z1kCfMG)z9UYQyBS-i5GO?`^rWo z%LCkd5Wc7YI;az$inl0fD8A$jKo zJ@QN#!>1)9LT%247z>7~$61=tvT;T$kf8%1U=TuSaPT`_5uI$uS#NK0?jC%0*TQJZzEh^g z?6AHdmU%Jd7Tw;N%Qob)xNLW0+)id~=gKJdxzZwH8dW#b%@sl$2h?!K98DhtJ{$M@{8YQpgf;r% zlKA8uaA{FHz1ZM)D=UsRU{^;@a0V{K;k)j41nAI-yY;)UgXy<44)9=#;>{pV*a~Z{ z4@?@I6YxyFG|)74i+BnsP(=31SqUrzraae#Fn+C5)O2?`;Gbsb`V@9d9SUSC2c+niZ-U~KhOT3(TS&5O06x=UVS zCCdou4t=0eYC4J>IUjnUT&XG+lt6}3a@Gj91Hn*_)W@9}Hq$*Sn8+En+NdCF)-z`Z!Zz`}qdDr=l zuu7QDO7(|05l7bYBDk=W`5f-;W~v7|Q|{qrFGF;E&~Tg;I$UZ8ZTp7U>aWD(ggoua zjTj9Kp(ZaIAyc{D2&th>4zI>HIz3KoA<)T9lQL}h42E~-{It)?i-8w?tzmI7*f}}f zp1jIVYV0}uOtOaT(8)(?3Hz(8KW>}#Cf2Cf&lJLtZx9}tKT z9Ks5q@b<=K^N;JjKYnqcvF>9mw`D9gqBs}x952@t;zD3^G-lSgjJT~MR0wekpP}P@ zE~;PY`@PKNlOXb^Y7*@vjA$f`yQLqeO5K%eO+6S^5z{xjMNXjV##|f(GoK{i^Qj%T zhe6O(E2B_D$!-bNhs*jG$O?ySIo;9xp@)3HUwkD7}c3&=Rp6-EoVc4d_y zYohSaes}uZ`=5Dzg(CuY>r+C^skkM?oOf-&MVM*SSC#^GDdH~)~x+ySBZ+k%>g=m9ako(V<6GQ|=#<=OVgXcDmnPnDK zloiJhYo*W4${JHW*(}i+E1`q;^X9|nTgYy3rg3b@Pdelptpl`LuDqKJ z13}g~au=M(u^pt9w<+L>(doiOV=63mVDk*g=oKQ`_a|EeY26mlr!*VoE zdwb1^*&p16yeCDeId;Ba0aDz}0e465i_S7>MUiMl9Ij^LXc0}t!Ypkp*YB@P=y>p%@JDxoKUn8%T>>Vh*h~1uN@|?Z zK=PJvfn)N-i|3CKLWx0{vM;?Bb^8gh=@Xlog7u74cur`@h8(NhQc~mCBZ6sps2he&=-C z?LNZ`2!cQ&b0c6CZv`d#fon!FNV^=Lum9ZHvH2R(M4`1dhQ(X!qPZj@#$a#^$A#M{ zlU3QX)@uFgr@H%Jgv%$>rSiSVv)GGSYp1$ zQIT~Sw@M>hHXaDnJ8e{(#t&h6@N0e9Tg}m?+0Cw$^b!;3LSvp-w-Yp2A8ouY$$w1R zn@TQD7ErVehz0-cZA#g@HJ{1(F$+Q4m`L6|RNN7R%S;H~DcZ|@n*g3zEAdhaN~tQ( zF_bt|aewkBtdyW2;ss7b>s@%#H7%^OiQ|Q;>t{Z5DM6NXFkd|OGMrBI{ulZ+tWqVm zu1CR*LU!cPz@<&LE!fYW5^r3x7$>3U-4$@%Gp6n>;>7!S8DR%wt9r2TzZ{YvbQ5_r$A^!>~5@R^bS`k7PnE*{B8oEQs+FEP%>%OoqN!;*6Q z(g2}Sh^kv3lZOaW{n^|NSyHXGSSg zIn=xtD~tEmxJ$sLQVLfZUiX`gHmps^jr1+pj7Dx2Y#vDmdl<&D?VA;J@9lz(Q=c~8 zn*ObquvnkMPkqZ1P_&X(86Hd1!J3h(j8kF6w}troGkjW*`<^sJK_|vy$`aGAfA&PH zgA2Voh^gnyys7qx;$qQEAa;e=Z%nFbU^t7s#7y)68bA1CiR0DJT!%BEoDIoz_(+m8 z;EAjZy1G^{(JcWX zp3d~hoQJ>*#)osoDmyNRjmdHN5FB01lI%Kl9liuVsy%<(?Ta@D4d+=F5xqu@55~Jr zD&zs^U%dEWt|5UpTgK(jI}qEa34g>1ifvPIVwN*0n_H>HPo=JnaA_FH#%5VYQluNl z3Vm$ffB(!i`zEJ{oRf38bh2ERud6#)5(XaFWs;F^6g(aA2AK5%iXY$``Nn0Ro6EAgF;#Ipam zJo(M?JLSjdBI{wZhxmsFXwT+x#!o2`MMp5msnnQMLV(|AH20~v;Za9E(1#Eg@1v2+ z7r6p>DihH>P@2H5q+W&#eWgQcj?aeCg{JtnP{b^uOg6cABt=0U1A`dCKKP#^Y+x3R zeS=iS)ePqPcjB};@|4pZ83 z5u8lwDAK{gDOBbXZ#M@1{od)%x#e(1*jZ~+S**2glC+#(L?mP4J$@Uz5=jw|i$l+z zMlv<^d##epeDJr_MvvJSh|w#d8teZ7x_vH>k7u`IQwCTYjWct3Y&krOFkxKn?^ipmpH*|JNb$xj@ZXA=~2 zAzl1N1q2r(M!Qi;9dFVgvkC<;Jq0dOHbl4U~!5-lYk1Il~lYGg1iNr-G__ zGG3Nsid<`4VAz#>ulW5&svj*~Fd$loD%OjJI5)$abacPg7cXV8zJwo2w>W?GtMNJ= z|D!%Jy9QRub5Mi65(7-WBDUL9R&JP~X}jR%*(34jXU-q}Q|g0K5bTp!pFw3ByuS`E z*!Ruy+85>a;6s$Z2Jh%f04aPG)0FoT0#8kIj$Q0N<4P)sY$YttXIt{+Ll~>Bh<@CN z*hTCkUi*!JRSb7!W5fvSaARUxcqZZRV8?E`j!!*^c01+$F-KK!qKYZ$vPA&1BMt@j zscE#vR*u?s-@}a9H2XL3z(l%bYV8jr3bipvNNK7>2hDB@v+lOzx89#k7GxY3Fu1cT+ z!})~8%#}}OG)$_Nf^#`~l)!S@LF|sH6P(|Tz}7|~g+^HLZ3ndBp$BIwDoV60+v9MM z_%LF?-CoypefTqH&v@XLYVN(2&=iG`uCu#{;8cpi1gZJcEf2%KU8@@@fGY2({)1Q; zB#Ov&OPLH32Hgw*|NDCm^r1;lxN9s$;0=T1w1k}}6gh4;95@1sTL{$F?MsU%-B-X( zHvVQCBz%qF|BdY|SO-2d*%Zml1pdopjv(jgy_I;%{XhSiX5j`*$=jF&`D2rVU82b) zT|V<+%(&)Y4LA|7gj-Nu2`0hG@3;9YPsusF`N{`MAHx&Lpp6sByDp7;3N+pH2!}%^ zlY(p;cSFIV8b}er^l~tJ7&!Svq4nsExM-2Q4B|srg6x8*)Agijla>7K+oq!XSXP=9 z@vR$GUba_6!|spU51@m~rXcoEZ~+*6kFss{3^VOFD0UwLX0Fx+-(^Ch*h@-rO^Zwd8D@Pke(Yi+`=(Yed57IhbA1Kn z`1Afvaa>n??_mL8ZZgco(^cD#30vAH6k-r3uWS#*r>$R&(KHP4H5Re|ei;1}D1$Uq z&*Vt90VvA$Rvh-r02%*>ohZDli+eToRCW@&A4Cm1QcqJXXX8-$t4K5N$os}+B%PQ;Z znEgL}?m}2YiVj7J&U_u|!3Ys-w3cb#WRa4qO>Wsp`u}1yJ z*o4n8UWt?Fl~yGHgBN~x0qx<>T&&R>0mmgc`Ywnd-w`BTBewf}I7s2QIxq)VAy&;O zSk(x1tE69TZvn;38I%#O;;n;Bp*69@#hSclgFe4~Rd}@xmJluX_N`)thnaUA9PBFQ z!0r{YZcz0B)`6@=1k4KJny}D+fPMI z#sUIANz>iYqBc@;ApE)=`bz9SCf?|FAD+z|&dBZrV|qt|xD*ZgK2j{^T91?3l-gHC zPIowe3~XghkFu0VULqL;7f2cCo9*K}-Q|<#>~q^OXDs#{k{BDI^lEIHz}gdJb7LWi zbKzF3T0_FMb&G;o-q<#3UpLbC>*^?X73<^7NjwA(dc$Y85^=u9bBcK9NU?V*Gfu)m2`|S7S+pCL0J?k;Ko`bDeA|z{{DO!<-~}0U5svWwCAHE zVn%4C=qHoQ_=oEJ%0bZ`&&pLH7XagKJ*(TN67O@CVb)Ih@F~_rS&9{FFKNfveMn9* z6uQ_OuCKY3S@Wg@k1U_ON7ZzZStF`MWvA3b~xtb7{aYJiVdnCM1*!^X_t zO1y1VG2}Ox-<-qjRnruy^8ys8x9J+V-^fFxvF?Tg!!+s zgi0Ti(Vi0xBewttf@oMwF5Q*pvg@EYr`Ty<-E&kjzO&lH_w-;ee`OkTh?4T1I)L}Z zSb#Z;yDU1gj|*{x0&Z~6DZaI7w?8Zh`_yf$yS$CWQ+23s;zzMPgff5H)9Pla7&fazWU_~0B({!Xo@1ZcutYE&vpB!RY$s|72lBh0frEkL zKtzGb^i9M6(H=>1jkCz4v1W;|pH1)kbMg!xvSmTge*D)((; z%WtJ_`14cPjgQpmyUYSeugg-RkN)y)NlhZIb%Bt+DB;2_~@pd^GN}VNs~r}r%|e`y!SR3 zRpq_Xlyp(qPl?LW-m;bQ;-9|b?_KXnQbDOUMB|}{X|lbBMrk)5CV9I+_?SdKX?v73 zZ4N{7xY$P^DpBGRWe2iFHs~-ADzNpy3Wlx76sj??Qh_)NwJPibS%&ew%6vWZUfSlx zmKDa{%z#!x^)*0vlli^&*)5zMB`d|aBouU$+oM&}0a{fF3m`bK>B1q3P`)uN46_@G zCL>!fOBB?O<|^Skju0zPe=QQg^S~>^{$m^HdR2$lrV0SDGa zsdz&Iepm^XhzUnr4EPC+!k9dMuMW;BhM9u;no70F1Ov%4>n=%w*w3bp3AWCh&@J?( z4meRG{Ur708Ui0gECd|B1Z4Z+Gk4COQ^d9y?-yGn*z4x+l|5WkCmJ}}O=}^Q1r4Rz zsssXUe5y|ttBusu{qJg>u5Mol9uO$J`H}uWLS`%32@=m*R zyfH}C1bTlwG*%|2qp4%c>@HwWta|*`RK9S4-;@KG4v~$tjpD1HoA_z|5=VvFWD#JAQw%08DMks` zWC)C+$b>r@fl1bmUkH8Sd046S+y4kVtm2haLu?FxuuyOs{0}1N`DAJISM!j3Cofs7 z7>A-#lRYtqrAnV8`~t- zS>#r&b7q*bJI38aNT_-qq!cFPj&yDpB>DgSvH?=U@zoX3d%FamUAzW7^h=PXM+|`) zEF1Ng@kD;2<9ixJF1r{#V~JeukHDN=x@;{)=8*4km?;um*y_G+eMoq{ljH=Zj)T6D zwdjv0cMjcJw~I%5z24_&!{T$2>;5rVGF{1ZyT}u<<=#wy2Nv`3- z^$M?KxKQ15N>suk5a?`d!>g=3k+zrm-Hph9z3dT5el9)t*fNpjib*ecglM7kajz@gm2d(f>wmn~*Q{%2G4@o(7l)RPMVxq(E<2vtq{ueQRe@ZUfCa2M{(w}M8p8g0 zndiuD8kq|~E5I;-(gq3~#a?qB_v4Lc3=3+T!dJI-;>-Gqpg(xM_fYLsTkeC8Q}1?f$}2afICSkiT*NN*@6J4Pf9}~ zu@Mcy3@c?&Nuc~MsMdFuFx{R$duzoa9Ms4_*dX<|>wn#gy&Y05@r9x7FQ zSBh03wtnAc&-pkx_P~J+DJ{j@V6KH+kZ-D#4vg9}S}30O&jJ8$~vd42f1;o31? zEe2<2qFu6+;4VW-+%8Hc5Bnm*THj?bBMQJ_&GF*I>!jP_%0P^UM;mM;;QF|R+HUUY zluIkX_$){*5C4ABkcM^jXEa&Q8oBT`5-dD)c;+DT0D%C2i-e|F>1hzVlVv&9zYwM( zv}ue|VKZ!N9Ua?z!fZ-K%)073eB2!Va9#?06tS_CMZ_jQ9QlbxR{6Sb$CYQ71vw=E zCmrv$y@tP;WAr1jrjN^HV{}Whd9ss=D~HGmPLYZ+D=X7fVO*(SPg1Tv3BI&PpFI9H zdrL?kxT?G-f5Vic$~xk|f~j{$@CBR!cI~zbkC@a4KmT2=tTko4+jHuSFk)gzc@Yz% z4VU|`T2#!JRl0N1omIjX*mm|B!{!{NlVPQrG?(aY@ry(c1xbz);nZQ6gAr5}w%IMx zze)8#Wj4e8*?&VGY$IN-+P9u?6qYk@r;;h@ZJ$?H8%+V!#^ zBrndIsg@@0csXO?$#;e^k|2sHJ-7mPcrtUrmfy->HijTD)yBH6`i6D1u(3;>c!2)s z!N0JlpKpzN?6ceDFaljyBw!(v&)F@>m*6ik@*86y}Pg#hY11Jj;x-S&Fcx@nN=`bU7P4`6y<|KDbRa={ELcveMjt z;qTu#)8BVhay|w%F^5=|nB$Zg6?2YVnamqet7?^FRa9_Udy?2b#uaH=(#98+iuH5? z{Ya4P;2$i+_r*Z7_mRiO#Na_Q6yvOlpWwPAI_s_(fdk=AlqFPG!BB~v5r|ML%cd&S zRH+5h=o3EUxlc#iO_dLAMYA?}w^*B{T!P)T7ilE{r*M3>>F(kH_RMZ>)h=5n( zq1s=`E`M}fJ21#(?i2wb~^$s&3d$atzvpC*Jm7kfR$qo^FkD|sb-YGd4t4I#PGAEz+~@3NfOR)Q6u z7YWunci9!CT|e6(Lqdp#FA!v4W(bli`_cI4efJt`5$o_p{EP2?sNSEk9eLPMUl$u? z$>Ku1j5Jtn-q_$l{V#UeYb6t>WK}#5nT{29ys_JtY(FG~V_N*Px65hMrO5u>ek(-* za0Zo)5ox4TQ!r!XFNR&LpEC@AQTFK+ak7UP2LOwY)FQ%3#3&o#NJtML zCkK=cay5O@cwJ)7-8ZOQ?*}}=&fB}ZpCgWm1naWE+xuuQ6Cr#bC=VjZnc3dj<83~w zG53wkBz$dCD2eSRY*PM=r=K(R_MDpR6jI1(xhbkq!eOR;CM&t5>S*^vxJ&>MB4&z# zl7*Fx{S61Mveg&AXy%7cs_nJ<#*?492KICy0c?pNQZr$u_1$p^V8w_}S8Z*?Y15W^ zEXkvFi#ZgLQDPWvq|Q0BBT?-|0+Ktmvh+{iaqh|TU84|R|F2t%a)e28q82~H!J*HoI z1yoW~@-wKaaX)~_Ch;MPIr)Ww041Z$Qg(YR9!i<-b~L;EFhGXreu zM!LGeEW_7=N)qBQ`UFUR@&@C}+#01z$ zh$DSFxP24xCp{v=eX$b%12bn2n?l+?k(;@*v*STHY9%H}LgFo0xo#P6e7a&H-9I%g zjo>|q*ykbRoC8V2$tYk+Bs(MuBzqgq#l>M{s=9+{g&g)xTS0qmRCO{N857v@4M#-p zI~&HeD;C89#@VpkSz*Aw!eh06hbnwv^+0KGz|o7b5`fsSHrUGmXl0`)=}zzqyS_>G z!O%|$0&X`Ose)n3ZPH=kI_`&-<@I+l(LZQGE+5O&HU{yFjbSF#!|~iAWW!xVXan}0 zl{^^nP>QCc4Zu6y79MuJKMWWMf3`JRiMGUu5Zz`M&0@2kbzy&mHVo>244G{)E4dm5 zYHeMge>3e?bEG^q{z(P0>#2C-E|Uf-Dgm2lns*=1Xr)c-&x@*39F3YI_zQe7yuP~E z6Y^$6blPeXjFh|tW3#>X>kmr4kWO}074?-*BZPZH?f_9M4&3|ZceQ;!oB@bFSg23< z;C8izqiHq54Qu_{#@mSL_mwngd@HaDhbfbikqTQlGT;6GYXQiec|j1K^HOMH31aP1 zf@F7@cW8~_b0xl}-wJrU;xNOhH3hs@3gn=W&~qqnXpY$(D;e-0MacV9LR@^_=?^7; zO8#hf0Y}P<4G|g8bELox&iSwe=UupLII1*jEFrnEl|+MWgsaj(s*>TV zIHrCsRuNHQyIwI7io&8! za+}48#vUcq-Po4alt*ZA2M`E)%m{z{GgrmWUR2FV*c^>p>^@<6mXoLUEiV2(TghFkn|B&Lym%~-Il~p{gaK}?QpioJcYQDB`@MYDspZ5Br4PJl@MNy z`^i(bwV|+&OOb#u91A!C&K*%epT0gTw!OUH-!GCUKD&hxbIb#~Qc_vGF){qiCqt$n z5(`vvjjVhj5wb}j7Q4>|CYm(BBP9(3?-?zrFnu&ujYa&eHHSSdDJSg>=+r^UH6g-ZOXB*9m&(gJG0jdQ)WK?tOx zm#>A_yTvW`m@_~#}`g!QfRvEEqyTuc@jX9cKJVhW`j@gwZ$Gj8M zJ_8`&#=39Ag||{k0sD`;4Hp^wJ^^%3uh$%29EKR7IF0UK^tXFS{t{?U-04b~LnD{8 za@(?nnb}YnBd(d}2YDW>q;SdxSrf8f#F`j}1)lhL;Q*0e(eyomzihUzZPZbD!?4&o z08Fq<1RpQY;ip+m*~p=VU{gtpvpMAJ7Xz>Ho`2^%n~*z1MP!#ic@H%pTm{TvulL3L zpZv^C@stlhXifMh%EcMw;=SP4F}ha4%8h^$%|mZPyPx1U*!jwiGmUcbmn(z6rf_}w z^fvJNq$b|}NuuX+ft(ER;OGOgHk#gS7vp)0M@1dS97edc?TZ|7WEx=n)4#*IAm*#z z+0K})=U=#Ui(MYc7O-+7y)LF$0X;(5v6Y@#q7 zl)r-|-h_fYrz>~lvI5mAS@264$%{MOUh6PA*kyN}-#95KJ~kyPhKf~kcxN{Gh`@a(j%SF zzqiwju_~7hp4(bnZG_A;avCZXtg7SUx?;7Xo~HBn&zxT{yL;aM}s0_#Iu}bQxXm$Q!wA#H`j09d_ykp_s?7dpW>1C#s*`{VuP6qGAD&r z<#WKM!7v*wlkAP;#A0rR{l@ThJq+n@@i*Scb2byB&%9DB)}s(vNaZ!!lriOjP$K+iz$3(WDIwHwDFu58X2(__pUK{BaumRY zC>?*bD+%CM9tKK*Og|1=TlFmkH;GMwg;mmtE2k3d z@67?g@d~vwR8^i^+tm$h$Yyx_aD?JEWuqpyH=ZV%enP0zeIu?h`h}OXEOR%+yW_*v z1qo(x!OlP|oh`S@R#fxLUH+mn3EsZKs_R&C1diEZk zcq$d!u01AXd%{S29+zR{Oo>xTx=~QK5tN2Z_^6tHKu_ZSj>X}#G!5)PPO~__)0RBl zw~Zw67%(Q=(=wC{hHoZjg#}P8Zn8a-%Gr!4mS*{+PS6IR}&^a*^wB8fR)7MRsB^w4RO^ z9HOTuhBwC}c09kPVs`Wi>}WBVe5oMO^lbt^+np88Jg&Em7y3iPxzBvhcKMi$lO-mZ zIcqtgSrHpjv4`4QOn^2LhjI^LnyQqlh${@5EwFvtaTc(&+M}~Ekqvw3%Unl3m;owp z@{imiFMj5d`W=g($|cxhEV6qbs2GcSlI4Is(II?GE`x7|q@Pr|Y=0#!2d-Z#9=C=f!2~?IpGd&vW9>$O%MWOD%OQ3XX|loAK+P z3Z!$yR?Zov;PJRLAvn3lVD~eE_3u}jlHha$!2Qi@omY8P2_LQey<@}XB%J%^jtoJ8 zv7`F!CGvPx&bvx>k(nw-(2b}MkNMk?tpu0qkB?^gIy$;YL`)#uC%7wqTm?9}|1sZs z*u+ah!;qJqZqywpk5+~n$)|VB$HZFU+V4LGs3bMOC}PYq{+l^eb|xCe^*1i-Q~>2k zCCx*13WgbC!6Y%njk;ysIGN#Wq|50)`D*{<9H|&Nf_B6^kG4tgg1E~@W&$Vr&4E`S z39Io9HUKo0@McWR`*LHw;l-g}&cshxpSG{skc!{|64MVUr;V&cJoQW`scbEL#whK< zci_l$XMUSH{9x0J^joI%+dk=|MNA4E&75{L0(ZoQVLb4?J?3i|EZGA3PE>-FdMUVX z9`3f6S@m#)4f7lE<{P6%rHto2{H6_= zbLosF+=o&mu<>6&F(wkr<%P+|dnH;Azu-XhfRaM*E2YOtU0%089g;a_7sg$qd>r0e z3yE&GgP)soeyi1XRZ3%TJpzD6LVK8!(mEpuZG%*as2Thlzr`Pt>7)LuLd*01$tL;UZX@l94h*d8LEluIy6 zD#nCs=m$oGJt7$-in^+EOWv`KWg_@->JR+sX+Lc*nsF13r@J*4CF)&W<#fN_o-YV? zMscgLO4(Sc+0Cv~dNa)IIm#xyTn%*BjbFq5%X1Yw6Z7C_sQc9Wc zZU}08Un+#&gC$To?|3hFd+uK#{_BAf;-&Vzu82QXQZ`MIR%HqrWySs#&G1gq)TbVwv`4PK!v_%g6lfnq1kw*|hDa+aP%b@dv9)$*!!lu>qt1 z4WcH=>rAxpc7(-${xcWHmvO-mweCoA zCz2rUwSSr2d&9s}Q(3y(T~&2urlZIaj2Ac-`9%k{8)?YL?f1qZzA-zwZjobtc+)(- zzEExhWO_{@PcU;tn_qlouf&@0UA<8~0b9T#z{=M{o0^0hGeFNfmDj3bKP*-*#|t@> zD0T@Y&X(tx4%NSnVo#V7TL(z2R|zX3r3LmLYt=KPSVR&=ys*vx{k-kTpNQ2!!3B_k zSTC0;am|QoJ_LjRVhGL_)|E5bee+`Uzi-bRa17~`g0{Xyw}=g9*U5M+1hTiBkIwdO zkk}Sx6uVtEqCP9%O$s%*+oSzQKlaOK&b;&M&J&6dK&*EL@sf8TU%Kd(XNas_;|)H9 zAW^%*F5ypE?d*5?U&Ef=uFZm5NYTO0LP*{$A>>`R&B?hi6^8%=!@;!)^sAOx)*-`P zNi>9A;~wJ=n^Ma5*9EJ)*n7l=+_2zg8!`_&jRQh8|CG=&(4Sx$%>$ZL2zl?hc$GQI({z1(3-;WCw#zG;s@99Ia zp>xLB5YwgR&@LLKh(2cDn4eX-)=gy#o}cF2%-)wM-=3h7Qiuyk?c!x1Q%NICE{|@E zRBx%Q2W#q&y_7Fn<{YV=UDG=;*chdx1>ywh5}W}0B7-^t5qyw6Q;}$DX5!z78Wk#y z(B=(T%H0HvJ(6jNkr)Gb)YAn1ouDr4(I;z+Hdqs~xQ;63RCH$-3;8t2&`0v{m+a-& z&zxllax!`s#HIzmWPd4Q)!o_XKqN;ke7iOm&wf1BV@L4$S8sp0KYipj;3(KQ%kpv} zYiC#JIx^pUL}P!x;N0QlHtnON_;O?E6n5B@0ur|(<1dCSWMt;I$g%*Zj|HksGr~9g zo?rhx7<=DmXAVV<=~WwC2J*>IWJWxtxUfEO@^I>3$X*~}%GTRPxkCy+!TU5mm$v)i z&GU1gGjM+7LiKu2(UiEPC_DauBU*PO(0LtxMwt<*hqp0Y+t>xu7_Jh_kFt>prwq!) zSD%BAeCCXOF-HtWHr_yY!~1mE)=fzL%G?`qAZ(^;6aDqX6y}(M*i%w5B$M4DA&HxA z<&+A*iP0SUtc+@EV8|-5R|2;6s)L-Pl`_I&Mfiw>3|B9qczda}(C9zdRfVyWqrH*i z8g~H<<&lE@i}QG7hW^Zlo19B-NzTu*m6-E(P=b|Y?sceKb~i?}8C9%_)})XWt5=P+ zNNst*zTJMLv19qeFSq*(B9n(t$Pfh)|6wMNY)cvaE()2D zloO)#62fVYv(b$zt3*X3WkXNA;|`(v$)GhR-h2D{#`yUbCWHTeFumFCIHO~S;9iW| zFz3RP8rLOgv$9BqW>{3B}m!sF6=#4GQ{US6Yd6 z2p*9*8ZHj|glLc%Ey|ygTBuQ-i&*PM4RHJyP(;VZGYdv!1JC9EFA6#5WwmBRjc5l% zA4WheX9;-kUA{_H?SV2ESPCchI5gZQ0gY6k({8G{n*&l2etP|Ub z4O>;k9&r;KQYEcO-N`(t!WCu9*jha<(T{EBoG@5*b!(XM6Nv%YN{J!GODqv(S#JJk zrLHdvx3j^ERO$%GRHd8&+;F*{AV{3^+fxc_=;ot0Zox0XTx%d!O?4pVt!&I9PZM^M z0>-!_@q&9{ujVL22}c_42#wAq3Yz(Kj3>NPUsLvgt9Q{LVfgzCUN?r`xW-+pBq9{%j+J@S=WG(sZ@rXBKh zW#=txM3(ibVJg@Xcra`ZUhG%|5|ULWe--OQp5%>D$vZd{ewt#Oa(si&*JYQ`2bcZK zc%HI6Y%4>efz(IHy09@3MTo~A=X1fMDMz-&9E~hF`fw@ZwvsuK9kQf((FVg!W7hi8 z{WizuY(Djbgow&9eu;9K2cRRtlH7bv)%VJ1BiNoKE}5gU->FIv8I)+3z3$x|unb%s zdHXRQa>N4Wbz8iuO{aKd_v@E0P-O~0_>b=ZTZ8}D&8`Rdp%DSHQI{N3MPNo0_D7HJ zW1qQ#(d+Mmieau2J1)@FMXNna6r19daY12JtlA(|_PD zznFJdevofqJMm7?2IHL+bE@u-nPZlu3R3dw%Jd7aO6D@)7FY}!96p%%`(zO29{MpA z7W4{%VDz&OX1Dc{7S1kOh>z%5XBI&+TCj+z<917aHz1 z1hD*%x3?|8i=Vk}J1JXzWLorhFIN04U7pnD+BQ=%a0p6ireQg?$gl`XERDZH6(PLT zC}`W)w2j|?^j@E{j`NWclJCssF~y9Yx-@fj& zF6x^TP7`y+Km8kj4c31D%=srdg>&M30<^^W9bD_g1;r)@STF*ds$x#;1FqDBT1NoD z%NT$7hRvNb2vhTZ6xGC7*U>y9m_{<w}92 zV*9Lm__ujm(q8?)|20+;r0RP5+J(;j7$<`2bR}VGFjL&V2x*DDT#1RHZr`Aef^|1; zB7LvO${-t*EbISsL={tT9&$5`8*RY5HhUVD!=XbWH%uD+qpO-PSK^wka(W>sWj%Qb!gphcZ_~ zdi=b_zdFy~XXWliJrV=DG$e)TY>xS&RcWO97O^u!(RPaNQl(H>HmAdWTk?s|cDwN? zf@`XuzGd(1uQzuZX>5+cF5u>yxsP(FAgi z$Awon=d@Rs@~P}<#QP4V4BlVM=;Ms?B?~vn_QC#uLvD|<#`>(sAM=P3#j4t5l+Et8 zuOt|a$Nc&EzVw;P0s8Gj_#CoCzl3aO|G-%TYSfI^sd&Mr9K?}idBQHYIz;j@LtL$6 zqj4YezqAq(fxr6dmGi`Bu0Z}?Fh+{QmQeCyOHAgnlUDPR1O+g`1GlVgZYT&& zvx{n=RZJ?7r#IQm+vF51;Jt$Q4yOvYC+lBimSg{TPtQ}6qyL-UhwXlE+KD+Emq(3e zi8XeljZ8RplJgF;Q=!uJ-;gyu{+WyGrp~B>3&e)v3K|{DE*E#I zKvzb~6y#^31NSw>Rk8DI8F+sBbA%I!N8^-YeOaV9zk3`Vdz)F$+Y?5ja=?l&V&ZKZ zf(h&r!jCcY4EIjD){Q-yjKfF;48#9tn>rW6J9k{wKl57qf*A65}&@1riqC|b|Uu=RH7_H{S8EN={O*P;3LSrcRkDOW(%88AteLj zJz1sPrTS<@N5-++2f?9m2Z}d|?UN$DMxs32f-d^1pfM0ccK>B4oMp~&G$;uaI67In z+ZLR1mzjn}=DI?<{YvTyC{xl}-8QcfG-*tbi8l5i;TqrmNW6f-_`hYv%(d_nV^9h^ zjrGoM#xBfl?pOfQ=igZRK-NfXIz36cS^e!tr!>bFVmOxMXqPlXc`kv>^|FJa?*vQW zAr?qt#ZwF2i{L>S!F9rZNTze8Y-ZGQ)avd8rI8j2#=T}EA!&qOgzbI%GndurcuXj2 zW4uFSf(a84?*s(Qn0=FcF}~YL#xWT7@d7S}#0eoF*oF6o)tIxedR*dB-eHsVwpZ)g zc*))^amdofOmLwKabk9Ix8bgLF9kFCF|GDn8@=qB4=2THOiG>7EW7I_s9ji)FzH{L?Q38AzHuLkd*(HGalEF4~C5Bvw(3wT*Z?YzAzBG_zyEWLv<` zzT3!~yQTd!-b5J$WSvb|I(JV|W#n%mKyip_SsZ=RBNo<_@~zshSGR&+n#dft^XljW zYp0TeBd$`4mp;hO*a54BU|6zFW}wWHrk}PNw2I(MLWHmhyWN!Ed-vt@O|p6@YKfeC zpvAarag8;XNE`Xzp!qQ1LUyyAD8__wgcLyV44;3mxCYqbztksZIU1e(7L7^YB<0xd zg+Ki-2xp?|;-8J&(>P|0;0gF5S;j^ROQCFIpS%=&wcn0ee7zVp&m5(6nwStRXcxkQ zt#gKV#Z_ah2B#GJCS3A89)l%;u43_*MD(#rSc`rb-i?AaH#yCFD7~3lE9=nms@&`# zIMEu4tHX*A+7g9+9UY^c)P}6DSlG7Ta#ojlXs5oay)(*g*2Hw_@saDM5z<}y<(NvY z%%ozcR#??tx+E$*htlp&0X_1}$z}7YU>G-1yMPo!4_*$dI+;Vuc#jndB5GrYOkw^7 z_tU^vRm>GrL9(70fv%bC5;m>KNUg=YtlFD%0;kl1_9?jfRMuwLG7eWQI zLZeopfxtnm#F?wi4dcTSv$?&9i}*_-X6~wUBNZvYEZUlkxQjK}+snRBVs6lS!ia?# z0@9* zpd%(;Yr8kBeg89OX7fnqOJppC9Nd;do-?z@Y>@PPz_OPfT_`l-Vg0-(a|F&Gk$+4` zF>MAkl;g-B19MoXE}Do!Hvr%ue{nnrss>;1iF)rjyfjlYL`<>PgTKN0Fox%k@K6{Y z6kj1pabeR48ReP;H-wN`5Mv)7>6e2Jll5T4JH0a6ZrUqr+_`T;FhyXXwemq14H6#q zazBpUL%41Bhfsz?$W{v1{xgNxMc5vxykXj@F+)Ro@sIseG4@&De13j<|DNa1;pk;O z3|b)~a?0DhITg%|J{+?iICNxD-$yM2yS)jxUW5)6m%Wgxtk6MW6GM^wu5hLPg6}b( zIcqypo>F%dz42QNDx3@lnKK4VK0RErGOPv&0)pt^GX!KQb>c;0Wmv6^(^EL{UzzNj zrMLMUThiVH6gdQKzX^-86Y>LJ2|EY7712f3MZ!;kxGr6uOB)7ak$457ryKQn$N}~_ zEdGwe{N=3mtSN&D(IZSDrcFmZ_V!fOfdgA5J_9F&q0=hV_*joePUjp?$C}eejCW_P zQ=0>W<+s&~g`s+BcVWfiEKM9*XoTo-=8AOc7BXqDr?rfBm^YiPKPoLWz$|0N=!= zdRJO+IVY2SZ9qO6laRq!P|;5~L#2%_Fe18L>ra_UO~+|Zoy8{Zt_slz3BEhUh8U$ z0P^hV?62c@H$mp^auZhF-z&WOZppNobqAvq*DH_0Vz0skW7X;yQ@fc~INq2P3B|Bv z!fMdxjK$druP#VE!itPz!qRUTF2Xv*Fc6i{-&>`5kdhwR7m4TV?2#hNVFp07IvVn< zJ;GMw7PR)!^*M8$g&i$I=qJK~;L}Vn(Xt^LKl7uErQ_$nc30kP+#GL~o>cb|c#RHp zx6!F70qsd{V6VyNi%T@Q`$^{79w@4v+tcyVD36JPm4kyk4t`Rpx$}XoEbN5{#%@UO zJ+=XZV+iNbFz<43KJj$*3JDvn@tch{UdNJf4=8}hSjV(G(X1L7Rtrhd9~|FtH?vR2 z`T*+!D0p4`j>n`QPdfV2=qY%XVh#|}lhu*0K+()q?Fg#Vt$_a3)|sp}ZQbHopBbzR zuM_@;mp}lprGwzUm7HVI6JAPU6WXD>eACW4Wlr%zkqx5$TKf>W+0|tq5eyaB1S=Km zr;*)xzvnpJiYa&lD2ZJc#*n95a$;E}j9q1~7 zRb&A7q>LhKR`(N=3x-3t^X2j|>q-KpM$Sw&)=@zs!uxxhJm;Hc97Jp-6SOg#2@90B z*2iQ6VZ22{AsE*yPl)c<`s;;(tHJV20wwGtenz^w=?5|t1Z^h>2KWW|@UN}J9ZRGc zFI&*gL$KOxVZ~(h=L!oL_l1cwTyYkTRPux}Ln!z-PZkd>M>o!32#s(gZPXT0it*dd zd+Y?XA<`q*EchRN^!N5xprSZ_E~w&%=>8 zVMoxsVd$LQG7L~a1ugAvT{<-h^AeB&FFx-7+&QPLKFz7S9Z9>e*<`dk;U$doOSORG z$;*Txl5Ai^DR=e)6?QM~Oq=yNzReVwv(ZY8WQXMYeD*N`jCtzAeB7c+=_s{hM0ybF z0C@mGK)%0=>1vi2tZ#ku;djmQ$H_-`x`IAiMB1{mBOZ{{!3P>(*ciGLezU!SZ&l)E zVRicE_I-w;C0aS&`QQ?~alU^}b2M>uct|qKs;JUtRh%ez@hdM`BB3~fu$`H=>yn0o zrVCEo&dM4Y=*kf!e!a-^o4qq5;wP0PS)(~1>xKXK7Yaxm$l_Ny#pq5i4)A^&7rqb6K8V zc+g1!LJ|92cRy$1_pesdWNob8@FnLgge1*f=<{vuQ`vfQh(QUik~YL+0uLH_jVut=35$HL}moYa2m`=57h$|KKQF!s)T zc`%*LE^WqvUjMQ&jY(M|H#Wj9z)`&|A~usnM7tp5;C6R$)z~9}&tqu|VVQqxO_qaV z)8)jq^%4kn?P2)(w)l#fi2 z2<8IS*e@8(QiLRLREx8*LWaDA6z?0L=@t@9_ozFBtw*$=A>dq)Hij1Yft;82QyYlTY#>xVgt zI|uyd+u^(X&9QUoCcv{&=30*72;s=#)Zy@9m9d~Wjg@>&{R7gf3fb_2h+fuSU$4D) z(U{G<81to#OiLf~2v@igoR!2C7&+S!a7iH4U@GqI{l&O|2AtzA-nEn(;*{=>Sb%dVTyAvLf}HVx=>O?_Hb!sGXKUFhRVk~QkuQDts{L}N@F z;=Wa4zd|_fByg-m*e%S;!MP&gbC2@~CLE)0gwtirT+qOw0iYeq`}^XbdFH`lWEu1g zHt6IXZm`qJZBEC0*+NR#C)kKsK6(WG;NT`hL9!P_IunVW$0pfE*vtDXGVXrn-1IEd z_9iAAkPxHYLdyC2a7bA>JC_?XjCf#ZiIItmRTxW0n;#S?YqeP3EeMyA^lBqMg3#?w z?-C0`v~dWE*A&%Tp1FW#q+Gm-z0<-(x7mfS`DncnKpba4T8D8y2*u3iFsveU9u*mG zR%O)!+aK7M0rmbX>oKP|D+oQBgAnX;3Q+^6^7S-XSHYrMOr#Q`2h+NV0bC1cDzrMX z`4)fI(W4;`e$(#=&^gU8cT%YU>{}g!29A6TYc}v0yzhfUgoIRgg<=v1TijgXkfMu; z&v%dI9emaf~8da)tP_Vb3MvL&?t`dwKKul&6#NQB~%LLi5V8c;mWf7dgH_Uz_{DFgBM&$uB9#R3$ ze)&p~)PGvCp!i5(y?7T=kk3pTLtgbC`j3mU-!c~M-#Yl5kUcUXYrUDM)bzlPSqdEa z+Xk~rRpRKQ15dn2X|%g3qe_9mnw3%F!mce?!T5#m3%cKTiY5d|P#!ejsPphKna%n% zgHPe)h>qk7ysFvR-Z#0?u;mnS0NOw`-QT0H=0#9)4{*_8f9en|LYg72e8#7ZEJDKq z?OVxLi)#&4)Rf6b7h@SHUF%(UV>Be#&t>6jmi(CRxe}yF%)6 zsMKEnEp)Q1z-FWKWiY~%FffWn16Od-ZCMH{YZ_{F6XYEXhRG)7~@IlXPr=u&>T> zxpmH+WSjBPqLINT8@_>XEdvb<+XZ8!w)#O&v9bc1WX=L(I)JHg)1a`V45W;!h$GQ0 z!*3?}RRH?gXITq73ZcZH)6qKxAH@5mINBVA5JU!~2J|q~t|ZgILKMj@0}tks4L z-X-1@{X0@)Hqs!ntdbpOQaM?PJ%LEXOGkJPISmXkoAoW0ZM{NYroTiG+odIw2Zt2V z!r(!u7$Kp0c${-^3w$!8s8%PdJNK`-B&R1eH~YDUB?jfv^*mv%5ytAP4zU5Hv%d#< zat@!wu>bGh3c+6+43w(J(b&9=OE5+qO%u{OQRv|q)P074NlI6RM6@op3d|Mg5WG9B zbp&3ZS-VLCwX-w!idSEr@q^EaeUn{$KpE9Kpa)imbd6AnNi<^D7lz?(b`?yqzP*Ly zJ&ky>cm$Z z+Cusm0*#Bw;dsMvCDcD;VOIpKMC^y=S9Rc=w>pY)lY_O0G|ytrubT3t(U$J#P*Lnd ztR$aZIinta<|sSG&Ctyjk~>(9_Vje!fq>hG^VcsIgfqMVoG*rISZ7d(CxWN4`>byx zVc_1k4Rbzjw#S;(1*i8eZ+?l%oIA8I(%L5@;Mh#P(hbC!5o$TeBuLO6Fdig5?>kd- zDrs0vVw4A?qS=sNy2d)fwp0eNsr8{#i4B6tg(R1t7Rb4Vsk1G0-@mkW8VmI{?ruaIITY#Hd?#bi=d}x=#OrZ zU?o(>Lki*8G0sAQBLV3q|Iu?xJqJ4CA~3O`ZWD%y`h#&)PPt|5bwAX&wm21q4Z;0F zUzbN5=$I2EaPY%D47BV`AKD3eN` z=mj%)F29Z=?~Py#G`dkvrOhZ8^W_#`xP@ws{kxTTggY&oeUxeWztwI77 zzqQwmoVefuYzZCKRX1i2tAo`t_yUE7>GFG)1=TmT;LT|mHOd<0>U)!o+PukGUtax6 z^j91v{*B^IG6WEPg@qvq^AJ>4egLPkJx8T~&z#22j5-Nx61dZ?weeCt7qV|)S6~!k z_4~N7CkPaheMwRUPYSMO?S~yP2I`avn{isJ%Z?i|ozpuYj9p;~IxM`(ND^sbgb83k z65JeZ0*>~*csZ7G$7KDuFH;_Cr#;FLW&jky=d zGaPLt6@1umsmJK-QDtLT{fZI=oAsTf5xbi%VjYKDT`$-|(HWn&=&ZSJtL|r1dPMP` z#wJTtkwUdHRf&gL=A9T+(u@7RW3bNXbRV?}85s&7XN@_XvdxH-mNLLS85z9ItG^-U zG8>o*<84*23Wx;6&iI?mslN<`Jm+n=ldJV@f=04$38kM%BS@M>T3i+d2s{%zV#&rO zOF~@aX^!n=9xE(v`vu_FFK4Vyj*(5lp!z=rJHZXZ(UxaMlg&+>brUcu!kr;d0@s6P z0xo=c4{`9^vju5W>@la4-n_Gu_)Qysf&3yu05Q8pNKu?Xat<=$*Js(NV2D)PNU}Lt zcqF1MB?p3Q+CK@`hXCfkdz$ZgmJ{!esYrB)#{jsi1>M5>LkAUeWRRL4EVG7-fQ^PJ zakhH?{5TXnA^&GmP-kEUMxEUp%gGY$RtsckAplAtl{IS!?^*6sC>%MFpmeX^h(2vP zscSn#D$58z+rJ_D2lWdJGaAbnpF09`kOqt-pX_$TG;~bhz>3-GlPw~>ZxYwTi7pg7 zAB~+PWT|6`4E`yFLw$W41El!pO;+Re{j#RyGwERQavaA6UL*jdkw3A3*bD^tjj3~5fJQ8onND*qnS(pPiuX}ZsbSadOkExI%f zj4x15iga3Ge=C8MiMCTDXz`3dUJv5URQMcjcQHo4xtNx~;c&4-I-!| zkeK&jadWfk*Jb=5_JA6 znT;tJs#LY3=ahIDJ8xKh1orvi=Nwb&d+AgPzNb#Cu^=R|T3z-6Vut%ZDsBYPll7)e zg4&QdL+mv68{ivUEnL*M=fu~^eF7qes?%O&unn!G1gDhHLf*?%EQ>>lN!vyZGE@AG z1gu<<_nGK(E+&W7<4ANv4ct&O1fo{QD@S{Tbszn{$=+0QRtxkCF6BN$tIJu|r%Louc22&eIq?6&10ft`Ss$4Cz9@ddG>J zgXkS=!=UQ+H2RQ|*__HDgp*p9t*MNj;fu(;{*^_Z`v=*h5zj2_ZS0?@%g6z(pR*L~yyc7@w@a}Sx}gZ>g4oj%u| z?D&Od%sDwT8Op>u_F3t$`K-cFZ2oAE62zDRkDY}DJb}o2t;MYJ%AhlpAXqWam`^v(PixmKLS=r;CyNNJ#wa&37CjBN(r5%$Y6wHFK2`427)#1SyLH zcL|{&5cn|eXlFx#VAr~EW4rEXQO3=Ic)&YILg5aPw`|mw5o7)Lb&6Ya4nc!-gAN8P?!jbr*&5A) zMw)t+*nJ~6G#khpn-HbRn0(;`#bfFEui=@`d4`$NW>H_z$(k+b1=Q#ZJT(MUU`Sv; zB}zT*Tz1w7HX0M&tbikzEN(OYu;?7>5Wlan@&)IhN|X5C>`3`)l?>U+U^hAyg6>s3 zAsehzwklp?D6nftCXNke4J7+?T02y24x~$#%Ccno{r6xVg4t{!O4TYI+-8+=@tT{O zZDEDYwsaCEHNluxq0VK38&9FGW;KUO(!H>+H-m*zjbxWbl0 zrrvP_o-zN;#JEOFFoK6B81FU{tdG}@88msn4AS!5!vH%YRYhU|g}vUmosH-wjqH-J zo3Zw+k%MCF8U^N2V_nT(l(y@(OnUUuC!L+sTjvP-Mh*=YIVmoK2QE=MB7BdYXuL%b zZ22tA1w_3HTZDGuM=gVxWoJEI|JYw#oiCQj_)*g?s#-gvK{n`&(dn{{Rx)Uq6d4q7 zh7evt*c0~R{W5mhHouxTecQZ_*5u9W=w^B2DG4aG1nk7$%Mb~$9QyuYXYg;fDBiAG zt?aOXjUWi%L^#Iz{Z-R$&bzZBjG-jxO@)A-K~np@Z@S+h4k=uh-}B%IEkjAxM`B!eET@TQDZ4>qL=I^avvru@gvu&)1mO zr8L7ta2OhMjzlJbAcme{?yS7GTJ@*-hvDprLmqALTl9;gcj_^MYlfvS%oX9>;=u0A zmsNV^H+dj1|4^*>Uo^rIjKcY;(iR>+V%78N^P1?G zeAehb4%S>E+xCzJYe87 zPM+GkI}DfgUr6wYaA2I#Ms4_#!(|MbZLT|8VntODe77$waoA=oUEqicSpgtl_qX%d ze4gK@LIR8V0aeA?4U%k@*l2Z3gR;{K7x{MMY31S+RoLr;0fsCO_zE?EpR1(3Vfh!a z*BJv8SG(2^W=wza*nO3xShj!G_RIELrHlo}jxtGI3WhpDw~z~M6!%GNqzj3?Jvz5J zG8<-<#ex#$Qbr&*Cv{n-F9(ppbeu>5i+~kI?BPa!188d~Ad@2r9~Zok={fg2XS}>I!}7S1tH>> zR^g82nJ6qndl_xK*|gDih6%#a4sXOd#Y9;5B)x2q_yTlVq-va^Jff7_ki(kewI?6QJ!ab+1lo$=34$uZToKe0t{Aiy z9A?ahEdV_X#JY1Vz-{+uRaqqvYJa`5^#B_BpDZw+hr+mNOS9g=Y9Bo?MSN23vZc01 zg(N(WKrvyap_mYML70&+-qPh&Ur!*+2^Cl*4ku^+AM?Slm; zxRdk?X2NZ}M;AtA4NW12FZK?e^anjPZZC0sAqH8m+Zwaf-|gW2 zx^KB;Y1TnZ+}xP8GF!}GGnL643r0u`Nm^p^M#A*yFOhH>r<6`v-yTw>zh#S-yA{Xf z0^mnBVCp?%(CQJUSfiCelx*MIy8Io zDOe>>UJ?TCjac11qgjVB+{Os3MIffd7`L3}2+ldcU8E-M%7MsAxOvt{NG*sIzq4jp zpr}~~!fKbDpinpke-V#-Sqe3@iL?w_>yzEA4YLl@9(76gjETrlrOvAn)@)SL-?1sj z@uan#|7Kf8ZM@oS)YgW}w$px#h71%!Kq4YxYnZph-_pDVA&Ob-f_{k|5P0YQ+uo(` zzTbjj8_Eti<73=F5HO7Cc#<>hN`PE}Hrv@%kFQ8P<0Yx793e+`c;Z8iyjyQIkJl^q z36}w~$AGXOajRsU{|+k{>9I;T57$Go$Xa;&>HeBg6luJ9u9Y z!#ke27ACoaGC?xKhLpo*!_v)p0uLZ)i1a~Y8YoDIOo3$zCD~_OzQdFJ^Wy-Asc*CE z1%KKkFo>Fz;z?`EMoBLr)ErJ5lm85Qh+u;wOS6(Vb;_(kJ=}uef_7VQA*jnLf!hj^=|%D;Qo=8a zgT-!7IZ<gIilNRCVFek)k)$dt z9heG_SdiCMTwbZ(m}#T-h?VQh%0RKes#IeTcR~<3p>ghBxj7a)qhWx_=+ZN|U^X4R zp10>{&teInr?EPPR|WsTb|TD!e*2y@3##wLdhQ=tPFLg5HVPSH! z5t)nN<8a1se}r=f4g!nf3ZcpSox?j&W|ggl5ELv|g-(Aa5cI?|m%>cD7i@Z1i|BLS z;tB!#MF6@icqXt&*f?HTL_q#`xJ?Y35K%+oVB^#kdK2$8z%FL1O*q!7X{T_Ton9~s zk2Noq(PrEXiKD|VgEGRoU2EO3>phr+xiKuu{NVd0xa{A=#}i(W7_#1C4DPbaerJel zXXc4?38Rojy8AfMX)&^)12Ol0a^JgWb5@odY3Q<#Ht1W^xwSdi&AJu#@8q--TbZ&1 z#uzrG5xIfnSC}Y$qGx8X3{&WI{X``MSc!G4|n9Q+W=>@YicS7etX#q>*Mc0WIJ-a32%QyyKv#4eg?t)FUW zu^BMlU|1j)$S6vkN9g{t$vGbDM~)PQff$YUom*RD+ePcdpQ~VbL55@^lW` znGIj!kWKbzz#^N_>foCy#Pnk`@{i+Kx5%I3cG|}+n;FjhqNJDBJt3-gg5O|!x-jIO z$GcBl=Q%nP^SVCRE3kT+&FiJP^aOw{1=noUCK#x|Z0#(GBiJ<=TZjdK3w=9n4-fmt z*=ReAMag4prJ~)m((^hbeTe1HAUDr+7v6W#{kWHrhs(oGL;PRge4{*abeAk; z*3vChh)nTX3)md54ku`W8z#f1t?|}g5)VV@;wB7gVK}tJGr4Vkm6&v)gG@{(R+Ta; zU!ZfK^$Kfa9|cJd-i_#8MC2(148cuh z`60Wwunw%$!3Qgku~4e-Qm#Wp6&wJ3q~c2S3v>Ui{=H|eB^sx{SW9QptuZxcciq8@ zDZ)&YNI;QWEq8loxA5B#)1 zTu3b%K8jj3R@8R@jrz8X&r{E`p zBm2~0TsBy%V-p54b3Se+88h3}{LwstQi70$r3sUQcK6Ntp!-k1gRGgvoPIT0x2&=o zW`da3s5SO(bJ>A=Ojh~muyw^xnJC?mBt^mTf-PDZs>30yEH8g0gnU8>fkha+_A$VX z(@}dg#F?dt>Evb#0!%^cj&!(poezCRiuSHVM?n+blI->2tlaO+T+IY!-T%^`vQ1to zWj3#r_16{OB!90=P|UUvDxCZ7@Uo&4IbR$}6B6(l!$PNbiaqZvk!S52t4c=`j=;_E zOO*~kEM#BR{^Rc~{#|B7hCSZO9tbf`IlpOOP7Z@I9&aVC8gJk}dgdENh#)4xQY!3* zCr99PBu6KG{S{|m&e2ml#mkiC$!~lcJk+#t+@pIU<&h!Mio- z2Ir@|+KkFm1E0NH(gbvWOQUA5-$3uOG8Vt;w|$M%LO5-Yrl0m6^ike_(*iNU z-*$pinFw`ic;1rOWVt7Dr&No3p2K z=$tGfxXEdC*#$vxiNXX0v0))Ft32W>?aVg6BKqfe^(+*{czeLgShqPlt9O8M`+2x> zV25v42?sIU-}xP@M5UB@AfvF1l%6&=l=7dRv6NX9A__IZ&VD3f`diOjKtJ2c&*CF>X3I?JuLk>~+G?hajyCG!?R&k{17g-Covd z8qOx@-os!+Kn1e(m%WLjCLHc>*Xd3E;Hi$9B^~{+qwSE8v zPYG}zHbjLw)abs6Wb7a8`DPftvN1@cSD{sVGwtqmUgpTG@kbgrts@%bw2sLRVVh3s z6k6e?`|1E@g%p6+#69Z&*h#6{->ZyBO79Rf2OQ3i_5d{8eb1lIXMMs?0(E~av|SP) zXY^UZN$jj$>B@h^$6#i|6d=nKUnbdr^dRtc9z~ov67+Ee+KV-g4?brQj?XyV)_^g? znq}k9Q39#mA$xEUmUYO5Hmdo0QI*O=^LI zItEG!GErC~+yo6u`29I&vIX_C{j88&h8w~W3BbFUL6((VIGwwJ58sG+NB?U4xxMf~ zzf!(b7VY0L-akK&*@w}VrmXY98Ti32vXjY&z!9oTL4*Gl5Gza2`-HHlh z91d-h^_#YNQcvfjHo|@*QeFwb&o0%<%56L>%-Lzz60Jjss##`8EE-Z0zvRr^^DNU2 z?yGE}4IRins&pA~7NWjBK}exOm}{Il{8e#@*}h6jAd&+Oi>R{IZXr86 zQC!O+dOdtf1bb`K?sw(AsUB3t1$*GmdalqGW?ftj-aFvKg2SVCkehQ z^V5(h#D#!7Xau{bVOob6dBvXoaehwuV}4tE3v>wWt&i7o0x1Z#EfjhJ-8P2QF0<#S z(X8$s!$>N2&jLwC1QF`Hjp;c%uhVgMK|4f4gLW=_1MSutIms)tw$P)JfTRyF3&Q*M z6;>?KFfGI}BMu%piZOMuKq_ge-#q=Fo^|t2_PJInY+8A9**S^LtyFRn6K~{N>D!4{ z_PT%c6?H2G%v+6ctw&`T6${3-r5TBGNQK1Kjli9z$Z&-7sl3nYL z;dE)`b;L@gbcxa?Bv7PGfVH-N6h@}XXi5{9cE;6UPxJ{0Lc~=p@_R%3rzshejwKo< zM6J|@FIHXhSHR36NERVbc7e0F4>f--D>9w`(w_<#Otiksce{|PYkhR|Z&!|~>mp!@ z~1hf68fYIk-S#>^yF$SE%7(<>p z@l!X)D13+Q%HmgnW!UQg-@Z8&(h|K3P%L76h21*u7goz*m=PZl*2a310K=*6Wyc@{ zDNN1#G+`kBH}co@I7!l*$kB614`ZYSd=-Txor( z>BDK2%2()>E?2Ozg~zrJpVG5$c46%^t}%YPpW#ZMp9S8M;(?s)>KehL`g=S`R3zs z$GQ2;sc@_Oah*X5(Q6&AGuXKBJIkIc;aF}W4ORe-$>8s6JV7rog3Oa{ri&mWPDW?5 zC1YkhEu_PEMhO195R>}_Zkk&Qlx}sy0}SEKUjvp|&NIehgkza`&-m2c|HK`pRf^ zAgXv}))%^u=MUNt670=Ne9lSxbTnGEi^1hhyVVXmLk$V9TAe&;Qap^Wq<6p;JRTmL z<8$GY1nqW(jv;PVr!f4we6lKbqK9BGBo1L65D9dMSxz1zUV^^b43a?+FRm|45c2Hb z2{rxVw{s1=n?ZI9oV6~NO;j*HLcG4@?7->wL+HkF#ihfhutyF{(dWx}&fQhJcMX5J zHh|8+7J^b}3nqtag#wMn*g8pHr1=f<7s3^H2;!>?Ufdg;#Ucru_Z2qHjR+Gy9wnO) z07w|1WYcDQ$$bhn-A3i%p#5aM{o1L+z+NTk6Y&Iiekl{$vGn_0&zz@aY3kCM>_Rkd zb0MaDUDA$Y1mT4e8{+n`Vt@#`(hJ8H$HIIx!wSe#^<$B*&>|_s}Nj)E3(XS2nXF?(m zJj;GhqGPX=LylN0g~$|gnU|gNuo7@kcLv)V+bz0UgZ)#8Ik?{yr@kJa{}N!z*=*G2 z00tpL%tv^s?pP76jbJ8K3MKn@95`;I@Zjv+F!mGlP1{L6$Dmewxi;j!XKqn&BT2N7 zm_(!W7Oghd4(M&RlIocVsI2lCU;=GG^5K=iy}W#$Kg(-0(|o=SNO4KStUK7 z2}cwnCll;ua{_eTC0&lCg z-XCuIc|pvij}^2rqhsETvF=o|GA~VI$t>nb8U#o)Mt;c=%K{`=-dLrVwtjA*Wg8fE z4=N5*HhN2WY5qAyS-NoE30A}s31TW2rhpr11xdsq5mCHFK+2n0_a>>k97+QA9BL#~ zMzB*Wl`j*YJYEDF>{m>Bdm6F)A;nllLOyxcvQWC=weeX-k@`-)vRijOa{)Z-EIzaT zMPTK`Fzwe91^}UTi6vi%Uo<5V@fKSd4J>VcX<~E8=9Amen-OhrHm1!6=Vs;WiOH5| z@?APgYbVji5yWEYF*XSQueepXKOfj&`qwYrq(4_P($;=Ky=awJezVFae_1TT;xCE0 zO?$P;Q6v@)cLes2Aem$CY*NQI^-sPqyX$98G@Q52Tcxw#yj50(Z&YO!$RF0Zh;2uw zh+Ij~jgTr3?u?a1gj8PAT zq?}jI_R?~YbSYr?hHs1ZS{wZSGzcprRTK{+Pr=A3PJ4OP8J~mKlK}(_?zbrq+{$df@wS z?5~O`Y$>X1mY1E38d$|iqItpvJeYLrc0EQ2g0nWzsn8r}7riy3Ao11@W}PNywf z=kq1xOA&Jla~vEsZ8YlaZ0YziK6KB}ybVV^Z)`BZpb)`MzKE2LBO{L~6i`1#A`RIm zjDI7n!*Us^#3U9M&Rmn4R9tr?1IsT|3V%K8NG6-lxVRv0L`S8beS-d!$P~JmTG?|$ zZeEK1n+(O=kOJ)Y4_EAYwC&@DfxdH*u88!z0BgsE@Qr3>j#5%}mE7{U`jG#-Ad8hD z*7~;m05p2Xv)qD-9JVgHRjBZ_+Ud)x7vel1yl@+s+yt`7N*<=Mqemd@8xe}JLo5cy z2iQ*WTXJogvL|%#n%}oZK^I!1ZM=ko?2#q-dpjVLV2sqko&=AflESdN9U|(Pp~abd z3F_`*E@^~{M(j+fn8OCSF;Txyd;^uCznu_4tO%99!ky%$gp9%_J+(8-s*iyVj3Gu{@^VbFQ+Qaq6XU@;FdvR5)E}Bk`5KSC&^rr$wNis{S zlHDm%D8MGCu6P@CrbHHAnavz`;_ZR0qI9-7!|*gQy3M2zE@P3BC}vo7q?1`GLWfTR zuL3!^@1LAPX{?n7L5jZLy+5ChrHdogB|HE|hiEsWqfM8oO>76oD&#eo-!5(Vc#l#J zGi0Id(yRNnpx4|+WBpLJ*5s@`OiriJ*g5al5hP1obSY($tr*btG6^TVIp^Tx(KxqSIfv>N<*m6im`dG0b~1XxR$!4(AyrOgE*6s~UrL{6C2li5 z)nyDUcxZth>7+&RRv+m&W0z(R6vK`NJSqr01(ozAwyt!ZV4E;{Y#70g8k@Wz^6^*K z@KE%SSWwz*A0_2c#i{P|hCHipv!w3W@96araXX-cJS@Cv`J^w9e&m_1^t14Np)!ZY zfDFQ>cQsyk-U}=DiWFiM!A8VKiY(@DPycuV;*5IGdb2iJt2TU@*leeYAn3ze=&BJ5 zy0VvV0$t#|6CeS9ph;_~AC3I_uTAyO7qbBy&XFhwEO;n*o)|f2ZcrRVs6UoCO|Vql zSsYdz)2wA0N=Fqz|Gv8L<4aH3M)-;6rSU6$pukuwBTX*c8(EcrBh|4&gD!MPQ&CrNo|djcO9M$Y-k zr-nNhIW6fZnr=2)Wk927)l5f)FKY0hsBR``V=SxxT}DI#hZ80^3#?|H-FvF0<}9LL z6GpeSHaaV{;mgA1cPvIJtOjEa3rmb;g&?Bwg?HGt)+dR#7|Ua?^=(raMf$Buh|g!s zsu`w`LKYpYF&n-_eR;kxDfXR`KEF#53>$)2n0W-T_gOn~?u<+Rh{oa|{VdQk?ZkmS zLAnX^Et?~uCUJNMXB06pVOT->W5jH;fHEaRe4PLXuU+dOW|_P>-XheodbQ!p_t3-( zsq3(W32)iRP2TsStGXvkKg{6$BB95e>(p#MhMt>DA#XXVYjc(C&p1pwi=1)1I2Fu>_+xajh}705=ql@` zcG3d&MUj3p{?6y*^)t`1?7ht{NWJ?b~C9)#?lOCfj zl1;1cGDhc2g7rsqZLeYintd|r8Yc8Mz&=odY>$2t{Ed6|Q03Mfk&dgY*zqYM7z4KG zjdPa)E{HEI*1*}v(ovyMB2)$(2bcw4rzyk8z7%>xX79fu<<4`SkQaj0nw`m8_Bvco zSo#K_CW~OnHb%H0^4MKTN)enYk}1+dfWU`5WE&>FZ+~gRZeE}P@}Y9b0N2RTk6DM4 z5+l}Qm);DqGe|&QMnYK?)+-Sh7Tfyb%;t8Ppue!AV=_K$F3liKYiQ@`2Lwwvoli*8ym5Sq_x@-SSn>xj;S-j%BBgy_9gP4 z5NxmOV$Osqs?y$tr!~i)(l}VSN|0w!xx7W~X2SDaKrO)HJ9GVwbj)mzq+QB}nA;mw z0xp9sV91W01YNDY!i(Al2W%22rk_r=s;Q@wJ> z=9sf}$9e%1ebNY1_^i{l`2^97y&yt+Bh(i1l!J6Av5SQS`dl0&IR>4j+)~=v{EJ1M zJNc%5XZq(tXXKHcLWL4cXPstgE~bh{YG+w zc???W(&5BmPDlCSb-Zs@UM(d%rq_jdlvVk#rm~K*ix-*oA)}s~(MXan3W$}6EJ$gI z2?&d)^gbXw&wgB78-DVwbG~z%!x9@{u2Q=U(jM)yi|(@He-}7R!bwXFEergi>hm$K3#l@ zaZ2(>I+DzTk1_ep$7J-SZP90s zeZ+OxISEJ$%p3+grhD%#m}l0w_(c##8>_HK#;V!0;ZC}^j0Pc`Pu$u@{9@Q(gr9kW z?Q9M&Ovo{bmj`Y17Ic{7I*K4MX(2-p)uSa-guD*%tu~63o~&J&W7Ikw-D#^6I9aVu zM!8GaJq)LdG-xNBb;2SE5CZ!TD*H#F$X^Lv&k;xSRpd=;1t@>5RhSpk9-}t~V%;DIXi<8zg6LZ?k!gO-pWZ~VF9z){8R8o=Q)ZrZLbo-xLw>ie7=0Sw6 zhpKnh#!Wk?%%#afo(+x#E5+ik!r*8oNTH=zq8q>yCNo;Y~$ z;MwD4X9KHHTjKkhV8t;-{o_6ByRN4`UToKS%$yC`U7kLeO*n>@$EGF@7w1& z60OMcw4{Qy&wvHgL1{HaG7y))Zr{S6E@&F{4D=JM7g%t#>bmBsZFacPH^d3(9}_mc z+J=m8QhP{+_QK_VKx{w>lKI-mr#Fkd?Xyv|0g9RjMx{3BHBO_A;2vA zy+w-O^h;snpD`WWCGw84*O%>qWUpq-;N8*w7oNGGmS`IE+cV|LrY-78sF_doG17EAtX#=L3RXOW zE|pyqG*g&|kfIaFeWxQedz)ng zjqC!rnjbqj8``uQb}0>(s3Wsul=ye;<)4R}M&>M?j;FAOR@z!vy^E=Sg8aIjw91=` zT_o0YS4`d3+(}#0U+Qr*wyhImrGMg$yL#5jiv!{@Ex+MQ8o7~hw4pK1odz=tzG1)! z{1uIst~si7y}&ksP{O%~7j@5;-SwQC08K!$ztR__Xnat?Z^j4h!)4nJ@>ordAAvt$ zhC!^t9&6;cz{HBc%5{}NvXfzrVE?*1))OaKns-g}=h?@TIqGZ*L2u3`gqW@>6Kfyq zP9AE>M38%;36DSHCWL^-N>t(Juhg>K^khLNP^|6- z32_R-#JF_*6Yo2Cb4KoylhHI&R6?30r-tMaF*~7rrv80P#0qLz|dURgmx?67W%}kH-YMpMa(RC6LB1v0=ny zHbGgyC|v7ZoFf+P-v-{(Sv)|L(6qkFM-?{ZLBE4n>JyOgf9{%*B_AwfLK>YEI&Mp< z?gaRPTP$RcunmOCs@n(S4bDnZHL`=N&!;ANtWDSinNqh`(+( z=$?x^$Kghv)@I#{!!(L&(fni3T_cD2h)Kp2k5KOHtQ25YqmaRjsNGWj$EI-{jVcTL ztkZMPX(8Uuj0ZC9Q2kFLU#&lkcavP-$epCRKw5yVqdkiSg{Wtf6aI7^!9uUwqCbQ-_uOJFb01Ix&V+DFqGfLb zBBMT;6B6h2p+B0Cb%`@v>AJAlxW9h86*t@Hp|Q>(&RiOB-_aM<|WGKYu9?VJ4 znmcotZXiR+d5=b=yhXE=Nq>Pe-N_RgyH`$qo7QfG10!PqClT zpuM$7{bYNo{rm1p--qC$?Oa9@rwf1@nUVSL7oeTKSnbi!g4IUqA!XG6rkrB_rl=m5 z2Qopb11b#{8UzJVsu57eE)dtUi{ATI{m)$!7>C-Uqz1e+$ymRI1Yh{dX27+_cngd{ z(x1v1??yfj4US2rdO_rurJn*9c(X8{%YfduHRD`4?QS5s&Swi&r=X0z?BOF3RTt)c z$!YrVrb4z<+7FED+~!;NZ(e-!EWbF3!-ht;BBWEW$*C>aY`@_Ksk{_)9@*~&JBNA9 zowM8tBY+JTW*3Ns9(LpR1b`B3hIeo6clQvsj~ryB9MrtVLZnUGWM=<>)<;!`i${_h z+(^W2q*{si88DLw<_^V91BrPKoQ&4WM`JL(Z+CZjp)m_#X0Sv<*1s`4`IypOt)dA+ zB(>OvnK0PCk^(HL3w2*!! z&>o!FJyTxL_&8;2ybhZ+KB{jtBfBghn_)s1VU=J@Ue|=I<7J`lOTC=SfJZb^Tso^` z4Dc&sx~@iUjH$rl7YKx19GP20X2;7_(nSNMtxy*11j}a4Y7r^eS3r7JzSy*1dghAg zDdn>BU8Wly!9HemjQYB@kX1_%wNT zo6WEJc;|K{ZPk9yVzbh_Gml@5j$!-q@?S7|pW320@sEL~<>6prH1xNv@ zqgrKSAs-{5$99H$cfuG*1&P4VpIk8Qyy}*+*4J$>#Ga>Q zg+3e!JBHXKjyUkPnjpM4x0{X`b7Xy|9rQ| zSR%;6lC%^GG3r~=ZQXhF`hM1_8uochXo@4*i(l{ z9^xagiwYrvNN`2g1<5QnR#5i0UQ@Mm*l9!^Ovtfwuxf`&FRi^YGpu)x^4xR9S^%JqyD#-GzYenSBvES?WkuLbvqx z8K#?GuZ5Vy*Ar5_y>6WBZE@G$Q4SS4fYuuvA z!j7rpqIU#i39KbS*1e`qq_fTdxatq~3m zJBGa?!(<&-mCj_nzc1)woFgSDS2TL7^A^2b(DjejUnL|mA!h}Jk-+ApDP$(BvItT@ zcdF2dywfC^>z+s8UXGe^C`~nP2~V7=<@%+mf(0zZ^Td3HcZ5@gV|R;N5csVh!Af?l zM-o!sKg%JSXdZHikg5%65Lek_ zdDj=+DqyQ-Ay^XfHeQ#vzcD+)h@} zu3C2Krht3SjvRdZ^cDepq-uNw3Wo(m=1)h(0h^ni#1@CAu{R;yp6j;dYRk(df)V} z=IVwJlk841*_kb&Blxm{m8KV?Jw13x^rs?d6h$c7NHIV&piAIaF4Nb0Ho1#z)~U-k z;{yu)k%DlS7mI=GwZo_mAEUt$rJc#%Gsrr~WhAFq7LV!tj(p3**OP(+ZM87x?+C(qncD@pb6x zN_YRJbFkR8e(Yr0z=E?47&Cxy7B1zFCwAf<-{sFb+mR53mjpQB7;>V3RB;$JQMN$Bwe$W>g9>)~w#!4>5<) z1E2a+<*Cl-k=I#IG;e!!@5F{?bGfvgu)~wc7x$mmWjt=`D5fZb*Cubl>wN9hh?*6e zc!KA$*u9BN$HF1dKt7FOGhnpug`HStWJiu74}7rF6hzB9Axc=mR%fl+FFkYKMyr#k&!`qt)8tOas3N3DnTS|~ z2$Au#MQdC=(gA*w|W}=bKc9qQ^&{055s}GgnW?5sEEov{^pfsEXkcB`YIR)7c!XmO*KCAdpK@5b^Q(!W*J*|*DX5JaV&*( z(fE|MXu>x(5mX6GQ&QLz*4lJIUIjYq?5{heM-tZ@TgGIb>*4)@idTXZ=m{C1VTB7N3{~> zl!$+V{0G~eL>Odb#@euRs1a@Ct1181^JPgD^`Y0%1d!Fu7XMRC5hYF+MB+2|?d^qS zcL32Z?ckC0ZRL5>D29hotOCj(dWJ|sD}an z6x4fR3+^~bc32ToQR73(aq}UEaLQhY;VMCV$ObGv1TxfU5h$~rjwQQ|8UWT|N08AR zrpJ?=bAP_S7_)3l=A)hQF>TtJ5Y=^KW+N``O{*d-*}tKEP{_eV`&*FhSWD53sKUr* z75AhN%HsD`&LZ}vBeL|X1k^xxSQR<1E*|EO9b>t2;kkqF++{u8Me+lbr)s#?GdE=y zBgk2000(Q8%ym_0CE}{oRLpJ}rd}{ENHy#TgOKc+sbnnX`4rS_Za9M}#323cz4~fJ zKw><^`OQ4A(Ob|zhK0`Qgwq6F!$>t1E+af6(1klEXlsHAgi9!x1#JG~r{8Sgo_GFJ z)V3FOT76|Cs&oh29Ti{vT384?B&X`rWhq^UyoX zY!|vm_Mz+KwcT{`&R$yngdc+_!!SvRy0d5Jj$zLcoGe9cTtLB;aWTYee~i}eETtDv z=DvPp$t;53-h?`>v93p|d*}nObGM5s_-H+VP#+`wd-<7*V%4}};-*FiJe%me$=8yo zQu$O?$FZDV(5vvTKD%8yUb~?{tTonWwUKad47)e>i9s^4D2>nk2lS24l_ctS)n*m) zW-}bDOZaxd2kbjMV7yqILyPg=na$A{JJPBW^3p1~1Oh-CE>nI|P)18sbiwF|5Hb;g zqaZf{Hbc7T*|@~}M-IAQ)e_6B{i)*7hJd1c8=^bg=rZk{V0f5NBPuiOS6t{qV0c!q zL3-|^qOGwtt-Te4d702s1<%4Yr)*Y8>dg{c*hGhYEM#|<{yXOIuzlSJXT+`$9t^$} zsZtQugUvHy6!dO!Jh?WwhYv@YpMBT4dU%npmFIKMTs~53 zF$j*Mq;>Ee!YKIUzHxV0sDK3%24MzHam45_NZHfl$KuN!mf{N^v~rsdI>%FPXl`+l z5;MuWH^TfAfTnwDw^#ekfPIf0s>~BN;_L`PA^sLTjrm1@DBW-v-m`x znu?g_CS6^>^w=0iec<-sgyMYe?487X;k)+(-WLNuvQv!jEJ*2sU>8<3{AB+fO^SY? z4)7KNeNfN{JmaGLGrIW4XD+lc`U}W7?Oa6lxHsVvi=dDyuYE|~TyUOQ4af_^YSmhS zKKMBua_<%YbJXcGUI92?aQ->qix{_5^8>Z|^N1mg*bsuX+x6la&Q#SZFZywh7S;hRV}D>`6NR94mPtVqJ)7)O@1c%O@qDYhk0 z^L7!u&Q1xdgLX>WU?7aNbw0oK@Nprkb!Qz~u!S*4C9Mo`{uK`(CMDX6%@FZ9C)6#^rGxjqVv9Zm$h3}Hzi3L@2`a6xvGR@C3J zs^%HB;fo}$Q95h@?lkuLfRYgub8PHRlzw7JLjtDb{$VObqO1HAPvB%3BPJW~?|>le zzwf?HeBbjGGMiL?qct#WPGvh13*jW67!`)Kh?%qC8J1sV`a|fy7*Qt)9q#eXuYAvp zmwi@apB9Z1mk5`K)wqQ{q%h102w%xuey?P>?^))QM%kLp+Cy$Qqm$d5 zG2hgX7h)ncR^W6wQ8*Jqb+PBZdlZ6kO}s3u1aeT2ECM=&-}Q#lbjqvPnW90|>psAc{l??uO-`i*MCf{DJVHeFOur_9=|Ir&E?gA{69_WqFK5y9#NA z=rvkBuOlE&$A;V zAMMx5%>P^hAc)G+S}PYfjmKSAi((6Kim0q`0|~rL*1Uee$S+Py0kL#J3V9#L+T6ht zrgY93{T)gvN|v7<2V@xH)07lL5bf@Vri?>(~N%V>p(GtWUN zk(89STS_X&%YsXI8aSd%&agA7XJ6R?vD1xaM|BtYwG94EcqRP+@1)=O#U$%8Tc=Ku zJflq7j8WNLTHg$}Vx!nZy%Q^C9z-k%F?g!FdD#FgWzs1h=$p1$(H8 zBM41pNRggC#P&`$4rr_faDV*GR;YpN%BPk;_NLL+*HUz7G{kIMUJ=FYRT&9+dGBD(4Eca zuh=Mm)(Z=emPPvF!iJn(+(ORDT{bBb=(I7J+9yQq38BT_;Jart$Kx1)Tl^9iVvd^& zX#od0hH;t{qPI5m)lTqQw#D}k^hKZGc_UsYaM5qwfMr&Ctg_HM#AvhLVqB8lCv;w6 zgB>{PIPaJjoMRYK-8?4Va2NgEw89M`@?#O$^nTzfarIdviDh`_eD7HaJxNl9Y{v!T zu)k*ZVV#i!*iPQ#1F&D1-5ljNu=9y*_mB|%ETE=jK%FoQUWjXGTFE{Ufwv4pQk zax76rwis7-q>=&kW@MK8+2enD<|5BEMhFZcdTp!;79m=z)a9*4jDr2{J57l$#tLB* zQ5^Dsj#_p-4=;ZtFdU%sH+%{4IzvxhFbStXf>t7{uz*M4wcAsSVRMYe`QsQ3YT!-w z`Z8y_lL`dGtW2(u+ku>^Vay@j5$-+#xApScc?7Mql~l9`eVy$*m4# z1Q81TGrBR*MupVmBtV6XXWIK~i{r;X=>$Ii;>}W}N=Sk&G*T6JYHAg#>_Q zxJzQGkpM*K@t<1bIaC|`u|Qp0WzlG;V!Y%|lpHGt+DI&0$aN*`UJS55I>KdaJ{{Fb zHYo=*{>&J+J;u2E0`fYs%Yj5(7$Wxi0o2Q7G!s}&0Ao8^teX8~{$$WW6ka_K@^HaNToKiB@Io7l z5Xeab)zr@e3#S;VfxZ&T)4#8U)k)Dg<)Yu5@^mBR8B}<5PB<@j1lHe)h)l$3jzSg!74q2~Px3#lpw~LBfUT zL2_R2E`yr$vUvy-Dakg@=*=tvWp}ib#Tdp072>NAO%*~IW0pz-Uh97(7jhN1am2p*;{~f zj=_AeL4@Vn5N^boF9edQUybrE6Jd_l&jwwUw1&~;ZAt;;(a~KNbMK>*71A+Zu(tf;`^^3%0=sY}iFz$WktWEf24#T!cN+rJ~rDw#`9n0Nz2}R?Ci`~OS zDkSPI#q5vFVj0y`3IbnZosD+0&Z(iw?a`nl0XzT4EDjNNZfV`SOCsi2tQn_Rnx8^M zXGVyAQY3s;F59>JrdSXqgasi`Wx^lMk|ToWb4?*G1Qi#jT+V$R5E%E);`wLJzcY^M z&jEhpqPjKgOwKiXw3EN@#QAXsa|CX!$sBOGHiH7iFW^0=irqrsG}s0RR6wBh?~$V$ zCAIJ^_Ae#K56_n%6B41-E+t^aBLQSDQLP(SqY>LffLa!9-Zek|X5R#?Jod*kn)I&2 zFz1uQF;}e7C=VZbrJqXrYr$Qa&1pnMZ@dFAu#5BvU_)kXg5-ljAA@CS@4_X$oaTb? zFJ&#b)CN~OrtiWmAJFi`=*Q-;S_!@?3~9prRwhWgq-SA5-!snZNhkJ;4FiP~cT9Si zeE{c{2QT7vc9baMkWSquk+vJ+j8lZtGV@c^)stBV|bl2!{V z^=_J>kOl+d2p$=%g33;y_7b)4JD#s1dcum~t<{^i$zR5%uvh~Meka}$(yjJ3| zcTrXdz78Q?1W@exY2EcKr+Wrx#EjCZ=eUwJ?wWoM0-V@xG*}T6DTHZZ0myg(>(Xbo zv(rWDfe==}0`$v(6HPRZF6^Pu*vvJ&xyBgluiC!%K64rMY=RKv=WK%7vW@1O&fF?l zIQrl#HyZv;FiqADVdeyfB6qOh2jFN`mj2?lK++Uq0ps`J!0qoVhIr_ii)7OYThyhT z4z(|*Dv+C2@9HVRZWJl_q5{PQ#C63wwi-a6O453k*2%L~pp zl|a7}WcI=KR#r>l`|_X~ox^frSmL6rQp_r%eq%OMX>&BhZ-Qt9(vh}e1+k!(e2~6Q z_#^4lVJdY9Yf)!R9#wWq2;`$cy%ECq-hPf(ZJ?hP%{YJTV9FsIzvZyF^`{^|f^BdW zgtCedT#am1)Zu-y*ym@tWtPp&@ff<+I)(tO@EB)7f`%&$2PJKM3O=>^~wW{b{ea~av5h(GM^ z=r2GaG`fiRyX#K!&OtvwF+d+M?fy=aVa_PdyqiF!C?CN10J5iWSvHN4LO$5_8Nx>9A#=yua-1fGTKgPlPgn zV(XSL(J~>49wZu?WAfS_@%gmMK!{lxr%ul7;4^Dj=q~Seev6eB9&oHI{(k1fEbC^& z2}<2tK&g9Y++_j}%U0MR3<&{&aNBhOy~R-bUrnxOVFVd*VaACX`$bv1PMj$0#P7z9 zzgme!jHLynoVjtK&e6 zl(IB*`Gzejw?bl^EC{ys%Ah5}-vsYOm?|Vy*9}?-1H2ETgE7iUPEXygp{ODlq`4`Ggd9*VP) z#l8O^{@#Zk!bfmto;AtueCD)G2uHgoCGCOit8=FiC`ma2B8wb{1!_^yv|K zKF8!{Ev=|0e9^GQ+^lUpr}buII1Aw6@$BTOV7uBwvDPcn3MPbu@>y>|1(Uyt|B4`J z#1gN>SfM9__a3ya{igV1@)WU@op!fdod};w2yY!RJdX zWGSez+Q-crZ7zcZMHDB^9cThb{car+B(+Z)_7L_R!s;g{`}=2(*xO^SBO9IVmW`PW zQve?PJZ1uSHHuA$Qb~3chF>aC3fQCFw;cMskoy}-05`60KdULQ**p$3ApYJie!9Ru z4O}N1fEx;{UuzYS%F|}nD1VVvk=Te(t?ZQKIL%C*-Bv)}dvcC*xSzQ1del@y&=`>L z#T+kB9u3g0YlHwxpkW$q^_{>*;>EuR3A3#61SylsE}xz9o6l~7Qpd9oEK&}qM8cIg zSge&S>qrr`oX)Uhyv zpuzW&qAV-Dq@`*2Yi(_B`?t$l=aWL382R-`dY5t$%PfWXjVKDhba zs(pk}@tJ4NykqTuHpdWQNw^uxICULz=G9;|5-ZwvlFAE*AMs`P(JlUD1;LkNpB)lX zl$5NBAj;L&UJ~&!Vp7;o&|~`(j*EOIeQ#Kd1+h&l^93*SJbXRLWaWBC9j)1-PK&2> zw9gqqpt2zT;;?eq*EwhtySS<>`6kG8KV|I0s=sikr zTd+Q1cy>D!!5~}`vY+e>3?r(->a9vRG%{&cLI%BI*Dm+aj_|N_>4e-11GCHiGV&!2 zqkYqx`iC1$t-_OuYs9)*p(HgvYQ1ik1OY(||e1h#D z%qx*kuqzAl2@WL$MfirO+|}ep z(ksWkZ!rfbfXRO@%QQg1FlOW0_-)?(Z(#&Gk}OqqNosYszBb~UT$v+eI|5$2l~FKMKpT#r+%PRa zc;e;(`ZxnX0=kF`K7;ro1eq<1{y3mdMDw1}#GGSmhd1rCtUsTw#Lk4Cf@Fz}zSG#n zVC53;j0T_|H|;R%?(9c`QZ#lMV$o1D@&s&b(tGhcGxs-64^-KKf-}Y~!I@oW`PmI> zjlEE;wi;f8i+4c2F5K47j107NjcRRJOK*P)+?oL+6KchZG$#^Q)3mqnuN(vqhc17f39 zZA73ahrmKx8b-I(gD-jhL>9U6hAGmkKMSqiC&y$T4mP_5JlB_FBNp9!Fo+^8dMx50KlJOIy zlpTwBNpG!U5VEUjV}=i2*6qh&onR6WtstWZjs7Lz-1~S)#F|OQ*$lMmY%g243ARJ# z4k99Th37e|rK+mr+Yg&7PAm4s9E&p|#$fJ8j1A*XN;sv#Do+3%Z}4^yLm<$v96;)) z(AbHK*s3TyLjefDo&1+fiXoa$*l7NbDp8BIi zkt4%HWqW($1Y{c}fiZ(XHjZ~kF;nnx=D9_*0{Hu2B$eyx<;2TVA{SUtSXX#}a3u+5 zptLr`Rl?m+W{{2E()#A=r8_TuUZ*EPT zb!eTAbKbbcg^A5rj(&trI(N-$Z7>8dhebC-TO?7X?sXToZsV^o{ly)_2Gi0rVfrh( zF?Yf3hB-*of_hCrU+Uz4PDfQGHaQ&vK*o8%S=UQ+m^4{;DY6X>5Lr^r}y@*Rgp&mO9d^M*ET z6SCT8AA$tGgkaO~y1_biI5i4MznTeprHxw2@k7otY#UQSH{VUUKA6gflS*LtZN2-O zBt-fC1m)X4JB|0|s9h;1AC{D}NhbvPVc>A-Rc9EUz=k1KZ%pYALOevk$m-)Sz@$Cr z(0)R-t+VeTg5M=Xze7Y0N1*gZu=B0{UEBH>AuZdaSGMb8*@#ToDGfY)JlnV9J;?Cq zqE7pH_H1_!yM|)5JU$eUpdyqq6mI>{*%e)!kl|&Tl1Y*-C0%5>WRS z?I{B@*BlTrvv4q3ieoBfiFra8`{R{VSD$;!q5)h#2GYug@~AsImzE|7y!M~D2r^=q z%!D44^GN+}H?`AlBRlsbfJ2-`$^6;TbX|6upMzsvHj%hVW`uu39L=O9UI#j zNTStP$ziuUa$>m6mBmxy z0g`&Ke@A--E#t_{6PNss97)o#bd`c}c}c;fd^s4Y0qX$hyq%900oc>!qDtQ=kysacEww&(c9d zbBWjOC5rT`d92FJ!bVgQg@+-jjS^iTwTB&0@^zM!F??q)Tfn{RUfU1I7{iDDK zNA*WgrB+7$Aa4vt;k^-&ODaG(3=p1E0bOteRoH{7z;IQIr_3%9>3tH z-nlosOFzqE8f8W+(JayKCp^!N6qD6>0H8mcwu-cY7`*EM*t(2A6==6wGghnMuVTCh zI->DmXLgTiKQb;Tsj-5jt>o>;_Yk5Y;)Ih0a|O+Xy6Q9l?#F{te0`IrY+2+OQP_~9 z0FvKLqjZE4YwT+}AXIF`G9p4nW3MCW)B7!k4#Gd7Us>N|c+WY!kA1r?WfK;c^6aj6 z_xyGUvJ#MefQ0MR>35br7cvJJym;Hex5SCVh=zPRBHSHvY!ve=%(M*T=gOoU({t*> zvw4t1obaNQI)xR}+pmr8;;%Z`b60FBC*CKMV!#`cl9x*?kV=5djc^|mRDL5_2i^si z!XZ4l0CD{&dL>RU_K@8IFY3VfTJBji9_e=Hfp8(t$80{CCB?z&O;Z52{=%{G5{5$= zym>?GsHejo!TdK4dN7Ca_E≪Nun$f-V%FdaWuF^~kCmX=FeErhCW+`0;7^!i zR4ywv+0Y-*wyHOTl2f|q<7wQ~M-!LqW6sykEFqmM*>|Qwuk_F158cU!z>y()Bbd}mgggkt zhNG1LN$kW|3d5$o+5HDzX$0@~AnCM$jW+njMmPJj0T^`T0mLZ_s2opZYSXE;8kSHeC1>RR`c=sXKq*=RSQ()5aSk`{8C(w*Qn^5 z#E zC6%&9ieJD)9#8Z0njLDK|0O^&L}Bt*v-3Rj4`e+5!DguDZm430FC)B3~Y20r?;O{DU`=Xq&d)X-~MjZXc4C2 zbqfCdH}B7<8yaPlt<=*JUtAw`DIhcD!Jpt+R^I-NEk;|L&J--+aG*B69i-}n`oAF3 z-Cf)9zzvR*TmrzCb^yfZ&R@Jzjr{PqpsdWRGd#3*6bL!n^32M2i;m`)&`Q~5x1{WS zxNPzusuj#Ii%&#MsAOU3s!KE#m=mfvyS<*?^_>KHkGFQ?YRReCB^Md%2OZf_fRz&r zSe_#3a+X-(#YjTFF|k0GoTyFRH6*ej{ys17s&ny8p)^)jSm^4%JX(45Gq*0Ka4Hq& zQq1Ct**4$wDF zU@Jz>%JLU}yD=flfeZ$vdTVg6HTxuqP?Al2CX=SkAQ~YLS zUpRDE`|#*(YtN2WYjLJ4u~FKuYNp$ieSZT>4BlH9B#q^ zBAK-QWpxC;fX>z97tIGZ23y;MP%q#21wI&X?@sZ&OGvT+ak1p5<%Fv3@E_0x zM(-r}r4!0rIn#XKf`t3#XP#-8nDpAi;gU~_%O+gHdXh&9+IlmvC<0flMK*HpRMpfT zsN&q8hBDdd;s?aLZY6E>*)29k^9c(B`y-TljB~=82&OLH6pZhuk}l(yl}O^yF+GVZuG8678kG1*3y_bvTm)a+0tM zbSfw~_OG8mVQ&zyFtUjFGR=9o6Gd;+Um~OrByKoKoN~Wa zH0X-f{bRxAiIv^+qaJc9J})JkIj>xfy=H@fZ;YELjSf2mv2YZHh$^>TR4N^MEZdDqyP6~X0i}<3JqMaN&5b~V*WwEFU zFV>ehUz-#D;BD2~T+8f`j*00A12NRs5sbq|R<^6Iguh`i{O0yB4FxNtOh4GE{tKcU zf-`P!Zs>d9Gq*CBlil&LSb)Zq>@Ly8*#BP1Xh!T-2JL-USP@iqcqFJEi)61>9PJz@ zBypLT-~#&pf;S`0>yMUaC66ycFFXLZubU$2uS}QTJch@YI#(zk)U!K7!P+I1a@|n_ zZGjGskqknfHBIUw{%b_yA81d4xP2*GM&I16e-ACOE?VTPZOGOwHso0w zi^qqG=|;UcY)im$IgU$_^qX!IIo|oxV$r1-VGqlC1BeYVy1ay#b`3K}JBXK7pIS~* zYTX|00gmSRPF2UxZe&<9bLme79WN$XsE7{3i zN!tUlXhge>Z>)w@rmdKO-`1Cz{jVjS8GzZm2aB+XGa=hg@)X*R+3$^JSy_@8u!yi= zc+!62G|g3}i9m)o3ueo?lo#hG@>)8EN174kJOS$=NS}1;x+)Oa{0?swTQLWW91iOZ zJmXWgGEMS00TWFDYf`lP8qn!Q#==&T!}YsS3C6Gz%nDUG{wWy~po;yl+ECiom|#K@ zMib0cqd-kS_l$E7jem5OFZ;}m%k!m}<2Ft(S8Sa%)0iIXKifu%{*6q8ypHTZ+-RGa z-C#4KJ{YfX$96KngSa6vi1$6%0- zA+v3V;h8*m{wkAd}KuTykbDu-%ufbeoSOoHG80#;&Z zZaQAjf9~0)xw-O?^D$l*iOGgVBxYx>Ydrn^VSDW8l7&2Q@-<1UDE?aS>*)u*jKot@ z#e|l2Gmq%#cAWhZ|JrRmY)zh7SD4`r?;z2HgsqXuaG8!~SRt{ssH2969mJKGT@)Cb zu#RDY9RtQ|YX(y;fJz?XgiXa7 zBGLKeS42)QdmF22`ltB4S2P9AgTfH=|C$eJk`zNRONud!yC3sm^*AS3t47a@s;9|g zD40&F_ZI-Bt`csq5{&Uh#%#)BV?K^4iN$>GBG!nc%Xl5{=a|A?Od9-2;Nkv8JlyOg+xT|A(iWjvxEXO>sNaikv#KPLY@`0Edge?owCEhQ{sK z*c1tsrY}vHSJoSe3C#jYB}S9-@Ucyp8~vAEp|isF{_x_@r`xn2S0@{xO(w;~CYdFp zQ=hi-KPt_rQWrxdn7C)}$@=q({yfZBMt`d!6gwjzEHRSfCFIIRs2WCsI$y{SoRN)y z^c&H_cv3{T)%bBGvJXz}jjeM#RYjWxnZ=`i3uLSOoB5cArVU8502JyQd z-IEipbJfwf6O|acvKBEWmrJ~>{!XLR!BHg`JABL0R-NU299DR@pT-|sMN=+GmQ;)@ zryd-gmSMLI6IYdUepu_OWzd_NlTQmyFMSSpjTJqVuei{EKJGJc2@j7?4kf!K#~swr zsj$t?P9~v~};MqzsSVva=~ z^>z8kG6~7vzX7F8(pOTn5Z;Kz)JDUgMSXp$aPjafHu2fMrH4LqQvl8(|Ni^0fB*M? z{@4Hg&%cb|^o>Efz!vc-EEdDL{xZ|mRe``-ER)}&ASgXNQJg#7(sld5N(A=}-ZwUk z{Fl$!l`o}@=2BWGA(*n@OR|@7E2M6~=S}; zaL(fH;bmh|T5LAr{3Qzqr-B*>7b{b=xY98FFrxhdQ;2a`D2VxFZegc>gi^gHf;ULy zd6SAenOha0a=^INVTR6bQq!SmgM;ela-j^e)&CAAl_GEcFbOP7jfO^7)!)`XPD zyDa9EL2dy(0>b^IY+?HrUf)L8h8@oxJPfwxQ(iZFY;d&gE-tPMkANjdgeErZ$xm@sT|}J%Gdyw8lS#Zoy{4()6jx8iZY&$RaBl{*}Sjn{S`xKnBI!I*G~KHd{`Fzb!; zNgJuN;Rg`Ix;>K4noEo2a%I+95wqaSZeHc+wBYq2qiNsQ?is>5U^{uMl>88Xgw4jC zz~cmAc2vdK|AuS$mI};Ka>rWJJ<-KUDR~i8P{U=WOH*={_2m&+!4Ff^RY=r0)~lVC z8|PeK7yi!!bs=1ysFUDwz^l7Ms5;Fy<7%wrUstD^Bn>bJ-*Xz~f-LJ@clTLxiFOew zW`alfQ?8y$q0?*7AUH97-*xb!JskAymYDM85-qS@(}Ju>FqfVRBcQ&VN+-OsWZvJB zzNd&wG?9x-va%KCCDWu+oFbRf_#{~tpI~0Ey4)Js(vcEu?5O4ZECMY&XH8o*f3Who zPFKR^LW_09FU9&~FG1^Auiu!L(&k+GfwD|G3Bwv1}sOIuS ztavA~;7cB^W4ad=A+57A(*fx!u`vm%RCTaKtt%ll2Dby=!WT<91&lUci)f;AVX-Fe zM_rFD7%{S-W>rzF@sO|+q5E2RUhsb7wh@Gha7FkIPq`)lp6L|5{QSrN0{{U3{{R30 P|NjF3K#t)=>VX6Re#3sm diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/config.yaml b/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/config.yaml deleted file mode 100644 index ae3df34..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/config.yaml +++ /dev/null @@ -1,142 +0,0 @@ - -# - Only tested with Phred33 quality scores - -samples: config/samples.tsv - -units: config/units.tsv - - - -############# -### READS ### -############# -trim: - trim: - activate: true - tool: adapterremoval - params: "--trimns --maxns 10 --trimqualities --minlength 30 --mask-degenerate-bases --seed 12345" - - # Ignored for SE - collapse: - activate: true - params: "--collapse-conservatively" - -derep: - extension: - activate: false - k: 16 - params: "ibb=t prefilter=0 el=100 er=100 ecc=f ecco=f ignorebadquality extendrollback=0" - - derep: - activate: true - # vsearch or seqkit - tool: seqkit - params: "" - - low_complex: - params: "entropy=0.7 entropywindow=30 entropyk=4" - - - -############# -### ALIGN ### -############# -prefilter: - taxa: "Bacteria,Archaea,Viruses" - - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: - prok: - n_shards: 2 - path: "data/prok.{n_shard}-of-2.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal -N 1" - bt2l: False - acc2taxid: "data/prok.acc2taxid.gz" - virus: - n_shards: 1 - path: "data/virus.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/virus.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 25 --weight_type 1 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2" - - -euk: - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: - mitoch: - n_shards: 1 - path: "data/mitoch.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/mitoch.acc2taxid.gz" - plastid: - n_shards: 1 - path: "data/plastid.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/plastid.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 15 --sim_score_low 0.95 --weight_type 0 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2 --seed 12345" - - -############ -## REPORT ## -############ -report: - multiqc: "--no-ai --verbose --cl-config 'custom_logo: data/KU_long.png' --cl-config 'custom_logo_title: CAEG - Center for Ancient Environmental Genomics' --cl-config 'custom_logo_url: https://globe.ku.dk/research/caeg/'" - multiqc_db_url: "test_qc.sqlite" diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/samples.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/samples.tsv deleted file mode 100644 index 5994081..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/samples.tsv +++ /dev/null @@ -1,2 +0,0 @@ -sample alias group condition -Lib ancient diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/units.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/units.tsv deleted file mode 100644 index 4a8a376..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/config/config/units.tsv +++ /dev/null @@ -1,4 +0,0 @@ -sample library flowcell lane seq_type library_type material data machine run_n sample_n date center platform adapters -Lib LVsim1 BHXXXXXXXX L001 PE ds DNA data/test_L001_R{Read}.fq.gz SIMULATED 0000 S1 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Lib LVsim1 BHXXXXXXXX L002 PE ds DNA data/test_L002_R{Read}.fq.gz SIMULATED 0000 S2 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Lib LVsim2 BHXXXXXXXX L001 PE ds DNA data/test_L003_R{Read}.fq.gz SIMULATED 0000 S3 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/prefilter_shards/saturated_reads/filter/Lib_LVsim1_collapsed.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/prefilter_shards/saturated_reads/filter/Lib_LVsim1_collapsed.tsv deleted file mode 100644 index 7a48652..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/prefilter_shards/saturated_reads/filter/Lib_LVsim1_collapsed.tsv +++ /dev/null @@ -1 +0,0 @@ -M_T0_RID250_S0_NC_028636.1:14337-14398_length:62_mod0000 diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids b/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids deleted file mode 100644 index ef20c09..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/data/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids +++ /dev/null @@ -1,1299 +0,0 @@ -M_T0_RID0_S0_NC_030117.1:111953-112007_length:55_mod0000 -M_T0_RID0_S0_NZ_JBDYLZ010000006.1:232651-232713_length:63_mod0000 -M_T0_RID0_S0_NZ_JBDYRX010000003.1:638778-638845_length:68_mod0000 -M_T0_RID0_S0_NZ_JBDYSJ010000001.1:480453-480521_length:69_mod0000 -M_T0_RID0_S1_NC_029996.1:52049-52114_length:66_mod0000 -M_T0_RID0_S1_NC_029997.2:98154-98247_length:94_mod0001 -M_T0_RID0_S1_NC_033619.1:5054-5125_length:72_mod0000 -M_T0_RID1_S0_NZ_JBDYLZ010000006.1:89475-89546_length:72_mod0000 -M_T0_RID2_S0_NC_030240.1:124812-124864_length:53_mod0000 -M_T0_RID2_S0_NZ_JBDYLZ010000014.1:79367-79450_length:84_mod0000 -M_T0_RID2_S1_NC_029132.1:78897-78961_length:65_mod0000 -M_T0_RID3_S1_NC_029996.1:125237-125310_length:74_mod0000 -M_T0_RID3_S1_NC_030229.1:666-744_length:79_mod0000 -M_T0_RID4_S0_NZ_JBDYRX010000001.1:960749-960798_length:50_mod0000 -M_T0_RID4_S1_NZ_JBDYSJ010000003.1:80602-80671_length:70_mod0000 -M_T0_RID5_S0_NC_028371.1:3473-3533_length:61_mod0000 -M_T0_RID5_S0_NZ_JBDYLZ010000014.1:31093-31169_length:77_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000003.1:463476-463555_length:80_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000004.1:91279-91382_length:104_mod0000 -M_T0_RID5_S1_NC_031272.1:12737-12796_length:60_mod0000 -M_T0_RID5_S1_NZ_JBDYSJ010000001.1:152930-152976_length:47_mod0000 -M_T0_RID6_S0_NC_018093.1:1833-1947_length:115_mod0000 -M_T0_RID6_S1_NZ_JBDYSJ010000001.1:525478-525555_length:78_mod0000 -M_T0_RID7_S0_NC_027121.1:14835-14908_length:74_mod0000 -M_T0_RID7_S0_NC_030117.1:123232-123357_length:126_mod0000 -M_T0_RID7_S0_NC_033733.1:1775-1866_length:92_mod0000 -M_T0_RID7_S0_NC_033757.1:335-408_length:74_mod0000 -M_T0_RID7_S0_NC_033816.1:2121-2169_length:49_mod0000 -M_T0_RID7_S0_NZ_JBDYRX010000001.1:768041-768147_length:107_mod0000 -M_T0_RID7_S1_NZ_JBDYRX010000003.1:741729-741847_length:119_mod0000 -M_T0_RID8_S0_NC_028255.1:2339-2453_length:115_mod0000 -M_T0_RID8_S0_NC_028362.1:3644-3681_length:38_mod0000 -M_T0_RID8_S0_NC_030295.1:5058-5146_length:89_mod0000 -M_T0_RID8_S0_NZ_JBDYLZ010000011.1:65064-65142_length:79_mod0000 -M_T0_RID8_S1_NC_029996.1:15385-15439_length:55_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000001.1:372140-372170_length:31_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000002.1:184902-185028_length:127_mod0000 -M_T0_RID9_S0_NC_018175.1:751-814_length:64_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000001.1:128705-128756_length:52_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000003.1:717567-717638_length:72_mod0000 -M_T0_RID9_S1_NZ_JBDYRX010000001.1:708791-708875_length:85_mod0001 -M_T0_RID10_S1_NC_034266.1:180760-180821_length:62_mod0000 -M_T0_RID11_S0_NC_027126.1:6629-6712_length:84_mod0000 -M_T0_RID11_S0_NC_027426.1:3579-3717_length:139_mod0000 -M_T0_RID11_S1_NC_030117.1:3968-4065_length:98_mod0000 -M_T0_RID12_S0_NC_027016.1:206020-206105_length:86_mod0000 -M_T0_RID13_S0_NC_027915.1:11194-11270_length:77_mod0000 -M_T0_RID13_S1_NZ_JBDYLZ010000012.1:21748-21797_length:50_mod0000 -M_T0_RID13_S1_NZ_JBDYSJ010000002.1:219548-219618_length:71_mod0000 -M_T0_RID14_S0_NC_033816.1:7896-7995_length:100_mod0000 -M_T0_RID14_S0_NZ_JBDYRX010000001.1:272205-272307_length:103_mod0000 -M_T0_RID14_S0_NZ_JBDYSJ010000001.1:204692-204745_length:54_mod0000 -M_T0_RID14_S1_NC_031321.1:1201-1285_length:85_mod0000 -M_T0_RID14_S1_NC_034217.1:1799-1845_length:47_mod0000 -M_T0_RID15_S0_NZ_JBDYSJ010000001.1:485204-485240_length:37_mod0001 -M_T0_RID15_S1_NC_023442.1:20190-20253_length:64_mod0001 -M_T0_RID15_S1_NC_028259.1:6855-6912_length:58_mod0000 -M_T0_RID15_S1_NZ_JBDYLZ010000014.1:31347-31473_length:127_mod0000 -M_T0_RID16_S0_NC_033718.1:9155-9282_length:128_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000014.1:112132-112219_length:88_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000018.1:30565-30632_length:68_mod0001 -M_T0_RID17_S1_NC_030658.1:888-970_length:83_mod0001 -M_T0_RID17_S1_NC_030873.1:769-848_length:80_mod0000 -M_T0_RID17_S1_NZ_JBDYRX010000004.1:479027-479133_length:107_mod0000 -M_T0_RID17_S1_NZ_JBDYSJ010000002.1:142153-142239_length:87_mod0000 -M_T0_RID18_S0_NC_033830.1:429-498_length:70_mod0000 -M_T0_RID18_S1_NC_027429.1:4469-4544_length:76_mod0000 -M_T0_RID19_S0_NC_028491.1:2563-2618_length:56_mod0000 -M_T0_RID19_S0_NC_031227.1:5693-5751_length:59_mod0000 -M_T0_RID20_S1_NC_029562.1:5000-5036_length:37_mod0000 -M_T0_RID20_S1_NZ_JBDYSJ010000004.1:235888-235979_length:92_mod0000 -M_T0_RID21_S0_NC_028242.1:2691-2737_length:47_mod0000 -M_T0_RID21_S0_NC_029052.1:6412-6494_length:83_mod0000 -M_T0_RID21_S0_NZ_JBDYSJ010000002.1:218541-218623_length:83_mod0000 -M_T0_RID21_S1_NZ_JBDYLZ010000006.1:140228-140329_length:102_mod0000 -M_T0_RID21_S1_NZ_JBDYRX010000001.1:693665-693710_length:46_mod0000 -M_T0_RID22_S0_NC_030402.1:754-835_length:82_mod0000 -M_T0_RID22_S0_NC_034216.1:12941-13048_length:108_mod0000 -M_T0_RID22_S1_NZ_JBDYRX010000001.1:435105-435213_length:109_mod0000 -M_T0_RID23_S0_NC_030701.1:5103-5151_length:49_mod0000 -M_T0_RID23_S0_NC_033762.1:10-98_length:89_mod0000 -M_T0_RID23_S0_NC_037617.1:942-1060_length:119_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000002.1:499806-499888_length:83_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000004.1:201196-201277_length:82_mod0000 -M_T0_RID23_S1_NC_031275.1:7710-7771_length:62_mod0000 -M_T0_RID24_S0_NC_030240.1:57723-57766_length:44_mod0000 -M_T0_RID24_S0_NZ_JBDYLZ010000012.1:969-1002_length:34_mod0000 -M_T0_RID24_S0_NZ_JBDYRX010000001.1:197011-197061_length:51_mod0000 -M_T0_RID24_S1_NC_027121.1:8433-8469_length:37_mod0000 -M_T0_RID24_S1_NZ_JBDYRX010000001.1:668610-668664_length:55_mod0000 -M_T0_RID25_S0_NZ_JBDYSJ010000002.1:6311-6403_length:93_mod0000 -M_T0_RID25_S1_NC_029997.2:85189-85282_length:94_mod0000 -M_T0_RID25_S1_NC_034384.1:2318-2377_length:60_mod0000 -M_T0_RID25_S1_NZ_JBDYRX010000002.1:614807-614869_length:63_mod0000 -M_T0_RID25_S1_NZ_JBDYSJ010000004.1:88035-88153_length:119_mod0000 -M_T0_RID26_S0_NC_028491.1:86460-86530_length:71_mod0000 -M_T0_RID26_S0_NZ_JBDYSJ010000003.1:64065-64167_length:103_mod0000 -M_T0_RID26_S1_NZ_JBDYSJ010000002.1:180789-180849_length:61_mod0001 -M_T0_RID27_S0_NZ_JBDYRX010000002.1:879317-879417_length:101_mod0001 -M_T0_RID27_S0_NZ_JBDYSJ010000002.1:371147-371261_length:115_mod0000 -M_T0_RID27_S1_NC_024911.1:1404-1530_length:127_mod0000 -M_T0_RID27_S1_NC_034266.1:112117-112169_length:53_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000003.1:302019-302061_length:43_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000004.1:327071-327150_length:80_mod0001 -M_T0_RID28_S0_NC_027812.1:1778-1877_length:100_mod0000 -M_T0_RID28_S0_NC_028833.1:23931-24017_length:87_mod0000 -M_T0_RID28_S0_NC_034159.1:870-906_length:37_mod0000 -M_T0_RID28_S0_NZ_JBDYSJ010000003.1:260828-260864_length:37_mod0000 -M_T0_RID29_S0_NC_027137.1:5905-5940_length:36_mod0000 -M_T0_RID29_S0_NC_027208.1:2702-2783_length:82_mod0000 -M_T0_RID29_S0_NC_029996.1:60558-60653_length:96_mod0000 -M_T0_RID29_S0_NC_033722.1:167-248_length:82_mod0000 -M_T0_RID30_S0_NC_017977.1:8983-9015_length:33_mod0000 -M_T0_RID30_S0_NC_034219.1:4140-4199_length:60_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000001.1:753768-753819_length:52_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000002.1:441798-441831_length:34_mod0000 -M_T0_RID30_S0_NZ_JBDYSJ010000001.1:878513-878614_length:102_mod0000 -M_T0_RID30_S1_NC_028492.1:144-210_length:67_mod0000 -M_T0_RID30_S1_NZ_JBDYRX010000004.1:168829-168933_length:105_mod0000 -M_T0_RID30_S1_NZ_JBDYSJ010000002.1:584020-584104_length:85_mod0000 -M_T0_RID31_S0_NZ_JBDYSJ010000002.1:273852-273897_length:46_mod0000 -M_T0_RID31_S1_NC_031450.1:2281-2311_length:31_mod0000 -M_T0_RID31_S1_NZ_JBDYSJ010000002.1:454313-454400_length:88_mod0000 -M_T0_RID32_S0_NC_023442.1:31719-31785_length:67_mod0000 -M_T0_RID32_S1_NC_028133.1:1439-1562_length:124_mod0000 -M_T0_RID32_S1_NZ_JBDYSJ010000002.1:412312-412351_length:40_mod0000 -M_T0_RID33_S1_NC_034266.1:78437-78516_length:80_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000001.1:102672-102747_length:76_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000002.1:784464-784511_length:48_mod0000 -M_T0_RID33_S1_NZ_JBDYSJ010000003.1:324967-325032_length:66_mod0000 -M_T0_RID34_S0_NC_018457.1:737-780_length:44_mod0000 -M_T0_RID34_S0_NC_028253.1:2464-2519_length:56_mod0000 -M_T0_RID34_S0_NZ_JBDYRX010000003.1:19821-19946_length:126_mod0000 -M_T0_RID34_S1_NC_029255.1:103099-103196_length:98_mod0000 -M_T0_RID34_S1_NZ_JBDYRX010000001.1:214312-214398_length:87_mod0001 -M_T0_RID35_S0_NZ_JBDYRX010000001.1:286577-286647_length:71_mod0000 -M_T0_RID35_S0_NZ_JBDYRX010000002.1:303458-303514_length:57_mod0000 -M_T0_RID35_S1_NC_028374.1:16776-16870_length:95_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:363132-363178_length:47_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:829523-829581_length:59_mod0000 -M_T0_RID36_S0_NC_029311.1:99001-99097_length:97_mod0000 -M_T0_RID37_S0_NC_033620.1:94230-94306_length:77_mod0000 -M_T0_RID37_S0_NZ_JBDYLZ010000012.1:26095-26141_length:47_mod0000 -M_T0_RID37_S1_NC_029311.1:32048-32093_length:46_mod0000 -M_T0_RID37_S1_NZ_JBDYSJ010000001.1:902396-902441_length:46_mod0000 -M_T0_RID38_S0_NC_030691.1:6883-6932_length:50_mod0000 -M_T0_RID38_S1_NZ_JBDYRX010000004.1:200501-200575_length:75_mod0000 -M_T0_RID39_S1_NC_028136.1:1274-1340_length:67_mod0000 -M_T0_RID39_S1_NZ_JBDYSJ010000002.1:503066-503117_length:52_mod0000 -M_T0_RID40_S0_NC_030234.1:4344-4414_length:71_mod0000 -M_T0_RID41_S0_NC_031088.1:9201-9299_length:99_mod0000 -M_T0_RID41_S0_NZ_JBDYLZ010000009.1:31815-31852_length:38_mod0000 -M_T0_RID41_S1_NC_028244.1:5988-6042_length:55_mod0000 -M_T0_RID41_S1_NZ_JBDYLZ010000006.1:65238-65362_length:125_mod0000 -M_T0_RID41_S1_NZ_JBDYRX010000003.1:765215-765280_length:66_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:32817-32939_length:123_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:462782-462843_length:62_mod0000 -M_T0_RID43_S0_NZ_JBDYLZ010000008.1:49878-49973_length:96_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000001.1:889979-890062_length:84_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000004.1:406662-406696_length:35_mod0000 -M_T0_RID44_S1_NZ_JBDYLZ010000006.1:90744-90777_length:34_mod0000 -M_T0_RID45_S0_NC_027712.1:10734-10821_length:88_mod0000 -M_T0_RID45_S0_NC_029311.1:44548-44620_length:73_mod0000 -M_T0_RID45_S0_NC_030693.1:5273-5361_length:89_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000008.1:40421-40495_length:75_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000009.1:55082-55112_length:31_mod0000 -M_T0_RID45_S1_NC_028232.1:6596-6658_length:63_mod0000 -M_T0_RID46_S0_NZ_JBDYSJ010000003.1:168383-168513_length:131_mod0000 -M_T0_RID47_S0_NC_029932.1:1175-1250_length:76_mod0000 -M_T0_RID47_S1_NC_027633.1:3344-3412_length:69_mod0000 -M_T0_RID48_S0_NC_018174.1:5223-5261_length:39_mod0000 -M_T0_RID48_S0_NC_023443.1:462-562_length:101_mod0000 -M_T0_RID48_S0_NZ_JBDYRX010000002.1:697197-697270_length:74_mod0000 -M_T0_RID49_S0_NC_029309.1:6196-6271_length:76_mod0000 -M_T0_RID49_S0_NZ_JBDYRX010000002.1:627468-627514_length:47_mod0000 -M_T0_RID49_S1_NC_028375.1:6864-6975_length:112_mod0000 -M_T0_RID50_S0_NC_027634.1:1642-1737_length:96_mod0000 -M_T0_RID50_S0_NC_030117.1:58855-58929_length:75_mod0000 -M_T0_RID50_S0_NC_030397.1:2093-2139_length:47_mod0001 -M_T0_RID50_S0_NZ_JBDYRX010000002.1:579910-579949_length:40_mod0000 -M_T0_RID50_S1_NC_028099.1:106360-106431_length:72_mod0000 -M_T0_RID50_S1_NZ_JBDYLZ010000012.1:83521-83604_length:84_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:803598-803655_length:58_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:945690-945779_length:90_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000006.1:184353-184397_length:45_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000018.1:32304-32360_length:57_mod0000 -M_T0_RID51_S1_NZ_JBDYRX010000001.1:868994-869082_length:89_mod0000 -M_T0_RID51_S1_NZ_JBDYSJ010000003.1:168788-168850_length:63_mod0000 -M_T0_RID52_S0_NZ_JBDYRX010000002.1:889544-889674_length:131_mod0000 -M_T0_RID52_S1_NC_030801.1:2462-2542_length:81_mod0000 -M_T0_RID53_S0_NC_029053.1:3050-3132_length:83_mod0000 -M_T0_RID53_S0_NC_033792.1:955-1008_length:54_mod0000 -M_T0_RID53_S0_NZ_JBDYRX010000003.1:127692-127758_length:67_mod0000 -M_T0_RID53_S1_NC_027533.1:2013-2051_length:39_mod0000 -M_T0_RID53_S1_NC_031307.1:5253-5307_length:55_mod0000 -M_T0_RID54_S0_NC_031079.1:45-96_length:52_mod0000 -M_T0_RID54_S1_NC_027712.1:6686-6777_length:92_mod0000 -M_T0_RID54_S1_NC_029996.1:22662-22724_length:63_mod0000 -M_T0_RID55_S0_NC_030141.1:2102-2247_length:146_mod0000 -M_T0_RID55_S0_NC_031304.1:2692-2762_length:71_mod0000 -M_T0_RID55_S0_NC_033704.1:4049-4166_length:118_mod0000 -M_T0_RID55_S0_NZ_JBDYRX010000001.1:247013-247049_length:37_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:448811-448874_length:64_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:513869-513936_length:68_mod0000 -M_T0_RID56_S0_NC_027016.1:52570-52626_length:57_mod0000 -M_T0_RID56_S0_NC_031449.1:9465-9556_length:92_mod0000 -M_T0_RID56_S0_NZ_JBDYLZ010000007.1:245259-245319_length:61_mod0001 -M_T0_RID56_S1_NZ_JBDYLZ010000007.1:103507-103590_length:84_mod0000 -M_T0_RID57_S0_NC_018070.1:8325-8447_length:123_mod0000 -M_T0_RID57_S0_NC_027426.1:3804-3851_length:48_mod0000 -M_T0_RID57_S1_NC_028099.1:83564-83601_length:38_mod0000 -M_T0_RID58_S0_NC_027121.1:14888-14980_length:93_mod0000 -M_T0_RID58_S0_NC_029550.1:232-272_length:41_mod0000 -M_T0_RID58_S1_NZ_JBDYLZ010000015.1:60370-60453_length:84_mod0000 -M_T0_RID59_S0_NZ_JBDYLZ010000011.1:108912-108996_length:85_mod0000 -M_T0_RID59_S0_NZ_JBDYRX010000004.1:15220-15308_length:89_mod0000 -M_T0_RID60_S1_NC_027641.1:1140-1184_length:45_mod0000 -M_T0_RID60_S1_NC_029085.1:8080-8154_length:75_mod0001 -M_T0_RID60_S1_NZ_JBDYRX010000001.1:262196-262266_length:71_mod0000 -M_T0_RID60_S1_NZ_JBDYSJ010000002.1:87924-88000_length:77_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:191465-191498_length:34_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:569149-569214_length:66_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000003.1:457685-457761_length:77_mod0000 -M_T0_RID62_S0_NC_023303.1:251-301_length:51_mod0000 -M_T0_RID62_S0_NZ_JBDYRX010000001.1:304278-304333_length:56_mod0000 -M_T0_RID62_S1_NC_023427.1:835-900_length:66_mod0000 -M_T0_RID62_S1_NC_027016.1:54356-54406_length:51_mod0000 -M_T0_RID62_S1_NC_028133.1:2961-2996_length:36_mod0000 -M_T0_RID62_S1_NC_031083.1:3710-3834_length:125_mod0000 -M_T0_RID62_S1_NC_031463.1:8948-8994_length:47_mod0000 -M_T0_RID62_S1_NZ_JBDYRX010000003.1:182597-182668_length:72_mod0001 -M_T0_RID62_S1_NZ_JBDYSJ010000001.1:192588-192667_length:80_mod0001 -M_T0_RID63_S0_NC_028144.1:6011-6113_length:103_mod0000 -M_T0_RID63_S0_NC_030240.1:102727-102785_length:59_mod0000 -M_T0_RID63_S0_NC_033760.1:1443-1573_length:131_mod0000 -M_T0_RID63_S0_NZ_JBDYLZ010000020.1:7118-7208_length:91_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000002.1:745773-745875_length:103_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000003.1:142067-142124_length:58_mod0000 -M_T0_RID63_S0_NZ_JBDYSJ010000003.1:151524-151569_length:46_mod0000 -M_T0_RID63_S1_NC_031236.1:11052-11140_length:89_mod0001 -M_T0_RID64_S0_NC_030748.1:1054-1124_length:71_mod0000 -M_T0_RID64_S1_NC_031093.1:6116-6176_length:61_mod0000 -M_T0_RID66_S0_NZ_JBDYLZ010000015.1:96499-96580_length:82_mod0000 -M_T0_RID66_S0_NZ_JBDYSJ010000002.1:346193-346225_length:33_mod0000 -M_T0_RID66_S1_NC_031305.1:4622-4714_length:93_mod0000 -M_T0_RID66_S1_NZ_JBDYRX010000002.1:340389-340472_length:84_mod0000 -M_T0_RID67_S0_NC_028134.1:42-92_length:51_mod0000 -M_T0_RID67_S0_NC_030447.1:1980-2070_length:91_mod0000 -M_T0_RID67_S0_NZ_JBDYRX010000004.1:332043-332120_length:78_mod0000 -M_T0_RID67_S0_NZ_JBDYSJ010000003.1:241049-241147_length:99_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000001.1:247375-247406_length:32_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000002.1:355091-355166_length:76_mod0000 -M_T0_RID68_S1_NC_034266.1:8834-8941_length:108_mod0000 -M_T0_RID68_S1_NZ_JBDYLZ010000016.1:69565-69646_length:82_mod0000 -M_T0_RID69_S0_NC_028368.1:19515-19575_length:61_mod0000 -M_T0_RID69_S0_NC_034266.1:30444-30515_length:72_mod0000 -M_T0_RID69_S0_NZ_JBDYLZ010000013.1:100003-100090_length:88_mod0000 -M_T0_RID69_S1_NZ_JBDYLZ010000016.1:63861-63942_length:82_mod0000 -M_T0_RID70_S0_NC_018404.1:2315-2374_length:60_mod0000 -M_T0_RID70_S1_NC_027713.1:293-401_length:109_mod0000 -M_T0_RID70_S1_NC_033830.1:3068-3146_length:79_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000007.1:118774-118860_length:87_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000016.1:66813-66865_length:53_mod0000 -M_T0_RID71_S0_NC_033620.1:14671-14724_length:54_mod0000 -M_T0_RID71_S1_NC_029562.1:2435-2497_length:63_mod0000 -M_T0_RID72_S0_NC_033716.1:7859-7951_length:93_mod0000 -M_T0_RID72_S1_NC_030117.1:83819-83856_length:38_mod0000 -M_T0_RID72_S1_NZ_JBDYLZ010000008.1:123604-123689_length:86_mod0000 -M_T0_RID73_S0_NC_030115.1:6022-6140_length:119_mod0000 -M_T0_RID73_S0_NC_030229.1:2674-2768_length:95_mod0000 -M_T0_RID73_S0_NC_033733.1:4354-4441_length:88_mod0001 -M_T0_RID74_S0_NC_031093.1:8592-8666_length:75_mod0000 -M_T0_RID74_S0_NZ_JBDYSJ010000002.1:362489-362559_length:71_mod0000 -M_T0_RID74_S1_NC_029302.1:212-295_length:84_mod0000 -M_T0_RID75_S0_NZ_JBDYRX010000001.1:235615-235682_length:68_mod0000 -M_T0_RID75_S1_NC_030235.1:6658-6691_length:34_mod0000 -M_T0_RID75_S1_NZ_JBDYLZ010000022.1:8709-8767_length:59_mod0000 -M_T0_RID75_S1_NZ_JBDYRX010000003.1:478660-478720_length:61_mod0000 -M_T0_RID76_S0_NC_018070.1:8778-8882_length:105_mod0000 -M_T0_RID76_S0_NC_029255.1:61305-61383_length:79_mod0000 -M_T0_RID76_S1_NC_027428.1:2290-2358_length:69_mod0000 -M_T0_RID76_S1_NC_030200.1:88040-88083_length:44_mod0000 -M_T0_RID76_S1_NC_033720.1:158-194_length:37_mod0000 -M_T0_RID77_S1_NC_033730.1:7657-7785_length:129_mod0000 -M_T0_RID78_S0_NC_023442.1:36825-36879_length:55_mod0000 -M_T0_RID78_S0_NC_027016.1:111926-112014_length:89_mod0000 -M_T0_RID78_S0_NZ_JBDYRX010000003.1:310444-310522_length:79_mod0000 -M_T0_RID78_S1_NC_030871.1:4415-4481_length:67_mod0000 -M_T0_RID78_S1_NC_031220.1:5976-6009_length:34_mod0000 -M_T0_RID79_S0_NC_029997.2:83992-84041_length:50_mod0000 -M_T0_RID79_S0_NC_030240.1:97988-98049_length:62_mod0000 -M_T0_RID79_S1_NC_033792.1:2479-2556_length:78_mod0000 -M_T0_RID79_S1_NZ_JBDYRX010000003.1:341785-341851_length:67_mod0001 -M_T0_RID80_S1_NZ_JBDYLZ010000010.1:13735-13769_length:35_mod0000 -M_T0_RID80_S1_NZ_JBDYSJ010000001.1:511944-512037_length:94_mod0000 -M_T0_RID81_S1_NC_027923.1:15413-15450_length:38_mod0000 -M_T0_RID82_S0_NC_027916.2:67438-67522_length:85_mod0001 -M_T0_RID82_S0_NC_028398.1:2368-2442_length:75_mod0000 -M_T0_RID82_S0_NC_033779.1:2219-2288_length:70_mod0000 -M_T0_RID82_S0_NZ_JBDYLZ010000016.1:9019-9115_length:97_mod0000 -M_T0_RID82_S0_NZ_JBDYRX010000001.1:261558-261662_length:105_mod0001 -M_T0_RID82_S1_NC_027016.1:72621-72680_length:60_mod0000 -M_T0_RID82_S1_NC_027535.1:2160-2253_length:94_mod0000 -M_T0_RID83_S1_NC_030159.1:273-312_length:40_mod0000 -M_T0_RID83_S1_NZ_JBDYLZ010000007.1:155539-155585_length:47_mod0000 -M_T0_RID83_S1_NZ_JBDYRX010000002.1:263346-263422_length:77_mod0000 -M_T0_RID84_S0_NZ_JBDYRX010000003.1:240685-240765_length:81_mod0000 -M_T0_RID84_S1_NZ_JBDYRX010000003.1:51637-51745_length:109_mod0000 -M_T0_RID85_S0_NZ_JBDYRX010000002.1:107354-107402_length:49_mod0000 -M_T0_RID85_S1_NC_023297.1:177-263_length:87_mod0000 -M_T0_RID85_S1_NC_030201.1:3764-3811_length:48_mod0000 -M_T0_RID85_S1_NZ_JBDYRX010000002.1:35225-35277_length:53_mod0000 -M_T0_RID86_S1_NC_028137.1:1830-1905_length:76_mod0000 -M_T0_RID86_S1_NC_033828.1:2664-2773_length:110_mod0000 -M_T0_RID86_S1_NZ_JBDYSJ010000001.1:383616-383681_length:66_mod0000 -M_T0_RID87_S0_NC_027631.1:5088-5147_length:60_mod0000 -M_T0_RID87_S0_NZ_JBDYLZ010000008.1:117199-117277_length:79_mod0000 -M_T0_RID87_S1_NZ_JBDYRX010000002.1:176453-176540_length:88_mod0000 -M_T0_RID89_S0_NC_028814.1:25832-25905_length:74_mod0000 -M_T0_RID89_S0_NZ_JBDYLZ010000010.1:109306-109408_length:103_mod0000 -M_T0_RID89_S1_NC_029064.1:9889-9971_length:83_mod0000 -M_T0_RID91_S0_NC_029997.2:19677-19742_length:66_mod0000 -M_T0_RID91_S0_NZ_JBDYSJ010000002.1:541980-542048_length:69_mod0001 -M_T0_RID91_S1_NC_028636.1:131522-131574_length:53_mod0000 -M_T0_RID91_S1_NZ_JBDYLZ010000015.1:73113-73211_length:99_mod0000 -M_T0_RID91_S1_NZ_JBDYRX010000002.1:531098-531224_length:127_mod0000 -M_T0_RID91_S1_NZ_JBDYSJ010000001.1:75425-75512_length:88_mod0000 -M_T0_RID92_S0_NC_033847.1:907-971_length:65_mod0001 -M_T0_RID92_S0_NZ_JBDYRX010000001.1:204153-204204_length:52_mod0000 -M_T0_RID93_S0_NC_029131.1:6029-6095_length:67_mod0000 -M_T0_RID93_S1_NZ_JBDYRX010000002.1:30248-30359_length:112_mod0000 -M_T0_RID94_S0_NC_028142.1:627-700_length:74_mod0000 -M_T0_RID94_S0_NC_033702.1:1317-1400_length:84_mod0000 -M_T0_RID94_S0_NC_033717.1:1284-1386_length:103_mod0000 -M_T0_RID95_S0_NC_018072.1:2591-2635_length:45_mod0000 -M_T0_RID95_S0_NC_027136.1:2231-2280_length:50_mod0000 -M_T0_RID95_S0_NC_029996.1:90789-90865_length:77_mod0000 -M_T0_RID95_S0_NZ_JBDYRX010000002.1:319590-319635_length:46_mod0000 -M_T0_RID95_S1_NC_033620.1:5347-5437_length:91_mod0000 -M_T0_RID96_S0_NC_028636.1:10556-10617_length:62_mod0000 -M_T0_RID96_S1_NC_028143.1:314-390_length:77_mod0000 -M_T0_RID97_S1_NZ_JBDYRX010000001.1:866338-866401_length:64_mod0001 -M_T0_RID97_S1_NZ_JBDYRX010000003.1:178272-178304_length:33_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000013.1:5680-5725_length:46_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000028.1:866-932_length:67_mod0000 -M_T0_RID98_S1_NC_029996.1:10631-10716_length:86_mod0000 -M_T0_RID99_S0_NC_030838.1:2068-2122_length:55_mod0000 -M_T0_RID99_S0_NC_031248.1:3321-3367_length:47_mod0000 -M_T0_RID99_S1_NC_027916.2:30126-30210_length:85_mod0000 -M_T0_RID99_S1_NC_030240.1:40035-40122_length:88_mod0000 -M_T0_RID99_S1_NC_031336.1:14128-14251_length:124_mod0001 -M_T0_RID99_S1_NZ_JBDYSJ010000001.1:396202-396267_length:66_mod0000 -M_T0_RID100_S0_NC_028376.1:14572-14682_length:111_mod0000 -M_T0_RID100_S0_NC_030697.1:970-1055_length:86_mod0000 -M_T0_RID100_S0_NZ_JBDYRX010000002.1:758402-758505_length:104_mod0000 -M_T0_RID101_S0_NZ_JBDYSJ010000001.1:645109-645147_length:39_mod0000 -M_T0_RID102_S0_NC_029255.1:63250-63323_length:74_mod0000 -M_T0_RID102_S0_NZ_JBDYSJ010000001.1:237444-237513_length:70_mod0000 -M_T0_RID103_S0_NC_028476.1:713-824_length:112_mod0000 -M_T0_RID103_S1_NC_031314.1:1276-1385_length:110_mod0000 -M_T0_RID103_S1_NC_031463.1:18479-18581_length:103_mod0000 -M_T0_RID103_S1_NZ_JBDYRX010000003.1:535271-535363_length:93_mod0000 -M_T0_RID105_S0_NC_030118.1:8503-8572_length:70_mod0000 -M_T0_RID105_S1_NC_027712.1:9939-9971_length:33_mod0000 -M_T0_RID105_S1_NC_030472.1:4177-4227_length:51_mod0000 -M_T0_RID106_S1_NC_028382.1:483-531_length:49_mod0000 -M_T0_RID106_S1_NZ_JBDYLZ010000017.1:12627-12692_length:66_mod0000 -M_T0_RID106_S1_NZ_JBDYRX010000001.1:885175-885267_length:93_mod0000 -M_T0_RID106_S1_NZ_JBDYSJ010000001.1:754603-754673_length:71_mod0000 -M_T0_RID107_S0_NZ_JBDYRX010000002.1:887203-887264_length:62_mod0000 -M_T0_RID107_S1_NC_027016.1:87956-88044_length:89_mod0000 -M_T0_RID107_S1_NC_028478.1:299-392_length:94_mod0000 -M_T0_RID107_S1_NZ_JBDYRX010000003.1:166903-166964_length:62_mod0001 -M_T0_RID107_S1_NZ_JBDYSJ010000001.1:252763-252845_length:83_mod0000 -M_T0_RID108_S1_NC_033767.1:689-744_length:56_mod0000 -M_T0_RID108_S1_NZ_JBDYSJ010000003.1:468268-468339_length:72_mod0000 -M_T0_RID109_S0_NZ_JBDYRX010000001.1:988451-988536_length:86_mod0000 -M_T0_RID110_S1_NC_028099.1:36637-36726_length:90_mod0000 -M_T0_RID110_S1_NZ_JBDYLZ010000015.1:71842-71908_length:67_mod0000 -M_T0_RID111_S0_NC_030232.1:3068-3100_length:33_mod0000 -M_T0_RID111_S0_NZ_JBDYRX010000002.1:284375-284457_length:83_mod0000 -M_T0_RID111_S1_NC_028491.1:22651-22727_length:77_mod0000 -M_T0_RID112_S1_NZ_JBDYRX010000004.1:227206-227261_length:56_mod0000 -M_T0_RID112_S1_NZ_JBDYSJ010000003.1:186720-186750_length:31_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000008.1:103905-103950_length:46_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000017.1:43421-43530_length:110_mod0000 -M_T0_RID114_S0_NZ_JBDYSJ010000001.1:888974-889061_length:88_mod0000 -M_T0_RID114_S1_NC_028485.1:4265-4351_length:87_mod0000 -M_T0_RID114_S1_NC_030654.1:5564-5612_length:49_mod0000 -M_T0_RID114_S1_NC_033763.1:670-745_length:76_mod0000 -M_T0_RID114_S1_NZ_JBDYSJ010000001.1:20373-20432_length:60_mod0000 -M_T0_RID115_S0_NC_033781.1:4795-4906_length:112_mod0000 -M_T0_RID115_S1_NC_031236.1:618-674_length:57_mod0000 -M_T0_RID116_S0_NC_028833.1:24900-24930_length:31_mod0000 -M_T0_RID116_S0_NZ_JBDYSJ010000001.1:278209-278280_length:72_mod0000 -M_T0_RID117_S0_NC_028491.1:76819-76945_length:127_mod0000 -M_T0_RID117_S0_NC_028636.1:51360-51406_length:47_mod0000 -M_T0_RID117_S0_NZ_JBDYRX010000002.1:695385-695511_length:127_mod0000 -M_T0_RID117_S0_NZ_JBDYSJ010000004.1:214232-214301_length:70_mod0000 -M_T0_RID117_S1_NZ_JBDYSJ010000001.1:254125-254189_length:65_mod0000 -M_T0_RID118_S1_NC_017967.1:3728-3792_length:65_mod0000 -M_T0_RID118_S1_NZ_JBDYLZ010000012.1:104385-104434_length:50_mod0000 -M_T0_RID118_S1_NZ_JBDYRX010000003.1:569089-569158_length:70_mod0000 -M_T0_RID119_S0_NC_027138.1:1980-2027_length:48_mod0000 -M_T0_RID119_S0_NZ_JBDYRX010000001.1:479636-479698_length:63_mod0000 -M_T0_RID119_S1_NC_030750.1:2333-2363_length:31_mod0000 -M_T0_RID120_S0_NZ_JBDYRX010000004.1:143311-143407_length:97_mod0000 -M_T0_RID120_S0_NZ_JBDYSJ010000002.1:211897-211962_length:66_mod0000 -M_T0_RID120_S1_NC_029255.1:99346-99425_length:80_mod0000 -M_T0_RID120_S1_NZ_JBDYLZ010000008.1:182987-183039_length:53_mod0000 -M_T0_RID121_S1_NZ_JBDYRX010000003.1:22645-22773_length:129_mod0000 -M_T0_RID122_S0_NZ_JBDYSJ010000002.1:28060-28162_length:103_mod0000 -M_T0_RID122_S1_NZ_JBDYRX010000002.1:593335-593394_length:60_mod0000 -M_T0_RID123_S1_NC_029932.1:780-841_length:62_mod0000 -M_T0_RID123_S1_NZ_JBDYRX010000002.1:624572-624628_length:57_mod0000 -M_T0_RID123_S1_NZ_JBDYSJ010000003.1:205052-205133_length:82_mod0000 -M_T0_RID124_S0_NC_018105.1:1032-1078_length:47_mod0000 -M_T0_RID124_S0_NC_027016.1:37306-37377_length:72_mod0000 -M_T0_RID124_S0_NC_027430.1:2075-2124_length:50_mod0000 -M_T0_RID124_S0_NC_033751.1:1175-1283_length:109_mod0000 -M_T0_RID124_S0_NZ_JBDYLZ010000012.1:107683-107735_length:53_mod0000 -M_T0_RID124_S1_NC_029783.1:12839-12935_length:97_mod0000 -M_T0_RID125_S1_NC_024911.1:585-717_length:133_mod0000 -M_T0_RID125_S1_NZ_JBDYRX010000002.1:524061-524121_length:61_mod0000 -M_T0_RID126_S0_NZ_JBDYSJ010000003.1:204369-204435_length:67_mod0000 -M_T0_RID126_S1_NC_027136.1:6692-6786_length:95_mod0000 -M_T0_RID126_S1_NZ_JBDYLZ010000007.1:147969-148026_length:58_mod0000 -M_T0_RID126_S1_NZ_JBDYSJ010000001.1:849768-849826_length:59_mod0000 -M_T0_RID127_S0_NZ_JBDYLZ010000019.1:20624-20673_length:50_mod0000 -M_T0_RID127_S1_NC_033619.1:4029-4155_length:127_mod0000 -M_T0_RID127_S1_NZ_JBDYRX010000004.1:112527-112563_length:37_mod0000 -M_T0_RID128_S0_NC_033620.1:26172-26261_length:90_mod0000 -M_T0_RID128_S0_NZ_JBDYSJ010000001.1:127550-127596_length:47_mod0000 -M_T0_RID128_S1_NZ_JBDYLZ010000010.1:81225-81326_length:102_mod0000 -M_T0_RID129_S0_NC_028372.1:12347-12414_length:68_mod0001 -M_T0_RID129_S0_NC_030844.1:4967-5083_length:117_mod0001 -M_T0_RID129_S1_NZ_JBDYSJ010000001.1:451837-451880_length:44_mod0000 -M_T0_RID130_S0_NZ_JBDYSJ010000001.1:904477-904569_length:93_mod0000 -M_T0_RID130_S1_NC_030400.1:8920-8964_length:45_mod0000 -M_T0_RID131_S0_NC_030200.1:24540-24653_length:114_mod0000 -M_T0_RID131_S0_NZ_JBDYRX010000004.1:307376-307435_length:60_mod0001 -M_T0_RID131_S1_NZ_JBDYRX010000002.1:215925-215981_length:57_mod0000 -M_T0_RID132_S0_NC_029132.1:26524-26609_length:86_mod0000 -M_T0_RID132_S0_NZ_JBDYRX010000002.1:856095-856160_length:66_mod0000 -M_T0_RID132_S1_NC_028099.1:70003-70100_length:98_mod0000 -M_T0_RID132_S1_NC_028636.1:77454-77493_length:40_mod0000 -M_T0_RID133_S0_NC_027210.1:8798-8910_length:113_mod0000 -M_T0_RID133_S1_NZ_JBDYLZ010000014.1:82781-82835_length:55_mod0000 -M_T0_RID134_S0_NC_034266.1:203255-203287_length:33_mod0000 -M_T0_RID134_S1_NC_033705.1:7105-7262_length:158_mod0000 -M_T0_RID135_S0_NC_033733.1:6746-6806_length:61_mod0000 -M_T0_RID135_S1_NZ_JBDYSJ010000004.1:255279-255341_length:63_mod0000 -M_T0_RID136_S0_NZ_JBDYSJ010000001.1:562721-562768_length:48_mod0000 -M_T0_RID136_S1_NC_030200.1:80911-80976_length:66_mod0001 -M_T0_RID136_S1_NZ_JBDYLZ010000009.1:44314-44384_length:71_mod0000 -M_T0_RID136_S1_NZ_JBDYLZ010000018.1:9886-9961_length:76_mod0000 -M_T0_RID136_S1_NZ_JBDYRX010000001.1:825042-825123_length:82_mod0000 -M_T0_RID137_S0_NC_031083.1:11357-11420_length:64_mod0000 -M_T0_RID137_S0_NZ_JBDYSJ010000002.1:311215-311270_length:56_mod0000 -M_T0_RID137_S1_NC_034266.1:15288-15392_length:105_mod0000 -M_T0_RID137_S1_NZ_JBDYSJ010000002.1:109720-109762_length:43_mod0000 -M_T0_RID138_S0_NC_033730.1:4735-4793_length:59_mod0000 -M_T0_RID139_S0_NC_029076.1:5391-5472_length:82_mod0000 -M_T0_RID139_S0_NC_029131.1:3428-3518_length:91_mod0000 -M_T0_RID139_S1_NC_027128.1:7467-7524_length:58_mod0000 -M_T0_RID139_S1_NC_033730.1:8262-8350_length:89_mod0000 -M_T0_RID140_S0_NC_031216.1:8965-9047_length:83_mod0000 -M_T0_RID140_S1_NC_029996.1:128484-128577_length:94_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000007.1:238838-238873_length:36_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000015.1:16859-16896_length:38_mod0000 -M_T0_RID142_S0_NC_027916.2:139729-139809_length:81_mod0001 -M_T0_RID142_S0_NC_030873.1:562-633_length:72_mod0000 -M_T0_RID142_S0_NZ_JBDYSJ010000003.1:9947-10048_length:102_mod0001 -M_T0_RID144_S0_NC_030200.1:1026-1085_length:60_mod0001 -M_T0_RID144_S0_NZ_JBDYRX010000002.1:297802-297909_length:108_mod0000 -M_T0_RID145_S0_NZ_JBDYSJ010000001.1:690815-690908_length:94_mod0000 -M_T0_RID146_S0_NC_028636.1:8587-8640_length:54_mod0000 -M_T0_RID147_S0_NC_030839.1:401-442_length:42_mod0000 -M_T0_RID147_S1_NZ_JBDYRX010000002.1:330619-330694_length:76_mod0000 -M_T0_RID148_S1_NZ_JBDYRX010000002.1:14264-14309_length:46_mod0000 -M_T0_RID149_S0_NZ_JBDYSJ010000001.1:617340-617447_length:108_mod0000 -M_T0_RID149_S1_NC_028249.1:10239-10323_length:85_mod0000 -M_T0_RID149_S1_NZ_JBDYLZ010000008.1:120921-120959_length:39_mod0000 -M_T0_RID150_S1_NZ_JBDYRX010000004.1:384747-384794_length:48_mod0000 -M_T0_RID152_S1_NZ_JBDYRX010000004.1:353714-353802_length:89_mod0000 -M_T0_RID153_S0_NZ_JBDYRX010000003.1:52603-52715_length:113_mod0000 -M_T0_RID153_S1_NC_028364.1:137-249_length:113_mod0000 -M_T0_RID154_S0_NZ_JBDYRX010000003.1:602237-602274_length:38_mod0000 -M_T0_RID154_S1_NC_028386.1:1116-1181_length:66_mod0000 -M_T0_RID154_S1_NC_033620.1:12644-12716_length:73_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000002.1:675599-675679_length:81_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000003.1:514528-514581_length:54_mod0000 -M_T0_RID155_S0_NC_033701.1:9275-9317_length:43_mod0000 -M_T0_RID156_S1_NC_023295.1:2064-2141_length:78_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000006.1:281471-281567_length:97_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000011.1:132268-132312_length:45_mod0000 -M_T0_RID158_S1_NC_028241.1:531-607_length:77_mod0000 -M_T0_RID159_S0_NC_029311.1:69011-69045_length:35_mod0000 -M_T0_RID159_S0_NC_031216.1:6290-6405_length:116_mod0000 -M_T0_RID159_S0_NC_033620.1:32537-32621_length:85_mod0000 -M_T0_RID159_S0_NZ_JBDYSJ010000002.1:600959-600995_length:37_mod0000 -M_T0_RID161_S1_NC_030240.1:83741-83790_length:50_mod0000 -M_T0_RID162_S0_NZ_JBDYLZ010000008.1:5183-5216_length:34_mod0000 -M_T0_RID162_S1_NC_017862.1:7381-7452_length:72_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:584559-584609_length:51_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:726659-726738_length:80_mod0000 -M_T0_RID163_S0_NC_033620.1:156883-156969_length:87_mod0000 -M_T0_RID163_S1_NC_030275.1:100083-100169_length:87_mod0000 -M_T0_RID164_S0_NZ_JBDYLZ010000018.1:17968-18030_length:63_mod0000 -M_T0_RID164_S1_NC_033620.1:130668-130713_length:46_mod0000 -M_T0_RID164_S1_NZ_JBDYRX010000004.1:519479-519563_length:85_mod0000 -M_T0_RID165_S0_NC_027917.1:1959-2051_length:93_mod0000 -M_T0_RID166_S0_NZ_JBDYRX010000004.1:59696-59805_length:110_mod0000 -M_T0_RID167_S0_NZ_JBDYLZ010000007.1:38370-38443_length:74_mod0000 -M_T0_RID168_S0_NC_030225.1:5381-5465_length:85_mod0001 -M_T0_RID168_S0_NC_030236.1:5080-5154_length:75_mod0000 -M_T0_RID169_S0_NC_028263.1:913-994_length:82_mod0000 -M_T0_RID169_S0_NZ_JBDYLZ010000007.1:16953-17017_length:65_mod0000 -M_T0_RID169_S1_NC_017970.1:7200-7322_length:123_mod0000 -M_T0_RID169_S1_NC_027016.1:84360-84421_length:62_mod0000 -M_T0_RID169_S1_NC_031295.1:1211-1283_length:73_mod0001 -M_T0_RID170_S1_NZ_JBDYRX010000001.1:71554-71642_length:89_mod0000 -M_T0_RID171_S0_NC_023429.1:1938-1983_length:46_mod0000 -M_T0_RID171_S0_NZ_JBDYRX010000001.1:944221-944313_length:93_mod0001 -M_T0_RID171_S1_NC_028891.1:8612-8645_length:34_mod0000 -M_T0_RID172_S0_NC_031455.1:2261-2316_length:56_mod0000 -M_T0_RID172_S1_NC_028383.1:1536-1621_length:86_mod0000 -M_T0_RID172_S1_NC_031293.1:5209-5302_length:94_mod0000 -M_T0_RID172_S1_NZ_JBDYSJ010000002.1:22259-22312_length:54_mod0000 -M_T0_RID173_S0_NC_033710.1:8523-8561_length:39_mod0000 -M_T0_RID173_S0_NZ_JBDYRX010000004.1:391209-391337_length:129_mod0000 -M_T0_RID173_S1_NZ_JBDYLZ010000022.1:5769-5818_length:50_mod0000 -M_T0_RID173_S1_NZ_JBDYSJ010000001.1:629973-630049_length:77_mod0000 -M_T0_RID174_S1_NC_030158.1:2752-2787_length:36_mod0000 -M_T0_RID174_S1_NC_031339.1:433-463_length:31_mod0000 -M_T0_RID174_S1_NZ_JBDYLZ010000006.1:10668-10748_length:81_mod0000 -M_T0_RID175_S0_NZ_JBDYLZ010000018.1:25042-25131_length:90_mod0000 -M_T0_RID175_S1_NZ_JBDYSJ010000001.1:899529-899569_length:41_mod0000 -M_T0_RID176_S0_NC_030200.1:58204-58287_length:84_mod0000 -M_T0_RID176_S0_NZ_JBDYRX010000002.1:668726-668775_length:50_mod0000 -M_T0_RID176_S1_NZ_JBDYSJ010000003.1:471518-471566_length:49_mod0001 -M_T0_RID177_S1_NZ_JBDYRX010000002.1:466682-466753_length:72_mod0000 -M_T0_RID178_S0_NC_028099.1:31084-31207_length:124_mod0000 -M_T0_RID178_S0_NC_033620.1:149729-149799_length:71_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000001.1:853106-853172_length:67_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000002.1:203092-203185_length:94_mod0000 -M_T0_RID179_S0_NC_023442.1:39001-39088_length:88_mod0000 -M_T0_RID179_S0_NZ_JBDYRX010000004.1:52140-52225_length:86_mod0000 -M_T0_RID179_S0_NZ_JBDYSJ010000001.1:721050-721084_length:35_mod0001 -M_T0_RID180_S0_NZ_JBDYSJ010000002.1:534591-534638_length:48_mod0000 -M_T0_RID180_S1_NC_029801.1:1212-1290_length:79_mod0000 -M_T0_RID181_S0_NC_023420.2:1575-1682_length:108_mod0000 -M_T0_RID181_S0_NZ_JBDYSJ010000001.1:400625-400659_length:35_mod0000 -M_T0_RID181_S1_NZ_JBDYLZ010000022.1:10488-10567_length:80_mod0000 -M_T0_RID182_S1_NC_030115.1:4690-4735_length:46_mod0000 -M_T0_RID183_S0_NC_029996.1:43664-43722_length:59_mod0000 -M_T0_RID185_S1_NZ_JBDYRX010000003.1:308336-308406_length:71_mod0001 -M_T0_RID185_S1_NZ_JBDYRX010000004.1:191608-191699_length:92_mod0000 -M_T0_RID187_S0_NC_029132.1:3505-3621_length:117_mod0000 -M_T0_RID187_S1_NC_028833.1:12138-12185_length:48_mod0001 -M_T0_RID187_S1_NZ_JBDYLZ010000007.1:48250-48349_length:100_mod0000 -M_T0_RID187_S1_NZ_JBDYRX010000001.1:251442-251541_length:100_mod0000 -M_T0_RID188_S0_NC_033620.1:60461-60546_length:86_mod0000 -M_T0_RID188_S0_NC_033745.1:5844-5924_length:81_mod0000 -M_T0_RID188_S1_NC_030746.1:5743-5836_length:94_mod0000 -M_T0_RID188_S1_NZ_JBDYSJ010000001.1:693404-693463_length:60_mod0000 -M_T0_RID190_S0_NC_028099.1:110295-110391_length:97_mod0000 -M_T0_RID190_S0_NC_031463.1:15502-15572_length:71_mod0000 -M_T0_RID190_S0_NZ_JBDYSJ010000002.1:205146-205255_length:110_mod0000 -M_T0_RID190_S1_NC_031291.1:89-172_length:84_mod0000 -M_T0_RID190_S1_NZ_JBDYRX010000001.1:953429-953485_length:57_mod0001 -M_T0_RID191_S0_NC_028811.1:13630-13691_length:62_mod0000 -M_T0_RID191_S0_NC_029255.1:128444-128478_length:35_mod0000 -M_T0_RID191_S1_NC_027706.1:673-702_length:30_mod0000 -M_T0_RID192_S0_NC_030202.1:1974-2037_length:64_mod0000 -M_T0_RID192_S0_NZ_JBDYSJ010000002.1:499003-499042_length:40_mod0000 -M_T0_RID192_S1_NC_028266.1:2491-2562_length:72_mod0000 -M_T0_RID192_S1_NC_029935.1:3672-3749_length:78_mod0000 -M_T0_RID193_S0_NC_030796.1:1139-1218_length:80_mod0000 -M_T0_RID193_S0_NZ_JBDYLZ010000006.1:65091-65167_length:77_mod0000 -M_T0_RID193_S1_NC_029311.1:3962-4023_length:62_mod0000 -M_T0_RID193_S1_NC_029854.1:2071-2138_length:68_mod0001 -M_T0_RID193_S1_NZ_JBDYLZ010000018.1:32241-32282_length:42_mod0000 -M_T0_RID193_S1_NZ_JBDYSJ010000004.1:33272-33325_length:54_mod0000 -M_T0_RID194_S0_NZ_JBDYRX010000001.1:29953-30068_length:116_mod0000 -M_T0_RID194_S1_NC_027117.1:4-75_length:72_mod0000 -M_T0_RID194_S1_NZ_JBDYSJ010000002.1:458031-458124_length:94_mod0000 -M_T0_RID195_S0_NC_029126.1:5551-5630_length:80_mod0000 -M_T0_RID195_S0_NC_030117.1:78912-78948_length:37_mod0000 -M_T0_RID195_S0_NZ_JBDYLZ010000010.1:56983-57024_length:42_mod0000 -M_T0_RID196_S0_NC_028891.1:12640-12710_length:71_mod0000 -M_T0_RID196_S0_NZ_JBDYSJ010000001.1:166064-166125_length:62_mod0000 -M_T0_RID196_S1_NC_029306.1:173-274_length:102_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000001.1:85071-85115_length:45_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000003.1:358250-358311_length:62_mod0001 -M_T0_RID198_S1_NZ_JBDYLZ010000012.1:46495-46566_length:72_mod0000 -M_T0_RID198_S1_NZ_JBDYSJ010000001.1:185655-185715_length:61_mod0000 -M_T0_RID199_S0_NZ_JBDYRX010000001.1:904336-904396_length:61_mod0000 -M_T0_RID200_S1_NZ_JBDYRX010000001.1:660511-660552_length:42_mod0000 -M_T0_RID201_S0_NZ_JBDYLZ010000028.1:698-764_length:67_mod0000 -M_T0_RID201_S1_NZ_JBDYSJ010000001.1:587635-587727_length:93_mod0000 -M_T0_RID202_S0_NZ_JBDYLZ010000009.1:73121-73183_length:63_mod0000 -M_T0_RID203_S1_NC_027923.1:89467-89574_length:108_mod0000 -M_T0_RID203_S1_NC_028470.1:6286-6372_length:87_mod0000 -M_T0_RID204_S0_NZ_JBDYSJ010000003.1:424711-424783_length:73_mod0000 -M_T0_RID204_S1_NZ_JBDYLZ010000009.1:157953-158008_length:56_mod0000 -M_T0_RID205_S0_NC_028806.1:14973-15042_length:70_mod0001 -M_T0_RID205_S0_NC_031336.1:5585-5707_length:123_mod0000 -M_T0_RID205_S0_NC_033710.1:1140-1174_length:35_mod0001 -M_T0_RID205_S0_NC_034377.1:309-345_length:37_mod0000 -M_T0_RID205_S0_NZ_JBDYRX010000001.1:648020-648102_length:83_mod0000 -M_T0_RID206_S0_NZ_JBDYRX010000003.1:657781-657875_length:95_mod0000 -M_T0_RID206_S1_NZ_JBDYSJ010000002.1:507837-507900_length:64_mod0000 -M_T0_RID207_S0_NC_029782.1:2571-2655_length:85_mod0000 -M_T0_RID207_S0_NC_033756.1:9757-9804_length:48_mod0000 -M_T0_RID207_S1_NC_028470.1:3881-3944_length:64_mod0000 -M_T0_RID207_S1_NC_029111.1:391-425_length:35_mod0000 -M_T0_RID208_S1_NC_028137.1:3146-3238_length:93_mod0000 -M_T0_RID209_S1_NC_027016.1:200405-200534_length:130_mod0000 -M_T0_RID209_S1_NZ_JBDYRX010000003.1:693765-693849_length:85_mod0000 -M_T0_RID211_S0_NC_030749.1:1821-1921_length:101_mod0000 -M_T0_RID211_S0_NZ_JBDYSJ010000002.1:199161-199238_length:78_mod0000 -M_T0_RID212_S0_NC_028462.1:2849-2888_length:40_mod0000 -M_T0_RID212_S0_NC_031272.1:7400-7455_length:56_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:220611-220694_length:84_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:824198-824247_length:50_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000002.1:522607-522670_length:64_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000003.1:35532-35575_length:44_mod0000 -M_T0_RID213_S1_NC_027619.1:3998-4074_length:77_mod0000 -M_T0_RID214_S0_NC_017990.1:4036-4109_length:74_mod0000 -M_T0_RID214_S0_NZ_JBDYRX010000004.1:6306-6380_length:75_mod0000 -M_T0_RID214_S1_NZ_JBDYLZ010000016.1:26291-26346_length:56_mod0001 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:332282-332360_length:79_mod0000 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:457564-457597_length:34_mod0000 -M_T0_RID215_S1_NZ_JBDYRX010000004.1:547476-547541_length:66_mod0000 -M_T0_RID217_S0_NC_030922.1:6414-6531_length:118_mod0000 -M_T0_RID217_S0_NZ_JBDYRX010000001.1:366993-367094_length:102_mod0000 -M_T0_RID217_S1_NC_017970.1:8697-8737_length:41_mod0000 -M_T0_RID217_S1_NC_018482.1:2018-2099_length:82_mod0000 -M_T0_RID219_S0_NZ_JBDYLZ010000006.1:135272-135372_length:101_mod0001 -M_T0_RID219_S1_NZ_JBDYRX010000003.1:132173-132251_length:79_mod0000 -M_T0_RID220_S0_NC_033725.1:8661-8722_length:62_mod0000 -M_T0_RID220_S1_NZ_JBDYRX010000003.1:133141-133229_length:89_mod0000 -M_T0_RID221_S0_NZ_JBDYRX010000001.1:771011-771087_length:77_mod0000 -M_T0_RID222_S0_NC_037572.1:1818-1871_length:54_mod0000 -M_T0_RID222_S1_NC_028485.1:810-872_length:63_mod0000 -M_T0_RID222_S1_NC_030793.1:2889-2992_length:104_mod0000 -M_T0_RID222_S1_NZ_JBDYRX010000001.1:301419-301533_length:115_mod0001 -M_T0_RID223_S1_NC_033620.1:157690-157751_length:62_mod0000 -M_T0_RID224_S0_NC_017937.1:2859-2949_length:91_mod0000 -M_T0_RID224_S1_NC_028388.1:2224-2291_length:68_mod0001 -M_T0_RID224_S1_NC_033700.1:22817-22886_length:70_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000001.1:692859-692944_length:86_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000004.1:483631-483701_length:71_mod0000 -M_T0_RID225_S1_NC_029311.1:72416-72523_length:108_mod0000 -M_T0_RID225_S1_NC_030240.1:91908-91984_length:77_mod0000 -M_T0_RID226_S0_NZ_JBDYRX010000001.1:678003-678073_length:71_mod0000 -M_T0_RID226_S1_NZ_JBDYRX010000001.1:984964-985038_length:75_mod0000 -M_T0_RID227_S0_NC_028636.1:35420-35507_length:88_mod0000 -M_T0_RID227_S0_NZ_JBDYLZ010000014.1:18260-18351_length:92_mod0000 -M_T0_RID227_S1_NZ_JBDYLZ010000010.1:2424-2519_length:96_mod0000 -M_T0_RID229_S0_NZ_JBDYRX010000002.1:664717-664801_length:85_mod0000 -M_T0_RID230_S0_NC_033822.1:1869-1967_length:99_mod0000 -M_T0_RID230_S0_NZ_JBDYRX010000002.1:244562-244600_length:39_mod0000 -M_T0_RID231_S0_NC_034017.1:4341-4449_length:109_mod0000 -M_T0_RID231_S0_NZ_JBDYRX010000002.1:364966-365054_length:89_mod0000 -M_T0_RID231_S1_NZ_JBDYRX010000004.1:275949-276005_length:57_mod0001 -M_T0_RID233_S0_NC_030402.1:4056-4127_length:72_mod0000 -M_T0_RID234_S0_NZ_JBDYSJ010000001.1:910286-910315_length:30_mod0000 -M_T0_RID234_S1_NZ_JBDYSJ010000003.1:84105-84229_length:125_mod0000 -M_T0_RID235_S0_NC_029997.2:52965-53016_length:52_mod0000 -M_T0_RID235_S0_NZ_JBDYRX010000004.1:469577-469661_length:85_mod0000 -M_T0_RID235_S1_NC_029993.1:68-156_length:89_mod0000 -M_T0_RID236_S0_NC_027209.1:15-106_length:92_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000001.1:879200-879251_length:52_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000002.1:665177-665206_length:30_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:172535-172571_length:37_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:365370-365448_length:79_mod0000 -M_T0_RID237_S1_NZ_JBDYRX010000003.1:311400-311455_length:56_mod0000 -M_T0_RID237_S1_NZ_JBDYSJ010000001.1:341900-342051_length:152_mod0001 -M_T0_RID237_S1_NZ_JBDYSJ010000002.1:210078-210161_length:84_mod0000 -M_T0_RID239_S1_NZ_JBDYLZ010000008.1:60180-60243_length:64_mod0000 -M_T0_RID240_S0_NC_028376.1:8889-8978_length:90_mod0000 -M_T0_RID240_S0_NZ_JBDYLZ010000011.1:107039-107086_length:48_mod0000 -M_T0_RID240_S1_NC_029255.1:88189-88282_length:94_mod0000 -M_T0_RID242_S0_NC_031275.1:6726-6767_length:42_mod0000 -M_T0_RID242_S1_NZ_JBDYRX010000003.1:456427-456495_length:69_mod0000 -M_T0_RID243_S0_NC_038232.1:593-634_length:42_mod0000 -M_T0_RID244_S0_NZ_JBDYRX010000004.1:71169-71250_length:82_mod0000 -M_T0_RID244_S1_NC_031105.1:1094-1177_length:84_mod0000 -M_T0_RID244_S1_NZ_JBDYRX010000003.1:93344-93453_length:110_mod0000 -M_T0_RID245_S1_NC_027916.2:74440-74509_length:70_mod0000 -M_T0_RID246_S0_NZ_JBDYLZ010000007.1:253179-253255_length:77_mod0000 -M_T0_RID246_S0_NZ_JBDYRX010000003.1:373773-373844_length:72_mod0000 -M_T0_RID247_S1_NC_034240.1:6159-6240_length:82_mod0000 -M_T0_RID247_S1_NZ_JBDYLZ010000006.1:319402-319479_length:78_mod0000 -M_T0_RID248_S1_NZ_JBDYLZ010000021.1:15403-15484_length:82_mod0000 -M_T0_RID248_S1_NZ_JBDYSJ010000002.1:614316-614362_length:47_mod0000 -M_T0_RID249_S1_NZ_JBDYSJ010000002.1:599779-599834_length:56_mod0000 -M_T0_RID250_S0_NC_027916.2:147626-147747_length:122_mod0000 -M_T0_RID250_S0_NC_033620.1:26136-26203_length:68_mod0000 -M_T0_RID251_S1_NZ_JBDYRX010000003.1:388429-388516_length:88_mod0001 -M_T0_RID252_S0_NZ_JBDYRX010000003.1:533554-533659_length:106_mod0000 -M_T0_RID252_S0_NZ_JBDYSJ010000004.1:89796-89871_length:76_mod0000 -M_T0_RID254_S0_NC_029312.1:1320-1415_length:96_mod0000 -M_T0_RID254_S1_NC_033722.1:1513-1562_length:50_mod0000 -M_T0_RID254_S1_NZ_JBDYRX010000003.1:600746-600803_length:58_mod0000 -M_T0_RID255_S1_NZ_JBDYLZ010000009.1:84943-85024_length:82_mod0000 -M_T0_RID256_S0_NZ_JBDYRX010000002.1:72764-72831_length:68_mod0000 -M_T0_RID256_S1_NZ_JBDYSJ010000003.1:105583-105635_length:53_mod0001 -M_T0_RID257_S0_NC_029997.2:11591-11678_length:88_mod0000 -M_T0_RID257_S0_NZ_JBDYLZ010000007.1:42813-42887_length:75_mod0000 -M_T0_RID258_S0_NC_030151.1:5275-5349_length:75_mod0000 -M_T0_RID258_S1_NC_023442.1:46718-46759_length:42_mod0000 -M_T0_RID258_S1_NC_027641.1:2606-2691_length:86_mod0000 -M_T0_RID259_S0_NZ_JBDYRX010000001.1:515399-515441_length:43_mod0000 -M_T0_RID259_S1_NC_033710.1:2139-2199_length:61_mod0001 -M_T0_RID260_S0_NZ_JBDYRX010000004.1:304887-304994_length:108_mod0000 -M_T0_RID261_S0_NC_024913.1:363-436_length:74_mod0000 -M_T0_RID261_S1_NZ_JBDYSJ010000003.1:83891-83937_length:47_mod0000 -M_T0_RID262_S0_NC_028964.1:8465-8506_length:42_mod0000 -M_T0_RID262_S1_NC_028369.1:11507-11563_length:57_mod0000 -M_T0_RID263_S1_NZ_JBDYLZ010000007.1:59938-60023_length:86_mod0000 -M_T0_RID264_S1_NC_030240.1:10284-10380_length:97_mod0000 -M_T0_RID266_S0_NZ_JBDYRX010000003.1:575037-575078_length:42_mod0000 -M_T0_RID268_S0_NZ_JBDYRX010000001.1:768153-768245_length:93_mod0000 -M_T0_RID268_S0_NZ_JBDYSJ010000001.1:798703-798770_length:68_mod0000 -M_T0_RID270_S0_NC_029132.1:95722-95798_length:77_mod0000 -M_T0_RID270_S1_NZ_JBDYSJ010000004.1:222075-222158_length:84_mod0000 -M_T0_RID271_S0_NC_033620.1:162451-162504_length:54_mod0000 -M_T0_RID272_S0_NC_033620.1:33874-33960_length:87_mod0000 -M_T0_RID273_S1_NC_030744.1:7300-7340_length:41_mod0000 -M_T0_RID273_S1_NZ_JBDYRX010000002.1:841729-841840_length:112_mod0000 -M_T0_RID274_S1_NC_037571.1:1402-1475_length:74_mod0000 -M_T0_RID274_S1_NC_037615.1:1507-1556_length:50_mod0000 -M_T0_RID274_S1_NZ_JBDYRX010000002.1:803747-803830_length:84_mod0001 -M_T0_RID276_S0_NZ_JBDYSJ010000001.1:37440-37524_length:85_mod0000 -M_T0_RID276_S1_NZ_JBDYSJ010000003.1:418336-418453_length:118_mod0000 -M_T0_RID277_S1_NZ_JBDYLZ010000010.1:25227-25303_length:77_mod0000 -M_T0_RID277_S1_NZ_JBDYRX010000004.1:42366-42442_length:77_mod0000 -M_T0_RID280_S1_NC_029255.1:110657-110707_length:51_mod0000 -M_T0_RID280_S1_NZ_JBDYLZ010000007.1:148039-148124_length:86_mod0000 -M_T0_RID280_S1_NZ_JBDYSJ010000003.1:358558-358656_length:99_mod0000 -M_T0_RID281_S0_NZ_JBDYRX010000001.1:319973-320043_length:71_mod0000 -M_T0_RID281_S1_NC_033717.1:9058-9157_length:100_mod0000 -M_T0_RID281_S1_NZ_JBDYLZ010000009.1:175718-175802_length:85_mod0000 -M_T0_RID282_S0_NZ_JBDYRX010000002.1:378265-378345_length:81_mod0001 -M_T0_RID283_S1_NC_027016.1:6355-6413_length:59_mod0000 -M_T0_RID283_S1_NC_028230.1:391-510_length:120_mod0000 -M_T0_RID285_S1_NC_034376.1:1364-1410_length:47_mod0000 -M_T0_RID286_S1_NC_027918.1:6177-6259_length:83_mod0000 -M_T0_RID287_S0_NZ_JBDYRX010000003.1:370134-370205_length:72_mod0000 -M_T0_RID289_S0_NZ_JBDYRX010000001.1:744827-744955_length:129_mod0000 -M_T0_RID289_S1_NC_028259.1:3827-3878_length:52_mod0000 -M_T0_RID290_S0_NC_030240.1:45198-45233_length:36_mod0000 -M_T0_RID290_S0_NC_030691.1:1722-1773_length:52_mod0000 -M_T0_RID290_S1_NC_029133.1:4034-4132_length:99_mod0000 -M_T0_RID291_S1_NC_028981.1:5970-6046_length:77_mod0000 -M_T0_RID291_S1_NZ_JBDYSJ010000002.1:464139-464169_length:31_mod0000 -M_T0_RID293_S1_NC_030232.1:2260-2327_length:68_mod0000 -M_T0_RID295_S1_NC_027916.2:61867-61920_length:54_mod0000 -M_T0_RID295_S1_NC_028806.1:27530-27608_length:79_mod0000 -M_T0_RID296_S0_NZ_JBDYSJ010000001.1:184354-184410_length:57_mod0000 -M_T0_RID296_S1_NC_028867.1:5870-5944_length:75_mod0000 -M_T0_RID296_S1_NC_029034.2:6068-6170_length:103_mod0000 -M_T0_RID296_S1_NC_029575.1:1786-1824_length:39_mod0000 -M_T0_RID296_S1_NC_031313.1:8320-8423_length:104_mod0000 -M_T0_RID296_S1_NZ_JBDYRX010000001.1:732093-732144_length:52_mod0000 -M_T0_RID300_S0_NC_030870.1:888-963_length:76_mod0000 -M_T0_RID300_S1_NC_028239.1:12981-13075_length:95_mod0001 -M_T0_RID301_S0_NC_027016.1:47977-48089_length:113_mod0000 -M_T0_RID301_S0_NC_029997.2:77533-77588_length:56_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000001.1:795273-795348_length:76_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000003.1:723584-723651_length:68_mod0000 -M_T0_RID302_S1_NC_033820.1:4695-4770_length:76_mod0000 -M_T0_RID303_S0_NZ_JBDYSJ010000002.1:596456-596511_length:56_mod0000 -M_T0_RID303_S1_NZ_JBDYLZ010000013.1:92895-92926_length:32_mod0000 -M_T0_RID304_S0_NC_031463.1:20675-20751_length:77_mod0000 -M_T0_RID306_S0_NC_027916.2:96621-96699_length:79_mod0000 -M_T0_RID307_S0_NC_028266.1:10941-10980_length:40_mod0000 -M_T0_RID308_S1_NZ_JBDYLZ010000010.1:103191-103276_length:86_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:370261-370296_length:36_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:387786-387861_length:76_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000003.1:389721-389777_length:57_mod0000 -M_T0_RID309_S1_NC_026944.1:4310-4395_length:86_mod0000 -M_T0_RID309_S1_NZ_JBDYSJ010000001.1:151328-151382_length:55_mod0000 -M_T0_RID311_S0_NZ_JBDYLZ010000006.1:59717-59765_length:49_mod0000 -M_T0_RID311_S1_NZ_JBDYLZ010000023.1:5604-5703_length:100_mod0000 -M_T0_RID312_S1_NC_018382.1:3769-3816_length:48_mod0000 -M_T0_RID313_S1_NZ_JBDYRX010000002.1:139751-139865_length:115_mod0000 -M_T0_RID314_S0_NZ_JBDYSJ010000004.1:132522-132621_length:100_mod0000 -M_T0_RID315_S0_NC_033823.1:7820-7860_length:41_mod0000 -M_T0_RID317_S0_NC_034214.1:5951-5996_length:46_mod0000 -M_T0_RID317_S0_NZ_JBDYLZ010000015.1:71185-71277_length:93_mod0000 -M_T0_RID317_S0_NZ_JBDYRX010000004.1:174342-174382_length:41_mod0000 -M_T0_RID317_S1_NC_030293.1:5902-5968_length:67_mod0001 -M_T0_RID318_S0_NC_028814.1:27392-27476_length:85_mod0000 -M_T0_RID318_S0_NZ_JBDYRX010000001.1:771856-771930_length:75_mod0000 -M_T0_RID318_S1_NZ_JBDYLZ010000006.1:119310-119391_length:82_mod0000 -M_T0_RID319_S0_NC_034266.1:62140-62218_length:79_mod0000 -M_T0_RID319_S1_NC_028981.1:4292-4341_length:50_mod0000 -M_T0_RID319_S1_NC_031455.1:2498-2551_length:54_mod0000 -M_T0_RID319_S1_NZ_JBDYRX010000004.1:60929-61033_length:105_mod0000 -M_T0_RID322_S1_NZ_JBDYRX010000003.1:440227-440291_length:65_mod0000 -M_T0_RID323_S0_NC_030240.1:40893-40967_length:75_mod0000 -M_T0_RID323_S0_NZ_JBDYLZ010000007.1:249215-249268_length:54_mod0000 -M_T0_RID324_S0_NC_029311.1:87639-87764_length:126_mod0000 -M_T0_RID324_S0_NZ_JBDYSJ010000002.1:545609-545688_length:80_mod0000 -M_T0_RID324_S1_NZ_JBDYSJ010000003.1:210751-210786_length:36_mod0000 -M_T0_RID325_S1_NC_031240.1:7762-7813_length:52_mod0000 -M_T0_RID326_S0_NZ_JBDYLZ010000009.1:5470-5539_length:70_mod0000 -M_T0_RID328_S1_NZ_JBDYRX010000002.1:171169-171268_length:100_mod0000 -M_T0_RID329_S0_NZ_JBDYRX010000002.1:757356-757453_length:98_mod0000 -M_T0_RID329_S1_NZ_JBDYLZ010000008.1:68972-69065_length:94_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:680879-680974_length:96_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:706464-706551_length:88_mod0000 -M_T0_RID331_S0_NC_029255.1:77095-77131_length:37_mod0000 -M_T0_RID331_S0_NC_030240.1:62248-62311_length:64_mod0000 -M_T0_RID331_S1_NC_030126.1:1582-1653_length:72_mod0001 -M_T0_RID331_S1_NC_033707.1:5319-5406_length:88_mod0000 -M_T0_RID331_S1_NZ_JBDYLZ010000016.1:42739-42823_length:85_mod0000 -M_T0_RID332_S0_NZ_JBDYSJ010000004.1:35297-35358_length:62_mod0000 -M_T0_RID333_S0_NZ_JBDYLZ010000014.1:79014-79074_length:61_mod0000 -M_T0_RID333_S1_NC_027647.1:655-726_length:72_mod0000 -M_T0_RID333_S1_NC_033620.1:54726-54845_length:120_mod0000 -M_T0_RID334_S0_NZ_JBDYRX010000002.1:455003-455101_length:99_mod0000 -M_T0_RID335_S0_NZ_JBDYRX010000002.1:694573-694718_length:146_mod0000 -M_T0_RID335_S1_NZ_JBDYSJ010000001.1:102384-102461_length:78_mod0000 -M_T0_RID337_S0_NC_028368.1:13695-13792_length:98_mod0000 -M_T0_RID338_S0_NZ_JBDYRX010000001.1:578324-578379_length:56_mod0000 -M_T0_RID338_S1_NZ_JBDYRX010000003.1:471689-471760_length:72_mod0000 -M_T0_RID339_S1_NC_028362.1:1132-1236_length:105_mod0000 -M_T0_RID339_S1_NZ_JBDYRX010000003.1:626110-626150_length:41_mod0000 -M_T0_RID339_S1_NZ_JBDYSJ010000002.1:576422-576503_length:82_mod0000 -M_T0_RID340_S0_NC_028973.1:4682-4727_length:46_mod0000 -M_T0_RID340_S0_NC_029132.1:93532-93576_length:45_mod0000 -M_T0_RID341_S0_NC_030240.1:112206-112263_length:58_mod0000 -M_T0_RID341_S0_NC_034252.1:1229-1329_length:101_mod0000 -M_T0_RID342_S0_NZ_JBDYLZ010000011.1:111949-111982_length:34_mod0001 -M_T0_RID342_S1_NZ_JBDYLZ010000008.1:135318-135406_length:89_mod0001 -M_T0_RID343_S0_NC_029996.1:68953-69051_length:99_mod0000 -M_T0_RID344_S1_NC_030148.1:11118-11172_length:55_mod0000 -M_T0_RID345_S0_NZ_JBDYRX010000002.1:64932-64977_length:46_mod0000 -M_T0_RID346_S1_NZ_JBDYRX010000003.1:433612-433704_length:93_mod0000 -M_T0_RID347_S0_NC_036636.1:7712-7773_length:62_mod0000 -M_T0_RID347_S1_NZ_JBDYRX010000002.1:59074-59138_length:65_mod0000 -M_T0_RID347_S1_NZ_JBDYSJ010000003.1:117376-117430_length:55_mod0001 -M_T0_RID348_S0_NZ_JBDYRX010000001.1:1015831-1015930_length:100_mod0000 -M_T0_RID348_S1_NZ_JBDYRX010000001.1:141445-141557_length:113_mod0000 -M_T0_RID349_S0_NC_030391.1:4068-4155_length:88_mod0001 -M_T0_RID349_S0_NZ_JBDYRX010000001.1:226925-227009_length:85_mod0000 -M_T0_RID349_S1_NZ_JBDYRX010000003.1:358370-358434_length:65_mod0000 -M_T0_RID351_S0_NC_033753.1:4226-4317_length:92_mod0000 -M_T0_RID352_S1_NC_028259.1:56-127_length:72_mod0000 -M_T0_RID352_S1_NC_028395.1:155-248_length:94_mod0000 -M_T0_RID352_S1_NC_029931.1:9204-9241_length:38_mod0000 -M_T0_RID353_S0_NZ_JBDYLZ010000009.1:48165-48236_length:72_mod0000 -M_T0_RID354_S1_NZ_JBDYLZ010000012.1:45797-45922_length:126_mod0000 -M_T0_RID356_S0_NC_028378.1:3454-3530_length:77_mod0000 -M_T0_RID357_S0_NZ_JBDYRX010000002.1:120553-120591_length:39_mod0000 -M_T0_RID357_S1_NZ_JBDYSJ010000004.1:245908-245957_length:50_mod0000 -M_T0_RID358_S0_NC_029126.1:5901-5938_length:38_mod0000 -M_T0_RID358_S1_NC_028140.1:1554-1651_length:98_mod0000 -M_T0_RID358_S1_NZ_JBDYSJ010000002.1:580725-580785_length:61_mod0001 -M_T0_RID359_S0_NZ_JBDYRX010000001.1:601220-601298_length:79_mod0000 -M_T0_RID360_S0_NC_027916.2:77660-77740_length:81_mod0001 -M_T0_RID360_S0_NZ_JBDYLZ010000012.1:70482-70531_length:50_mod0000 -M_T0_RID360_S1_NC_017862.1:2881-2912_length:32_mod0000 -M_T0_RID360_S1_NC_028373.1:7802-7900_length:99_mod0000 -M_T0_RID361_S0_NZ_JBDYRX010000003.1:274684-274747_length:64_mod0000 -M_T0_RID362_S0_NC_029996.1:102820-102944_length:125_mod0001 -M_T0_RID362_S1_NC_027916.2:110368-110450_length:83_mod0000 -M_T0_RID362_S1_NZ_JBDYSJ010000002.1:480705-480765_length:61_mod0000 -M_T0_RID363_S0_NC_031089.1:6455-6543_length:89_mod0000 -M_T0_RID363_S0_NC_031218.1:1568-1623_length:56_mod0000 -M_T0_RID365_S1_NZ_JBDYSJ010000002.1:271975-272051_length:77_mod0000 -M_T0_RID366_S0_NZ_JBDYSJ010000001.1:487398-487484_length:87_mod0001 -M_T0_RID366_S1_NC_030843.1:4921-5005_length:85_mod0000 -M_T0_RID367_S0_NC_030127.1:2548-2589_length:42_mod0000 -M_T0_RID367_S0_NZ_JBDYLZ010000011.1:24860-24971_length:112_mod0000 -M_T0_RID367_S1_NZ_JBDYLZ010000006.1:96139-96201_length:63_mod0000 -M_T0_RID368_S0_NZ_JBDYSJ010000002.1:604782-604905_length:124_mod0001 -M_T0_RID369_S1_NC_031464.1:5161-5234_length:74_mod0000 -M_T0_RID370_S0_NC_027542.1:1019-1100_length:82_mod0000 -M_T0_RID371_S1_NC_028144.1:5011-5099_length:89_mod0000 -M_T0_RID371_S1_NZ_JBDYRX010000002.1:678499-678596_length:98_mod0000 -M_T0_RID372_S0_NZ_JBDYRX010000003.1:526040-526077_length:38_mod0000 -M_T0_RID372_S0_NZ_JBDYSJ010000002.1:283416-283463_length:48_mod0001 -M_T0_RID373_S0_NC_033705.1:55-95_length:41_mod0000 -M_T0_RID374_S0_NC_027016.1:151413-151449_length:37_mod0000 -M_T0_RID374_S0_NZ_JBDYSJ010000003.1:310288-310375_length:88_mod0000 -M_T0_RID374_S1_NZ_JBDYLZ010000012.1:57726-57851_length:126_mod0000 -M_T0_RID375_S0_NC_034377.1:6340-6385_length:46_mod0000 -M_T0_RID375_S1_NC_028099.1:112413-112504_length:92_mod0001 -M_T0_RID378_S0_NC_018448.1:5936-6007_length:72_mod0000 -M_T0_RID379_S1_NZ_JBDYRX010000001.1:727009-727109_length:101_mod0000 -M_T0_RID380_S0_NC_034253.1:5146-5187_length:42_mod0000 -M_T0_RID380_S1_NC_029905.1:2051-2094_length:44_mod0000 -M_T0_RID381_S0_NC_030240.1:103311-103373_length:63_mod0000 -M_T0_RID381_S0_NZ_JBDYLZ010000009.1:178104-178162_length:59_mod0000 -M_T0_RID382_S0_NC_027210.1:5895-5968_length:74_mod0000 -M_T0_RID382_S0_NC_029996.1:87376-87478_length:103_mod0000 -M_T0_RID382_S1_NC_027916.2:84236-84307_length:72_mod0000 -M_T0_RID383_S0_NZ_JBDYSJ010000001.1:683370-683456_length:87_mod0000 -M_T0_RID383_S1_NC_029132.1:79856-79920_length:65_mod0000 -M_T0_RID385_S0_NZ_JBDYLZ010000009.1:69071-69118_length:48_mod0000 -M_T0_RID386_S0_NC_034225.1:1556-1648_length:93_mod0000 -M_T0_RID387_S1_NC_028636.1:123682-123742_length:61_mod0000 -M_T0_RID388_S0_NZ_JBDYLZ010000008.1:71860-71983_length:124_mod0000 -M_T0_RID389_S0_NC_029051.1:9270-9318_length:49_mod0000 -M_T0_RID389_S0_NZ_JBDYLZ010000016.1:61192-61254_length:63_mod0000 -M_T0_RID390_S1_NC_028981.1:1738-1830_length:93_mod0000 -M_T0_RID391_S0_NC_028371.1:6428-6495_length:68_mod0000 -M_T0_RID391_S0_NZ_JBDYRX010000004.1:272450-272500_length:51_mod0000 -M_T0_RID391_S1_NZ_JBDYSJ010000002.1:543099-543205_length:107_mod0000 -M_T0_RID392_S0_NC_028970.1:5031-5099_length:69_mod0000 -M_T0_RID392_S1_NC_028824.1:19380-19469_length:90_mod0000 -M_T0_RID392_S1_NZ_JBDYLZ010000009.1:26519-26597_length:79_mod0000 -M_T0_RID393_S0_NZ_JBDYLZ010000015.1:66736-66802_length:67_mod0000 -M_T0_RID395_S0_NC_031304.1:4214-4304_length:91_mod0000 -M_T0_RID396_S0_NZ_JBDYSJ010000001.1:683444-683483_length:40_mod0000 -M_T0_RID397_S0_NC_028125.1:5157-5221_length:65_mod0000 -M_T0_RID398_S0_NC_028814.1:21296-21329_length:34_mod0000 -M_T0_RID398_S0_NZ_JBDYLZ010000008.1:89568-89611_length:44_mod0000 -M_T0_RID398_S1_NZ_JBDYRX010000003.1:160428-160514_length:87_mod0000 -M_T0_RID399_S1_NZ_JBDYRX010000002.1:383166-383266_length:101_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000006.1:321094-321166_length:73_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000017.1:46480-46536_length:57_mod0000 -M_T0_RID402_S0_NC_028491.1:36087-36159_length:73_mod0000 -M_T0_RID406_S0_NC_033720.1:8569-8637_length:69_mod0000 -M_T0_RID406_S0_NZ_JBDYSJ010000002.1:605544-605617_length:74_mod0000 -M_T0_RID406_S1_NC_033620.1:71763-71841_length:79_mod0000 -M_T0_RID407_S0_NC_028491.1:95220-95304_length:85_mod0000 -M_T0_RID407_S0_NZ_JBDYRX010000004.1:531865-531922_length:58_mod0000 -M_T0_RID408_S0_NZ_JBDYLZ010000006.1:20241-20331_length:91_mod0000 -M_T0_RID408_S1_NC_030391.1:1047-1152_length:106_mod0000 -M_T0_RID409_S1_NC_029904.1:2927-3013_length:87_mod0000 -M_T0_RID410_S0_NC_028369.1:7176-7240_length:65_mod0000 -M_T0_RID410_S1_NC_027923.1:107200-107294_length:95_mod0000 -M_T0_RID411_S1_NC_027916.2:12656-12743_length:88_mod0000 -M_T0_RID412_S0_NC_028362.1:1734-1810_length:77_mod0000 -M_T0_RID414_S0_NC_027646.1:3518-3556_length:39_mod0000 -M_T0_RID415_S1_NC_033703.1:4454-4536_length:83_mod0000 -M_T0_RID415_S1_NZ_JBDYRX010000004.1:398358-398416_length:59_mod0000 -M_T0_RID419_S0_NZ_JBDYSJ010000002.1:339543-339583_length:41_mod0000 -M_T0_RID420_S0_NC_029919.1:1092-1170_length:79_mod0000 -M_T0_RID420_S1_NC_029132.1:86139-86240_length:102_mod0000 -M_T0_RID421_S0_NZ_JBDYRX010000004.1:42510-42680_length:171_mod0001 -M_T0_RID421_S1_NC_028099.1:99392-99421_length:30_mod0000 -M_T0_RID422_S0_NC_028236.1:7738-7797_length:60_mod0000 -M_T0_RID422_S0_NZ_JBDYLZ010000014.1:21662-21716_length:55_mod0000 -M_T0_RID422_S0_NZ_JBDYSJ010000002.1:476168-476219_length:52_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:131159-131244_length:86_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:465551-465658_length:108_mod0000 -M_T0_RID424_S0_NC_029132.1:124479-124602_length:124_mod0000 -M_T0_RID424_S1_NZ_JBDYLZ010000006.1:180426-180481_length:56_mod0000 -M_T0_RID424_S1_NZ_JBDYSJ010000003.1:445372-445447_length:76_mod0000 -M_T0_RID425_S0_NZ_JBDYLZ010000006.1:11120-11222_length:103_mod0000 -M_T0_RID426_S1_NZ_JBDYRX010000002.1:460851-460904_length:54_mod0000 -M_T0_RID426_S1_NZ_JBDYSJ010000001.1:882579-882628_length:50_mod0000 -M_T0_RID427_S0_NZ_JBDYSJ010000001.1:460394-460459_length:66_mod0000 -M_T0_RID428_S1_NZ_JBDYLZ010000007.1:203593-203667_length:75_mod0000 -M_T0_RID432_S1_NZ_JBDYRX010000004.1:37215-37282_length:68_mod0000 -M_T0_RID433_S0_NC_028371.1:7751-7803_length:53_mod0000 -M_T0_RID433_S0_NZ_JBDYRX010000001.1:940205-940283_length:79_mod0000 -M_T0_RID434_S0_NZ_JBDYRX010000003.1:278075-278140_length:66_mod0000 -M_T0_RID435_S1_NC_031225.1:6315-6360_length:46_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000001.1:992235-992354_length:120_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000002.1:28179-28253_length:75_mod0000 -M_T0_RID436_S0_NZ_JBDYRX010000004.1:193926-194033_length:108_mod0000 -M_T0_RID438_S0_NZ_JBDYRX010000004.1:427488-427551_length:64_mod0000 -M_T0_RID441_S1_NC_028486.1:4288-4332_length:45_mod0000 -M_T0_RID441_S1_NC_031135.1:1215-1254_length:40_mod0000 -M_T0_RID441_S1_NC_033620.1:171185-171273_length:89_mod0000 -M_T0_RID441_S1_NZ_JBDYRX010000001.1:944430-944505_length:76_mod0000 -M_T0_RID442_S1_NZ_JBDYSJ010000001.1:795030-795132_length:103_mod0000 -M_T0_RID444_S1_NC_029927.1:739-780_length:42_mod0000 -M_T0_RID445_S0_NC_030400.1:9136-9237_length:102_mod0000 -M_T0_RID445_S1_NC_037578.1:3062-3107_length:46_mod0000 -M_T0_RID446_S0_NC_029996.1:10622-10695_length:74_mod0000 -M_T0_RID446_S1_NC_034266.1:27796-27894_length:99_mod0000 -M_T0_RID447_S1_NC_031259.1:1711-1781_length:71_mod0000 -M_T0_RID450_S0_NZ_JBDYRX010000003.1:719829-719908_length:80_mod0000 -M_T0_RID451_S0_NC_027214.1:8775-8830_length:56_mod0000 -M_T0_RID451_S0_NC_028367.1:5391-5502_length:112_mod0000 -M_T0_RID451_S1_NZ_JBDYRX010000002.1:31090-31200_length:111_mod0000 -M_T0_RID452_S1_NC_030205.1:1725-1812_length:88_mod0000 -M_T0_RID453_S0_NC_033761.1:8903-9009_length:107_mod0001 -M_T0_RID455_S0_NC_027799.1:284-375_length:92_mod0000 -M_T0_RID455_S1_NZ_JBDYLZ010000014.1:95838-95936_length:99_mod0000 -M_T0_RID455_S1_NZ_JBDYSJ010000002.1:210490-210557_length:68_mod0000 -M_T0_RID456_S0_NZ_JBDYLZ010000007.1:109571-109660_length:90_mod0000 -M_T0_RID456_S1_NC_030240.1:55430-55543_length:114_mod0000 -M_T0_RID457_S1_NZ_JBDYLZ010000009.1:123168-123262_length:95_mod0000 -M_T0_RID457_S1_NZ_JBDYSJ010000004.1:21364-21417_length:54_mod0000 -M_T0_RID458_S1_NC_034266.1:128171-128258_length:88_mod0000 -M_T0_RID458_S1_NZ_JBDYLZ010000008.1:129533-129587_length:55_mod0000 -M_T0_RID458_S1_NZ_JBDYRX010000002.1:29087-29147_length:61_mod0000 -M_T0_RID459_S0_NZ_JBDYRX010000001.1:1023086-1023182_length:97_mod0000 -M_T0_RID459_S1_NC_023442.1:114262-114356_length:95_mod0000 -M_T0_RID460_S0_NC_029052.1:1193-1273_length:81_mod0000 -M_T0_RID462_S1_NZ_JBDYRX010000001.1:1005315-1005420_length:106_mod0000 -M_T0_RID463_S0_NC_028372.1:9914-9999_length:86_mod0000 -M_T0_RID463_S1_NZ_JBDYSJ010000004.1:218365-218453_length:89_mod0000 -M_T0_RID465_S0_NZ_JBDYSJ010000001.1:787887-787945_length:59_mod0000 -M_T0_RID465_S1_NC_029311.1:1797-1831_length:35_mod0000 -M_T0_RID466_S0_NZ_JBDYRX010000003.1:730520-730588_length:69_mod0000 -M_T0_RID470_S1_NC_033820.1:3073-3102_length:30_mod0000 -M_T0_RID471_S1_NZ_JBDYLZ010000008.1:35202-35290_length:89_mod0000 -M_T0_RID472_S0_NZ_JBDYLZ010000011.1:10802-10846_length:45_mod0000 -M_T0_RID472_S1_NZ_JBDYRX010000001.1:652634-652707_length:74_mod0000 -M_T0_RID474_S0_NC_030225.1:5289-5336_length:48_mod0000 -M_T0_RID475_S0_NZ_JBDYLZ010000006.1:151548-151631_length:84_mod0000 -M_T0_RID475_S0_NZ_JBDYRX010000002.1:464041-464153_length:113_mod0000 -M_T0_RID476_S0_NZ_JBDYLZ010000015.1:62860-62918_length:59_mod0000 -M_T0_RID477_S0_NC_027214.1:4315-4391_length:77_mod0000 -M_T0_RID477_S0_NC_030231.1:4362-4445_length:84_mod0000 -M_T0_RID477_S1_NC_027926.1:5336-5385_length:50_mod0000 -M_T0_RID479_S0_NC_034240.1:10006-10105_length:100_mod0000 -M_T0_RID479_S0_NC_034377.1:6973-7006_length:34_mod0000 -M_T0_RID479_S1_NC_029309.1:1183-1291_length:109_mod0000 -M_T0_RID479_S1_NZ_JBDYRX010000004.1:294593-294685_length:93_mod0000 -M_T0_RID480_S0_NC_030148.1:14092-14146_length:55_mod0000 -M_T0_RID481_S1_NC_027920.1:4910-4956_length:47_mod0000 -M_T0_RID481_S1_NC_028252.1:1447-1525_length:79_mod0000 -M_T0_RID481_S1_NC_029038.1:3990-4034_length:45_mod0000 -M_T0_RID482_S0_NC_031287.1:3748-3826_length:79_mod0000 -M_T0_RID483_S0_NC_029311.1:111589-111673_length:85_mod0000 -M_T0_RID484_S0_NZ_JBDYRX010000001.1:874633-874662_length:30_mod0000 -M_T0_RID484_S1_NZ_JBDYRX010000002.1:457659-457735_length:77_mod0000 -M_T0_RID487_S0_NC_023339.1:3452-3542_length:91_mod0000 -M_T0_RID488_S1_NC_030800.1:3767-3843_length:77_mod0000 -M_T0_RID490_S1_NC_028249.1:6706-6755_length:50_mod0000 -M_T0_RID490_S1_NC_033815.1:382-420_length:39_mod0000 -M_T0_RID491_S0_NC_029549.1:1543-1601_length:59_mod0000 -M_T0_RID491_S1_NC_023442.1:106362-106456_length:95_mod0001 -M_T0_RID491_S1_NZ_JBDYSJ010000002.1:433503-433622_length:120_mod0000 -M_T0_RID492_S1_NC_017967.1:4737-4790_length:54_mod0000 -M_T0_RID497_S1_NC_028231.1:2435-2530_length:96_mod0000 -M_T0_RID498_S1_NC_028368.1:10324-10389_length:66_mod0000 -M_T0_RID498_S1_NC_031088.1:10285-10350_length:66_mod0000 -M_T0_RID499_S0_NZ_JBDYLZ010000012.1:63930-64011_length:82_mod0000 -M_T0_RID500_S0_NZ_JBDYSJ010000003.1:369722-369827_length:106_mod0000 -M_T0_RID501_S0_NC_034214.1:4534-4626_length:93_mod0000 -M_T0_RID503_S1_NZ_JBDYLZ010000014.1:65584-65643_length:60_mod0001 -M_T0_RID504_S0_NC_033727.1:6181-6283_length:103_mod0000 -M_T0_RID504_S0_NC_037572.1:353-481_length:129_mod0000 -M_T0_RID506_S0_NZ_JBDYSJ010000001.1:230782-230869_length:88_mod0000 -M_T0_RID506_S1_NZ_JBDYRX010000001.1:155361-155441_length:81_mod0000 -M_T0_RID507_S0_NZ_JBDYRX010000001.1:64196-64251_length:56_mod0001 -M_T0_RID507_S0_NZ_JBDYRX010000002.1:311911-312021_length:111_mod0000 -M_T0_RID508_S1_NC_028382.1:618-664_length:47_mod0000 -M_T0_RID509_S0_NZ_JBDYRX010000002.1:83623-83710_length:88_mod0000 -M_T0_RID509_S0_NZ_JBDYSJ010000002.1:32694-32813_length:120_mod0000 -M_T0_RID512_S0_NC_031301.1:7499-7600_length:102_mod0000 -M_T0_RID512_S0_NZ_JBDYSJ010000001.1:497297-497384_length:88_mod0001 -M_T0_RID512_S1_NC_023299.1:173-222_length:50_mod0000 -M_T0_RID514_S0_NC_028144.1:1039-1130_length:92_mod0000 -M_T0_RID515_S1_NC_028239.1:1870-1935_length:66_mod0000 -M_T0_RID516_S0_NC_028099.1:69736-69811_length:76_mod0000 -M_T0_RID518_S0_NZ_JBDYSJ010000002.1:172879-172954_length:76_mod0000 -M_T0_RID518_S1_NC_028374.1:22488-22593_length:106_mod0000 -M_T0_RID519_S0_NZ_JBDYSJ010000004.1:83804-83909_length:106_mod0000 -M_T0_RID519_S1_NC_023442.1:37132-37228_length:97_mod0000 -M_T0_RID520_S1_NC_033821.1:5336-5462_length:127_mod0000 -M_T0_RID521_S1_NC_028362.1:8323-8409_length:87_mod0000 -M_T0_RID521_S1_NC_033620.1:165922-166009_length:88_mod0000 -M_T0_RID526_S0_NZ_JBDYLZ010000008.1:191196-191301_length:106_mod0000 -M_T0_RID527_S0_NZ_JBDYRX010000001.1:664374-664450_length:77_mod0000 -M_T0_RID530_S1_NC_029255.1:118676-118738_length:63_mod0000 -M_T0_RID531_S0_NC_030240.1:18050-18083_length:34_mod0000 -M_T0_RID535_S0_NZ_JBDYRX010000003.1:273784-273814_length:31_mod0000 -M_T0_RID535_S0_NZ_JBDYSJ010000001.1:408974-409045_length:72_mod0000 -M_T0_RID536_S1_NZ_JBDYLZ010000007.1:187492-187559_length:68_mod0001 -M_T0_RID537_S0_NC_031106.1:5925-5990_length:66_mod0000 -M_T0_RID539_S0_NC_023442.1:25605-25715_length:111_mod0000 -M_T0_RID539_S0_NC_030922.1:6177-6250_length:74_mod0000 -M_T0_RID539_S1_NC_033732.1:488-545_length:58_mod0000 -M_T0_RID539_S1_NZ_JBDYRX010000003.1:428710-428748_length:39_mod0000 -M_T0_RID540_S1_NC_028636.1:8122-8203_length:82_mod0000 -M_T0_RID540_S1_NC_033777.1:478-533_length:56_mod0000 -M_T0_RID541_S0_NZ_JBDYLZ010000009.1:17788-17882_length:95_mod0000 -M_T0_RID543_S0_NZ_JBDYLZ010000006.1:137222-137319_length:98_mod0000 -M_T0_RID545_S1_NC_033620.1:141319-141407_length:89_mod0000 -M_T0_RID547_S0_NC_029901.1:2272-2382_length:111_mod0000 -M_T0_RID548_S0_NC_027916.2:50899-50962_length:64_mod0000 -M_T0_RID549_S0_NZ_JBDYRX010000003.1:184280-184329_length:50_mod0000 -M_T0_RID549_S1_NC_027016.1:166476-166540_length:65_mod0001 -M_T0_RID552_S0_NC_031244.1:259-371_length:113_mod0000 -M_T0_RID552_S1_NZ_JBDYSJ010000001.1:904809-904898_length:90_mod0000 -M_T0_RID555_S0_NC_029255.1:86976-87025_length:50_mod0000 -M_T0_RID555_S0_NC_033700.1:23881-23958_length:78_mod0000 -M_T0_RID555_S1_NZ_JBDYSJ010000003.1:459317-459387_length:71_mod0000 -M_T0_RID556_S0_NC_029800.1:2415-2467_length:53_mod0000 -M_T0_RID556_S0_NZ_JBDYRX010000003.1:269557-269627_length:71_mod0000 -M_T0_RID556_S1_NC_018151.1:436-524_length:89_mod0000 -M_T0_RID556_S1_NC_029997.2:2602-2635_length:34_mod0000 -M_T0_RID560_S0_NC_030691.1:8709-8769_length:61_mod0000 -M_T0_RID563_S0_NZ_JBDYSJ010000001.1:279557-279665_length:109_mod0000 -M_T0_RID563_S1_NC_029255.1:16285-16387_length:103_mod0000 -M_T0_RID563_S1_NC_030651.1:8044-8106_length:63_mod0000 -M_T0_RID564_S1_NC_030380.1:905-947_length:43_mod0000 -M_T0_RID566_S0_NZ_JBDYRX010000002.1:228758-228796_length:39_mod0000 -M_T0_RID566_S1_NC_027916.2:158878-158953_length:76_mod0000 -M_T0_RID568_S0_NC_033718.1:5028-5099_length:72_mod0000 -M_T0_RID569_S1_NZ_JBDYSJ010000002.1:4445-4500_length:56_mod0000 -M_T0_RID571_S1_NC_030200.1:53402-53457_length:56_mod0000 -M_T0_RID571_S1_NC_031291.1:6265-6343_length:79_mod0000 -M_T0_RID573_S0_NZ_JBDYSJ010000001.1:821929-821988_length:60_mod0000 -M_T0_RID573_S1_NZ_JBDYRX010000002.1:420333-420420_length:88_mod0000 -M_T0_RID578_S0_NC_028389.1:883-929_length:47_mod0000 -M_T0_RID578_S1_NC_027920.1:2737-2802_length:66_mod0000 -M_T0_RID578_S1_NZ_JBDYRX010000001.1:125147-125264_length:118_mod0000 -M_T0_RID579_S1_NC_028636.1:80919-81006_length:88_mod0000 -M_T0_RID579_S1_NZ_JBDYRX010000003.1:600760-600842_length:83_mod0000 -M_T0_RID579_S1_NZ_JBDYSJ010000001.1:621908-622008_length:101_mod0000 -M_T0_RID580_S0_NC_031236.1:9639-9701_length:63_mod0000 -M_T0_RID580_S0_NC_033620.1:115666-115748_length:83_mod0000 -M_T0_RID584_S1_NZ_JBDYRX010000003.1:30143-30232_length:90_mod0000 -M_T0_RID587_S1_NC_030236.1:1921-2018_length:98_mod0000 -M_T0_RID588_S0_NZ_JBDYRX010000004.1:487902-487980_length:79_mod0000 -M_T0_RID592_S0_NZ_JBDYRX010000004.1:290162-290207_length:46_mod0000 -M_T0_RID596_S0_NC_028491.1:22873-22918_length:46_mod0000 -M_T0_RID597_S0_NZ_JBDYRX010000004.1:248380-248414_length:35_mod0000 -M_T0_RID598_S0_NZ_JBDYLZ010000013.1:99135-99225_length:91_mod0000 -M_T0_RID598_S0_NZ_JBDYRX010000004.1:521129-521194_length:66_mod0000 -M_T0_RID598_S1_NC_027781.1:1542-1623_length:82_mod0000 -M_T0_RID598_S1_NC_033828.1:1452-1571_length:120_mod0000 -M_T0_RID599_S0_NZ_JBDYLZ010000018.1:17132-17215_length:84_mod0000 -M_T0_RID601_S1_NZ_JBDYRX010000004.1:64749-64831_length:83_mod0000 -M_T0_RID601_S1_NZ_JBDYSJ010000004.1:72990-73054_length:65_mod0000 -M_T0_RID603_S1_NZ_JBDYRX010000003.1:148174-148218_length:45_mod0000 -M_T0_RID606_S1_NZ_JBDYRX010000004.1:81494-81540_length:47_mod0000 -M_T0_RID608_S1_NZ_JBDYLZ010000006.1:54120-54159_length:40_mod0000 -M_T0_RID608_S1_NZ_JBDYSJ010000003.1:75571-75624_length:54_mod0000 -M_T0_RID609_S0_NZ_JBDYLZ010000017.1:21746-21833_length:88_mod0000 -M_T0_RID610_S1_NZ_JBDYRX010000004.1:416636-416711_length:76_mod0000 -M_T0_RID617_S1_NZ_JBDYLZ010000013.1:81956-82016_length:61_mod0000 -M_T0_RID618_S0_NZ_JBDYRX010000001.1:154047-154079_length:33_mod0000 -M_T0_RID619_S0_NZ_JBDYRX010000001.1:929162-929284_length:123_mod0000 -M_T0_RID620_S1_NZ_JBDYRX010000004.1:231083-231194_length:112_mod0000 -M_T0_RID622_S0_NC_029117.1:1274-1341_length:68_mod0000 -M_T0_RID625_S1_NZ_JBDYRX010000003.1:351246-351297_length:52_mod0000 -M_T0_RID626_S0_NZ_JBDYRX010000003.1:54224-54264_length:41_mod0000 -M_T0_RID627_S1_NZ_JBDYRX010000002.1:425465-425547_length:83_mod0000 -M_T0_RID629_S1_NC_028264.1:4326-4405_length:80_mod0000 -M_T0_RID630_S0_NZ_JBDYSJ010000002.1:388835-388868_length:34_mod0000 -M_T0_RID633_S1_NZ_JBDYRX010000003.1:253941-254012_length:72_mod0000 -M_T0_RID634_S1_NC_033815.1:2695-2865_length:171_mod0000 -M_T0_RID635_S1_NC_033700.1:17426-17511_length:86_mod0000 -M_T0_RID636_S0_NC_029086.1:7004-7042_length:39_mod0000 -M_T0_RID638_S1_NZ_JBDYSJ010000001.1:82298-82352_length:55_mod0000 -M_T0_RID640_S0_NC_033756.1:5658-5786_length:129_mod0001 -M_T0_RID641_S0_NC_027706.1:187-292_length:106_mod0000 -M_T0_RID642_S0_NC_034266.1:154137-154203_length:67_mod0000 -M_T0_RID642_S0_NZ_JBDYRX010000003.1:290122-290229_length:108_mod0000 -M_T0_RID643_S0_NC_017937.1:1077-1164_length:88_mod0000 -M_T0_RID643_S0_NZ_JBDYRX010000002.1:527817-527928_length:112_mod0000 -M_T0_RID645_S0_NC_030799.1:4650-4688_length:39_mod0000 -M_T0_RID645_S1_NZ_JBDYLZ010000008.1:186276-186348_length:73_mod0000 -M_T0_RID651_S1_NC_033733.1:2956-3039_length:84_mod0001 -M_T0_RID651_S1_NZ_JBDYRX010000001.1:479171-479229_length:59_mod0000 -M_T0_RID653_S1_NC_029311.1:77186-77261_length:76_mod0000 -M_T0_RID654_S0_NZ_JBDYSJ010000001.1:904727-904802_length:76_mod0000 -M_T0_RID655_S0_NZ_JBDYSJ010000001.1:482269-482365_length:97_mod0000 -M_T0_RID655_S1_NZ_JBDYRX010000002.1:520330-520420_length:91_mod0000 -M_T0_RID656_S0_NC_028259.1:1542-1591_length:50_mod0000 -M_T0_RID656_S0_NZ_JBDYLZ010000019.1:6097-6185_length:89_mod0000 -M_T0_RID660_S1_NC_034266.1:157401-157477_length:77_mod0000 -M_T0_RID664_S0_NC_027916.2:59946-59993_length:48_mod0000 -M_T0_RID664_S0_NZ_JBDYLZ010000015.1:82686-82741_length:56_mod0000 -M_T0_RID664_S0_NZ_JBDYSJ010000003.1:87421-87503_length:83_mod0000 -M_T0_RID668_S0_NZ_JBDYRX010000004.1:18573-18663_length:91_mod0000 -M_T0_RID670_S0_NC_027920.1:1301-1393_length:93_mod0000 -M_T0_RID673_S1_NC_033703.1:545-616_length:72_mod0000 -M_T0_RID673_S1_NZ_JBDYRX010000001.1:644803-644895_length:93_mod0000 -M_T0_RID679_S0_NZ_JBDYRX010000002.1:605076-605139_length:64_mod0000 -M_T0_RID679_S1_NC_033703.1:1306-1364_length:59_mod0000 -M_T0_RID680_S0_NZ_JBDYRX010000002.1:632837-632879_length:43_mod0000 -M_T0_RID681_S1_NZ_JBDYSJ010000002.1:496144-496188_length:45_mod0000 -M_T0_RID682_S0_NZ_JBDYSJ010000001.1:116469-116509_length:41_mod0000 -M_T0_RID683_S0_NZ_JBDYRX010000001.1:675311-675352_length:42_mod0000 -M_T0_RID683_S0_NZ_JBDYSJ010000004.1:71365-71456_length:92_mod0000 -M_T0_RID683_S1_NC_029255.1:7610-7675_length:66_mod0000 -M_T0_RID686_S0_NC_027429.1:2932-2966_length:35_mod0000 -M_T0_RID686_S1_NC_027923.1:107955-107999_length:45_mod0000 -M_T0_RID686_S1_NC_029132.1:95050-95160_length:111_mod0000 -M_T0_RID689_S1_NZ_JBDYSJ010000004.1:138231-138318_length:88_mod0000 -M_T0_RID691_S1_NC_033710.1:3870-3926_length:57_mod0000 -M_T0_RID692_S1_NC_027531.1:1508-1612_length:105_mod0000 -M_T0_RID695_S0_NC_030200.1:124072-124139_length:68_mod0000 -M_T0_RID697_S0_NC_028921.1:5390-5470_length:81_mod0000 -M_T0_RID699_S0_NC_031083.1:4910-4975_length:66_mod0000 -M_T0_RID699_S1_NZ_JBDYLZ010000010.1:101894-101946_length:53_mod0000 -M_T0_RID700_S1_NZ_JBDYSJ010000001.1:915360-915453_length:94_mod0000 -M_T0_RID702_S1_NC_028099.1:63829-63929_length:101_mod0000 -M_T0_RID706_S0_NC_027210.1:7432-7505_length:74_mod0000 -M_T0_RID707_S1_NZ_JBDYRX010000002.1:367432-367522_length:91_mod0001 -M_T0_RID707_S1_NZ_JBDYSJ010000004.1:260063-260128_length:66_mod0000 -M_T0_RID709_S1_NZ_JBDYRX010000003.1:29327-29484_length:158_mod0000 -M_T0_RID710_S1_NC_033720.1:7987-8089_length:103_mod0000 -M_T0_RID711_S0_NZ_JBDYLZ010000006.1:173182-173278_length:97_mod0000 -M_T0_RID711_S1_NC_033700.1:20537-20567_length:31_mod0000 -M_T0_RID711_S1_NZ_JBDYSJ010000001.1:181184-181271_length:88_mod0000 -M_T0_RID714_S0_NC_037612.1:3005-3122_length:118_mod0000 -M_T0_RID715_S0_NC_027788.1:468-551_length:84_mod0000 -M_T0_RID715_S1_NZ_JBDYLZ010000006.1:219162-219260_length:99_mod0000 -M_T0_RID717_S0_NC_030654.1:1669-1721_length:53_mod0000 -M_T0_RID719_S1_NZ_JBDYSJ010000001.1:826609-826678_length:70_mod0000 -M_T0_RID722_S1_NC_027923.1:41169-41259_length:91_mod0001 -M_T0_RID727_S0_NC_029997.2:28478-28523_length:46_mod0000 -M_T0_RID728_S0_NZ_JBDYRX010000002.1:879157-879230_length:74_mod0000 -M_T0_RID729_S1_NZ_JBDYLZ010000008.1:194207-194253_length:47_mod0000 -M_T0_RID731_S1_NC_030117.1:17286-17318_length:33_mod0000 -M_T0_RID736_S0_NZ_JBDYRX010000001.1:178466-178588_length:123_mod0000 -M_T0_RID737_S0_NC_028491.1:18226-18284_length:59_mod0000 -M_T0_RID739_S1_NZ_JBDYLZ010000011.1:127333-127376_length:44_mod0000 -M_T0_RID743_S0_NC_037573.1:1169-1247_length:79_mod0000 -M_T0_RID747_S1_NZ_JBDYRX010000002.1:430138-430204_length:67_mod0000 -M_T0_RID749_S1_NZ_JBDYRX010000003.1:71924-71986_length:63_mod0000 -M_T0_RID752_S0_NC_031336.1:9006-9046_length:41_mod0000 -M_T0_RID753_S0_NZ_JBDYSJ010000003.1:446526-446575_length:50_mod0000 -M_T0_RID757_S0_NC_028136.1:1312-1355_length:44_mod0000 -M_T0_RID757_S1_NC_027016.1:202899-202969_length:71_mod0000 -M_T0_RID757_S1_NZ_JBDYRX010000004.1:461576-461693_length:118_mod0000 -M_T0_RID759_S1_NC_029691.1:3622-3733_length:112_mod0000 -M_T0_RID763_S1_NC_027916.2:99012-99086_length:75_mod0000 -M_T0_RID763_S1_NC_028265.1:10302-10344_length:43_mod0000 -M_T0_RID763_S1_NC_030798.1:7132-7233_length:102_mod0000 -M_T0_RID763_S1_NZ_JBDYLZ010000015.1:37189-37249_length:61_mod0000 -M_T0_RID765_S0_NC_028261.1:4356-4443_length:88_mod0000 -M_T0_RID767_S1_NC_027916.2:86943-87045_length:103_mod0000 -M_T0_RID768_S0_NC_028491.1:2854-2933_length:80_mod0000 -M_T0_RID768_S0_NC_030200.1:40203-40312_length:110_mod0000 -M_T0_RID771_S0_NZ_JBDYLZ010000019.1:13804-13871_length:68_mod0000 -M_T0_RID778_S1_NC_031275.1:5153-5201_length:49_mod0000 -M_T0_RID781_S1_NZ_JBDYRX010000003.1:540287-540355_length:69_mod0000 -M_T0_RID783_S1_NZ_JBDYLZ010000010.1:89260-89349_length:90_mod0000 -M_T0_RID785_S1_NC_027199.1:11719-11818_length:100_mod0000 -M_T0_RID786_S1_NZ_JBDYLZ010000008.1:173777-173859_length:83_mod0000 -M_T0_RID788_S0_NC_030922.1:1394-1483_length:90_mod0000 -M_T0_RID793_S0_NZ_JBDYRX010000003.1:539904-539954_length:51_mod0001 -M_T0_RID797_S1_NZ_JBDYRX010000004.1:414620-414694_length:75_mod0000 -M_T0_RID807_S1_NC_030117.1:45331-45378_length:48_mod0000 -M_T0_RID810_S0_NC_028491.1:85062-85136_length:75_mod0001 -M_T0_RID811_S1_NC_030697.1:295-351_length:57_mod0000 -M_T0_RID813_S1_NC_027016.1:91244-91325_length:82_mod0000 -M_T0_RID817_S1_NC_030240.1:108663-108730_length:68_mod0001 -M_T0_RID823_S0_NC_033620.1:158427-158465_length:39_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000003.1:241332-241406_length:75_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000004.1:228843-228928_length:86_mod0000 -M_T0_RID827_S0_NZ_JBDYSJ010000004.1:239871-239973_length:103_mod0000 -M_T0_RID832_S0_NZ_JBDYLZ010000015.1:88774-88854_length:81_mod0000 -M_T0_RID833_S0_NZ_JBDYSJ010000001.1:590978-591039_length:62_mod0000 -M_T0_RID837_S1_NZ_JBDYRX010000001.1:656888-656964_length:77_mod0000 -M_T0_RID840_S0_NC_028396.1:529-621_length:93_mod0000 -M_T0_RID844_S1_NZ_JBDYLZ010000007.1:237741-237786_length:46_mod0000 -M_T0_RID847_S0_NZ_JBDYRX010000003.1:703429-703507_length:79_mod0000 -M_T0_RID852_S0_NC_030240.1:105292-105367_length:76_mod0000 -M_T0_RID856_S0_NZ_JBDYRX010000003.1:28070-28132_length:63_mod0000 -M_T0_RID856_S1_NC_027644.1:3712-3804_length:93_mod0000 -M_T0_RID858_S0_NZ_JBDYSJ010000003.1:197400-197485_length:86_mod0000 -M_T0_RID858_S1_NZ_JBDYSJ010000004.1:175908-175948_length:41_mod0000 -M_T0_RID859_S0_NC_033777.1:2010-2066_length:57_mod0000 -M_T0_RID862_S1_NC_030799.1:1806-1881_length:76_mod0000 -M_T0_RID865_S1_NZ_JBDYSJ010000002.1:326035-326087_length:53_mod0000 -M_T0_RID873_S1_NC_028119.1:2502-2583_length:82_mod0000 -M_T0_RID880_S0_NC_033620.1:55069-55148_length:80_mod0000 -M_T0_RID882_S0_NZ_JBDYRX010000002.1:484332-484416_length:85_mod0000 -M_T0_RID882_S1_NC_034266.1:103121-103153_length:33_mod0000 -M_T0_RID885_S0_NZ_JBDYRX010000003.1:244205-244252_length:48_mod0000 -M_T0_RID885_S1_NC_036636.1:5051-5143_length:93_mod0000 -M_T0_RID887_S0_NC_029132.1:58239-58309_length:71_mod0000 -M_T0_RID895_S1_NZ_JBDYRX010000004.1:290403-290535_length:133_mod0000 -M_T0_RID900_S0_NZ_JBDYRX010000003.1:442650-442708_length:59_mod0000 -M_T0_RID903_S0_NC_029994.1:1129-1161_length:33_mod0000 -M_T0_RID910_S1_NC_030801.1:531-591_length:61_mod0000 -M_T0_RID913_S1_NZ_JBDYSJ010000001.1:289314-289350_length:37_mod0000 -M_T0_RID923_S1_NC_028374.1:1835-1919_length:85_mod0000 -M_T0_RID930_S0_NC_033727.1:5848-5935_length:88_mod0000 -M_T0_RID941_S0_NZ_JBDYLZ010000020.1:17961-18008_length:48_mod0000 -M_T0_RID951_S0_NZ_JBDYLZ010000007.1:258088-258169_length:82_mod0000 -M_T0_RID960_S1_NZ_JBDYRX010000001.1:365497-365549_length:53_mod0000 -M_T0_RID963_S0_NZ_JBDYSJ010000002.1:471116-471242_length:127_mod0000 -M_T0_RID967_S0_NC_028145.1:2423-2491_length:69_mod0000 -M_T0_RID969_S1_NC_027917.1:3392-3477_length:86_mod0000 -M_T0_RID973_S1_NC_028243.1:233-298_length:66_mod0000 -M_T0_RID975_S0_NZ_JBDYLZ010000006.1:262785-262833_length:49_mod0000 -M_T0_RID977_S0_NC_029311.1:110890-110930_length:41_mod0000 -M_T0_RID978_S1_NC_033707.1:4471-4569_length:99_mod0000 -M_T0_RID978_S1_NZ_JBDYLZ010000011.1:12262-12308_length:47_mod0000 -M_T0_RID987_S1_NZ_JBDYRX010000002.1:268856-268924_length:69_mod0000 -M_T0_RID993_S0_NZ_JBDYSJ010000002.1:495946-496025_length:80_mod0000 -M_T0_RID997_S0_NC_029303.1:1692-1771_length:80_mod0000 -M_T0_RID1003_S0_NZ_JBDYSJ010000001.1:678727-678783_length:57_mod0000 -M_T0_RID1022_S1_NC_030746.1:3635-3726_length:92_mod0000 -M_T0_RID1023_S1_NZ_JBDYLZ010000006.1:264893-265013_length:121_mod0000 -M_T0_RID1048_S0_NZ_JBDYLZ010000008.1:126930-127042_length:113_mod0000 -M_T0_RID1070_S0_NZ_JBDYRX010000003.1:112054-112158_length:105_mod0000 diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/expected/temp/reads/prefilter/merge/Lib_LVsim1_collapsed.read_ids b/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/expected/temp/reads/prefilter/merge/Lib_LVsim1_collapsed.read_ids deleted file mode 100644 index fa544d4..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_merge/expected/temp/reads/prefilter/merge/Lib_LVsim1_collapsed.read_ids +++ /dev/null @@ -1,1300 +0,0 @@ -M_T0_RID0_S0_NC_030117.1:111953-112007_length:55_mod0000 -M_T0_RID0_S0_NZ_JBDYLZ010000006.1:232651-232713_length:63_mod0000 -M_T0_RID0_S0_NZ_JBDYRX010000003.1:638778-638845_length:68_mod0000 -M_T0_RID0_S0_NZ_JBDYSJ010000001.1:480453-480521_length:69_mod0000 -M_T0_RID0_S1_NC_029996.1:52049-52114_length:66_mod0000 -M_T0_RID0_S1_NC_029997.2:98154-98247_length:94_mod0001 -M_T0_RID0_S1_NC_033619.1:5054-5125_length:72_mod0000 -M_T0_RID1_S0_NZ_JBDYLZ010000006.1:89475-89546_length:72_mod0000 -M_T0_RID2_S0_NC_030240.1:124812-124864_length:53_mod0000 -M_T0_RID2_S0_NZ_JBDYLZ010000014.1:79367-79450_length:84_mod0000 -M_T0_RID2_S1_NC_029132.1:78897-78961_length:65_mod0000 -M_T0_RID3_S1_NC_029996.1:125237-125310_length:74_mod0000 -M_T0_RID3_S1_NC_030229.1:666-744_length:79_mod0000 -M_T0_RID4_S0_NZ_JBDYRX010000001.1:960749-960798_length:50_mod0000 -M_T0_RID4_S1_NZ_JBDYSJ010000003.1:80602-80671_length:70_mod0000 -M_T0_RID5_S0_NC_028371.1:3473-3533_length:61_mod0000 -M_T0_RID5_S0_NZ_JBDYLZ010000014.1:31093-31169_length:77_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000003.1:463476-463555_length:80_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000004.1:91279-91382_length:104_mod0000 -M_T0_RID5_S1_NC_031272.1:12737-12796_length:60_mod0000 -M_T0_RID5_S1_NZ_JBDYSJ010000001.1:152930-152976_length:47_mod0000 -M_T0_RID6_S0_NC_018093.1:1833-1947_length:115_mod0000 -M_T0_RID6_S1_NZ_JBDYSJ010000001.1:525478-525555_length:78_mod0000 -M_T0_RID7_S0_NC_027121.1:14835-14908_length:74_mod0000 -M_T0_RID7_S0_NC_030117.1:123232-123357_length:126_mod0000 -M_T0_RID7_S0_NC_033733.1:1775-1866_length:92_mod0000 -M_T0_RID7_S0_NC_033757.1:335-408_length:74_mod0000 -M_T0_RID7_S0_NC_033816.1:2121-2169_length:49_mod0000 -M_T0_RID7_S0_NZ_JBDYRX010000001.1:768041-768147_length:107_mod0000 -M_T0_RID7_S1_NZ_JBDYRX010000003.1:741729-741847_length:119_mod0000 -M_T0_RID8_S0_NC_028255.1:2339-2453_length:115_mod0000 -M_T0_RID8_S0_NC_028362.1:3644-3681_length:38_mod0000 -M_T0_RID8_S0_NC_030295.1:5058-5146_length:89_mod0000 -M_T0_RID8_S0_NZ_JBDYLZ010000011.1:65064-65142_length:79_mod0000 -M_T0_RID8_S1_NC_029996.1:15385-15439_length:55_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000001.1:372140-372170_length:31_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000002.1:184902-185028_length:127_mod0000 -M_T0_RID9_S0_NC_018175.1:751-814_length:64_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000001.1:128705-128756_length:52_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000003.1:717567-717638_length:72_mod0000 -M_T0_RID9_S1_NZ_JBDYRX010000001.1:708791-708875_length:85_mod0001 -M_T0_RID10_S1_NC_034266.1:180760-180821_length:62_mod0000 -M_T0_RID11_S0_NC_027126.1:6629-6712_length:84_mod0000 -M_T0_RID11_S0_NC_027426.1:3579-3717_length:139_mod0000 -M_T0_RID11_S1_NC_030117.1:3968-4065_length:98_mod0000 -M_T0_RID12_S0_NC_027016.1:206020-206105_length:86_mod0000 -M_T0_RID13_S0_NC_027915.1:11194-11270_length:77_mod0000 -M_T0_RID13_S1_NZ_JBDYLZ010000012.1:21748-21797_length:50_mod0000 -M_T0_RID13_S1_NZ_JBDYSJ010000002.1:219548-219618_length:71_mod0000 -M_T0_RID14_S0_NC_033816.1:7896-7995_length:100_mod0000 -M_T0_RID14_S0_NZ_JBDYRX010000001.1:272205-272307_length:103_mod0000 -M_T0_RID14_S0_NZ_JBDYSJ010000001.1:204692-204745_length:54_mod0000 -M_T0_RID14_S1_NC_031321.1:1201-1285_length:85_mod0000 -M_T0_RID14_S1_NC_034217.1:1799-1845_length:47_mod0000 -M_T0_RID15_S0_NZ_JBDYSJ010000001.1:485204-485240_length:37_mod0001 -M_T0_RID15_S1_NC_023442.1:20190-20253_length:64_mod0001 -M_T0_RID15_S1_NC_028259.1:6855-6912_length:58_mod0000 -M_T0_RID15_S1_NZ_JBDYLZ010000014.1:31347-31473_length:127_mod0000 -M_T0_RID16_S0_NC_033718.1:9155-9282_length:128_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000014.1:112132-112219_length:88_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000018.1:30565-30632_length:68_mod0001 -M_T0_RID17_S1_NC_030658.1:888-970_length:83_mod0001 -M_T0_RID17_S1_NC_030873.1:769-848_length:80_mod0000 -M_T0_RID17_S1_NZ_JBDYRX010000004.1:479027-479133_length:107_mod0000 -M_T0_RID17_S1_NZ_JBDYSJ010000002.1:142153-142239_length:87_mod0000 -M_T0_RID18_S0_NC_033830.1:429-498_length:70_mod0000 -M_T0_RID18_S1_NC_027429.1:4469-4544_length:76_mod0000 -M_T0_RID19_S0_NC_028491.1:2563-2618_length:56_mod0000 -M_T0_RID19_S0_NC_031227.1:5693-5751_length:59_mod0000 -M_T0_RID20_S1_NC_029562.1:5000-5036_length:37_mod0000 -M_T0_RID20_S1_NZ_JBDYSJ010000004.1:235888-235979_length:92_mod0000 -M_T0_RID21_S0_NC_028242.1:2691-2737_length:47_mod0000 -M_T0_RID21_S0_NC_029052.1:6412-6494_length:83_mod0000 -M_T0_RID21_S0_NZ_JBDYSJ010000002.1:218541-218623_length:83_mod0000 -M_T0_RID21_S1_NZ_JBDYLZ010000006.1:140228-140329_length:102_mod0000 -M_T0_RID21_S1_NZ_JBDYRX010000001.1:693665-693710_length:46_mod0000 -M_T0_RID22_S0_NC_030402.1:754-835_length:82_mod0000 -M_T0_RID22_S0_NC_034216.1:12941-13048_length:108_mod0000 -M_T0_RID22_S1_NZ_JBDYRX010000001.1:435105-435213_length:109_mod0000 -M_T0_RID23_S0_NC_030701.1:5103-5151_length:49_mod0000 -M_T0_RID23_S0_NC_033762.1:10-98_length:89_mod0000 -M_T0_RID23_S0_NC_037617.1:942-1060_length:119_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000002.1:499806-499888_length:83_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000004.1:201196-201277_length:82_mod0000 -M_T0_RID23_S1_NC_031275.1:7710-7771_length:62_mod0000 -M_T0_RID24_S0_NC_030240.1:57723-57766_length:44_mod0000 -M_T0_RID24_S0_NZ_JBDYLZ010000012.1:969-1002_length:34_mod0000 -M_T0_RID24_S0_NZ_JBDYRX010000001.1:197011-197061_length:51_mod0000 -M_T0_RID24_S1_NC_027121.1:8433-8469_length:37_mod0000 -M_T0_RID24_S1_NZ_JBDYRX010000001.1:668610-668664_length:55_mod0000 -M_T0_RID25_S0_NZ_JBDYSJ010000002.1:6311-6403_length:93_mod0000 -M_T0_RID25_S1_NC_029997.2:85189-85282_length:94_mod0000 -M_T0_RID25_S1_NC_034384.1:2318-2377_length:60_mod0000 -M_T0_RID25_S1_NZ_JBDYRX010000002.1:614807-614869_length:63_mod0000 -M_T0_RID25_S1_NZ_JBDYSJ010000004.1:88035-88153_length:119_mod0000 -M_T0_RID26_S0_NC_028491.1:86460-86530_length:71_mod0000 -M_T0_RID26_S0_NZ_JBDYSJ010000003.1:64065-64167_length:103_mod0000 -M_T0_RID26_S1_NZ_JBDYSJ010000002.1:180789-180849_length:61_mod0001 -M_T0_RID27_S0_NZ_JBDYRX010000002.1:879317-879417_length:101_mod0001 -M_T0_RID27_S0_NZ_JBDYSJ010000002.1:371147-371261_length:115_mod0000 -M_T0_RID27_S1_NC_024911.1:1404-1530_length:127_mod0000 -M_T0_RID27_S1_NC_034266.1:112117-112169_length:53_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000003.1:302019-302061_length:43_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000004.1:327071-327150_length:80_mod0001 -M_T0_RID28_S0_NC_027812.1:1778-1877_length:100_mod0000 -M_T0_RID28_S0_NC_028833.1:23931-24017_length:87_mod0000 -M_T0_RID28_S0_NC_034159.1:870-906_length:37_mod0000 -M_T0_RID28_S0_NZ_JBDYSJ010000003.1:260828-260864_length:37_mod0000 -M_T0_RID29_S0_NC_027137.1:5905-5940_length:36_mod0000 -M_T0_RID29_S0_NC_027208.1:2702-2783_length:82_mod0000 -M_T0_RID29_S0_NC_029996.1:60558-60653_length:96_mod0000 -M_T0_RID29_S0_NC_033722.1:167-248_length:82_mod0000 -M_T0_RID30_S0_NC_017977.1:8983-9015_length:33_mod0000 -M_T0_RID30_S0_NC_034219.1:4140-4199_length:60_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000001.1:753768-753819_length:52_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000002.1:441798-441831_length:34_mod0000 -M_T0_RID30_S0_NZ_JBDYSJ010000001.1:878513-878614_length:102_mod0000 -M_T0_RID30_S1_NC_028492.1:144-210_length:67_mod0000 -M_T0_RID30_S1_NZ_JBDYRX010000004.1:168829-168933_length:105_mod0000 -M_T0_RID30_S1_NZ_JBDYSJ010000002.1:584020-584104_length:85_mod0000 -M_T0_RID31_S0_NZ_JBDYSJ010000002.1:273852-273897_length:46_mod0000 -M_T0_RID31_S1_NC_031450.1:2281-2311_length:31_mod0000 -M_T0_RID31_S1_NZ_JBDYSJ010000002.1:454313-454400_length:88_mod0000 -M_T0_RID32_S0_NC_023442.1:31719-31785_length:67_mod0000 -M_T0_RID32_S1_NC_028133.1:1439-1562_length:124_mod0000 -M_T0_RID32_S1_NZ_JBDYSJ010000002.1:412312-412351_length:40_mod0000 -M_T0_RID33_S1_NC_034266.1:78437-78516_length:80_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000001.1:102672-102747_length:76_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000002.1:784464-784511_length:48_mod0000 -M_T0_RID33_S1_NZ_JBDYSJ010000003.1:324967-325032_length:66_mod0000 -M_T0_RID34_S0_NC_018457.1:737-780_length:44_mod0000 -M_T0_RID34_S0_NC_028253.1:2464-2519_length:56_mod0000 -M_T0_RID34_S0_NZ_JBDYRX010000003.1:19821-19946_length:126_mod0000 -M_T0_RID34_S1_NC_029255.1:103099-103196_length:98_mod0000 -M_T0_RID34_S1_NZ_JBDYRX010000001.1:214312-214398_length:87_mod0001 -M_T0_RID35_S0_NZ_JBDYRX010000001.1:286577-286647_length:71_mod0000 -M_T0_RID35_S0_NZ_JBDYRX010000002.1:303458-303514_length:57_mod0000 -M_T0_RID35_S1_NC_028374.1:16776-16870_length:95_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:363132-363178_length:47_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:829523-829581_length:59_mod0000 -M_T0_RID36_S0_NC_029311.1:99001-99097_length:97_mod0000 -M_T0_RID37_S0_NC_033620.1:94230-94306_length:77_mod0000 -M_T0_RID37_S0_NZ_JBDYLZ010000012.1:26095-26141_length:47_mod0000 -M_T0_RID37_S1_NC_029311.1:32048-32093_length:46_mod0000 -M_T0_RID37_S1_NZ_JBDYSJ010000001.1:902396-902441_length:46_mod0000 -M_T0_RID38_S0_NC_030691.1:6883-6932_length:50_mod0000 -M_T0_RID38_S1_NZ_JBDYRX010000004.1:200501-200575_length:75_mod0000 -M_T0_RID39_S1_NC_028136.1:1274-1340_length:67_mod0000 -M_T0_RID39_S1_NZ_JBDYSJ010000002.1:503066-503117_length:52_mod0000 -M_T0_RID40_S0_NC_030234.1:4344-4414_length:71_mod0000 -M_T0_RID41_S0_NC_031088.1:9201-9299_length:99_mod0000 -M_T0_RID41_S0_NZ_JBDYLZ010000009.1:31815-31852_length:38_mod0000 -M_T0_RID41_S1_NC_028244.1:5988-6042_length:55_mod0000 -M_T0_RID41_S1_NZ_JBDYLZ010000006.1:65238-65362_length:125_mod0000 -M_T0_RID41_S1_NZ_JBDYRX010000003.1:765215-765280_length:66_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:32817-32939_length:123_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:462782-462843_length:62_mod0000 -M_T0_RID43_S0_NZ_JBDYLZ010000008.1:49878-49973_length:96_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000001.1:889979-890062_length:84_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000004.1:406662-406696_length:35_mod0000 -M_T0_RID44_S1_NZ_JBDYLZ010000006.1:90744-90777_length:34_mod0000 -M_T0_RID45_S0_NC_027712.1:10734-10821_length:88_mod0000 -M_T0_RID45_S0_NC_029311.1:44548-44620_length:73_mod0000 -M_T0_RID45_S0_NC_030693.1:5273-5361_length:89_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000008.1:40421-40495_length:75_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000009.1:55082-55112_length:31_mod0000 -M_T0_RID45_S1_NC_028232.1:6596-6658_length:63_mod0000 -M_T0_RID46_S0_NZ_JBDYSJ010000003.1:168383-168513_length:131_mod0000 -M_T0_RID47_S0_NC_029932.1:1175-1250_length:76_mod0000 -M_T0_RID47_S1_NC_027633.1:3344-3412_length:69_mod0000 -M_T0_RID48_S0_NC_018174.1:5223-5261_length:39_mod0000 -M_T0_RID48_S0_NC_023443.1:462-562_length:101_mod0000 -M_T0_RID48_S0_NZ_JBDYRX010000002.1:697197-697270_length:74_mod0000 -M_T0_RID49_S0_NC_029309.1:6196-6271_length:76_mod0000 -M_T0_RID49_S0_NZ_JBDYRX010000002.1:627468-627514_length:47_mod0000 -M_T0_RID49_S1_NC_028375.1:6864-6975_length:112_mod0000 -M_T0_RID50_S0_NC_027634.1:1642-1737_length:96_mod0000 -M_T0_RID50_S0_NC_030117.1:58855-58929_length:75_mod0000 -M_T0_RID50_S0_NC_030397.1:2093-2139_length:47_mod0001 -M_T0_RID50_S0_NZ_JBDYRX010000002.1:579910-579949_length:40_mod0000 -M_T0_RID50_S1_NC_028099.1:106360-106431_length:72_mod0000 -M_T0_RID50_S1_NZ_JBDYLZ010000012.1:83521-83604_length:84_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:803598-803655_length:58_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:945690-945779_length:90_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000006.1:184353-184397_length:45_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000018.1:32304-32360_length:57_mod0000 -M_T0_RID51_S1_NZ_JBDYRX010000001.1:868994-869082_length:89_mod0000 -M_T0_RID51_S1_NZ_JBDYSJ010000003.1:168788-168850_length:63_mod0000 -M_T0_RID52_S0_NZ_JBDYRX010000002.1:889544-889674_length:131_mod0000 -M_T0_RID52_S1_NC_030801.1:2462-2542_length:81_mod0000 -M_T0_RID53_S0_NC_029053.1:3050-3132_length:83_mod0000 -M_T0_RID53_S0_NC_033792.1:955-1008_length:54_mod0000 -M_T0_RID53_S0_NZ_JBDYRX010000003.1:127692-127758_length:67_mod0000 -M_T0_RID53_S1_NC_027533.1:2013-2051_length:39_mod0000 -M_T0_RID53_S1_NC_031307.1:5253-5307_length:55_mod0000 -M_T0_RID54_S0_NC_031079.1:45-96_length:52_mod0000 -M_T0_RID54_S1_NC_027712.1:6686-6777_length:92_mod0000 -M_T0_RID54_S1_NC_029996.1:22662-22724_length:63_mod0000 -M_T0_RID55_S0_NC_030141.1:2102-2247_length:146_mod0000 -M_T0_RID55_S0_NC_031304.1:2692-2762_length:71_mod0000 -M_T0_RID55_S0_NC_033704.1:4049-4166_length:118_mod0000 -M_T0_RID55_S0_NZ_JBDYRX010000001.1:247013-247049_length:37_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:448811-448874_length:64_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:513869-513936_length:68_mod0000 -M_T0_RID56_S0_NC_027016.1:52570-52626_length:57_mod0000 -M_T0_RID56_S0_NC_031449.1:9465-9556_length:92_mod0000 -M_T0_RID56_S0_NZ_JBDYLZ010000007.1:245259-245319_length:61_mod0001 -M_T0_RID56_S1_NZ_JBDYLZ010000007.1:103507-103590_length:84_mod0000 -M_T0_RID57_S0_NC_018070.1:8325-8447_length:123_mod0000 -M_T0_RID57_S0_NC_027426.1:3804-3851_length:48_mod0000 -M_T0_RID57_S1_NC_028099.1:83564-83601_length:38_mod0000 -M_T0_RID58_S0_NC_027121.1:14888-14980_length:93_mod0000 -M_T0_RID58_S0_NC_029550.1:232-272_length:41_mod0000 -M_T0_RID58_S1_NZ_JBDYLZ010000015.1:60370-60453_length:84_mod0000 -M_T0_RID59_S0_NZ_JBDYLZ010000011.1:108912-108996_length:85_mod0000 -M_T0_RID59_S0_NZ_JBDYRX010000004.1:15220-15308_length:89_mod0000 -M_T0_RID60_S1_NC_027641.1:1140-1184_length:45_mod0000 -M_T0_RID60_S1_NC_029085.1:8080-8154_length:75_mod0001 -M_T0_RID60_S1_NZ_JBDYRX010000001.1:262196-262266_length:71_mod0000 -M_T0_RID60_S1_NZ_JBDYSJ010000002.1:87924-88000_length:77_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:191465-191498_length:34_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:569149-569214_length:66_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000003.1:457685-457761_length:77_mod0000 -M_T0_RID62_S0_NC_023303.1:251-301_length:51_mod0000 -M_T0_RID62_S0_NZ_JBDYRX010000001.1:304278-304333_length:56_mod0000 -M_T0_RID62_S1_NC_023427.1:835-900_length:66_mod0000 -M_T0_RID62_S1_NC_027016.1:54356-54406_length:51_mod0000 -M_T0_RID62_S1_NC_028133.1:2961-2996_length:36_mod0000 -M_T0_RID62_S1_NC_031083.1:3710-3834_length:125_mod0000 -M_T0_RID62_S1_NC_031463.1:8948-8994_length:47_mod0000 -M_T0_RID62_S1_NZ_JBDYRX010000003.1:182597-182668_length:72_mod0001 -M_T0_RID62_S1_NZ_JBDYSJ010000001.1:192588-192667_length:80_mod0001 -M_T0_RID63_S0_NC_028144.1:6011-6113_length:103_mod0000 -M_T0_RID63_S0_NC_030240.1:102727-102785_length:59_mod0000 -M_T0_RID63_S0_NC_033760.1:1443-1573_length:131_mod0000 -M_T0_RID63_S0_NZ_JBDYLZ010000020.1:7118-7208_length:91_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000002.1:745773-745875_length:103_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000003.1:142067-142124_length:58_mod0000 -M_T0_RID63_S0_NZ_JBDYSJ010000003.1:151524-151569_length:46_mod0000 -M_T0_RID63_S1_NC_031236.1:11052-11140_length:89_mod0001 -M_T0_RID64_S0_NC_030748.1:1054-1124_length:71_mod0000 -M_T0_RID64_S1_NC_031093.1:6116-6176_length:61_mod0000 -M_T0_RID66_S0_NZ_JBDYLZ010000015.1:96499-96580_length:82_mod0000 -M_T0_RID66_S0_NZ_JBDYSJ010000002.1:346193-346225_length:33_mod0000 -M_T0_RID66_S1_NC_031305.1:4622-4714_length:93_mod0000 -M_T0_RID66_S1_NZ_JBDYRX010000002.1:340389-340472_length:84_mod0000 -M_T0_RID67_S0_NC_028134.1:42-92_length:51_mod0000 -M_T0_RID67_S0_NC_030447.1:1980-2070_length:91_mod0000 -M_T0_RID67_S0_NZ_JBDYRX010000004.1:332043-332120_length:78_mod0000 -M_T0_RID67_S0_NZ_JBDYSJ010000003.1:241049-241147_length:99_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000001.1:247375-247406_length:32_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000002.1:355091-355166_length:76_mod0000 -M_T0_RID68_S1_NC_034266.1:8834-8941_length:108_mod0000 -M_T0_RID68_S1_NZ_JBDYLZ010000016.1:69565-69646_length:82_mod0000 -M_T0_RID69_S0_NC_028368.1:19515-19575_length:61_mod0000 -M_T0_RID69_S0_NC_034266.1:30444-30515_length:72_mod0000 -M_T0_RID69_S0_NZ_JBDYLZ010000013.1:100003-100090_length:88_mod0000 -M_T0_RID69_S1_NZ_JBDYLZ010000016.1:63861-63942_length:82_mod0000 -M_T0_RID70_S0_NC_018404.1:2315-2374_length:60_mod0000 -M_T0_RID70_S1_NC_027713.1:293-401_length:109_mod0000 -M_T0_RID70_S1_NC_033830.1:3068-3146_length:79_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000007.1:118774-118860_length:87_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000016.1:66813-66865_length:53_mod0000 -M_T0_RID71_S0_NC_033620.1:14671-14724_length:54_mod0000 -M_T0_RID71_S1_NC_029562.1:2435-2497_length:63_mod0000 -M_T0_RID72_S0_NC_033716.1:7859-7951_length:93_mod0000 -M_T0_RID72_S1_NC_030117.1:83819-83856_length:38_mod0000 -M_T0_RID72_S1_NZ_JBDYLZ010000008.1:123604-123689_length:86_mod0000 -M_T0_RID73_S0_NC_030115.1:6022-6140_length:119_mod0000 -M_T0_RID73_S0_NC_030229.1:2674-2768_length:95_mod0000 -M_T0_RID73_S0_NC_033733.1:4354-4441_length:88_mod0001 -M_T0_RID74_S0_NC_031093.1:8592-8666_length:75_mod0000 -M_T0_RID74_S0_NZ_JBDYSJ010000002.1:362489-362559_length:71_mod0000 -M_T0_RID74_S1_NC_029302.1:212-295_length:84_mod0000 -M_T0_RID75_S0_NZ_JBDYRX010000001.1:235615-235682_length:68_mod0000 -M_T0_RID75_S1_NC_030235.1:6658-6691_length:34_mod0000 -M_T0_RID75_S1_NZ_JBDYLZ010000022.1:8709-8767_length:59_mod0000 -M_T0_RID75_S1_NZ_JBDYRX010000003.1:478660-478720_length:61_mod0000 -M_T0_RID76_S0_NC_018070.1:8778-8882_length:105_mod0000 -M_T0_RID76_S0_NC_029255.1:61305-61383_length:79_mod0000 -M_T0_RID76_S1_NC_027428.1:2290-2358_length:69_mod0000 -M_T0_RID76_S1_NC_030200.1:88040-88083_length:44_mod0000 -M_T0_RID76_S1_NC_033720.1:158-194_length:37_mod0000 -M_T0_RID77_S1_NC_033730.1:7657-7785_length:129_mod0000 -M_T0_RID78_S0_NC_023442.1:36825-36879_length:55_mod0000 -M_T0_RID78_S0_NC_027016.1:111926-112014_length:89_mod0000 -M_T0_RID78_S0_NZ_JBDYRX010000003.1:310444-310522_length:79_mod0000 -M_T0_RID78_S1_NC_030871.1:4415-4481_length:67_mod0000 -M_T0_RID78_S1_NC_031220.1:5976-6009_length:34_mod0000 -M_T0_RID79_S0_NC_029997.2:83992-84041_length:50_mod0000 -M_T0_RID79_S0_NC_030240.1:97988-98049_length:62_mod0000 -M_T0_RID79_S1_NC_033792.1:2479-2556_length:78_mod0000 -M_T0_RID79_S1_NZ_JBDYRX010000003.1:341785-341851_length:67_mod0001 -M_T0_RID80_S1_NZ_JBDYLZ010000010.1:13735-13769_length:35_mod0000 -M_T0_RID80_S1_NZ_JBDYSJ010000001.1:511944-512037_length:94_mod0000 -M_T0_RID81_S1_NC_027923.1:15413-15450_length:38_mod0000 -M_T0_RID82_S0_NC_027916.2:67438-67522_length:85_mod0001 -M_T0_RID82_S0_NC_028398.1:2368-2442_length:75_mod0000 -M_T0_RID82_S0_NC_033779.1:2219-2288_length:70_mod0000 -M_T0_RID82_S0_NZ_JBDYLZ010000016.1:9019-9115_length:97_mod0000 -M_T0_RID82_S0_NZ_JBDYRX010000001.1:261558-261662_length:105_mod0001 -M_T0_RID82_S1_NC_027016.1:72621-72680_length:60_mod0000 -M_T0_RID82_S1_NC_027535.1:2160-2253_length:94_mod0000 -M_T0_RID83_S1_NC_030159.1:273-312_length:40_mod0000 -M_T0_RID83_S1_NZ_JBDYLZ010000007.1:155539-155585_length:47_mod0000 -M_T0_RID83_S1_NZ_JBDYRX010000002.1:263346-263422_length:77_mod0000 -M_T0_RID84_S0_NZ_JBDYRX010000003.1:240685-240765_length:81_mod0000 -M_T0_RID84_S1_NZ_JBDYRX010000003.1:51637-51745_length:109_mod0000 -M_T0_RID85_S0_NZ_JBDYRX010000002.1:107354-107402_length:49_mod0000 -M_T0_RID85_S1_NC_023297.1:177-263_length:87_mod0000 -M_T0_RID85_S1_NC_030201.1:3764-3811_length:48_mod0000 -M_T0_RID85_S1_NZ_JBDYRX010000002.1:35225-35277_length:53_mod0000 -M_T0_RID86_S1_NC_028137.1:1830-1905_length:76_mod0000 -M_T0_RID86_S1_NC_033828.1:2664-2773_length:110_mod0000 -M_T0_RID86_S1_NZ_JBDYSJ010000001.1:383616-383681_length:66_mod0000 -M_T0_RID87_S0_NC_027631.1:5088-5147_length:60_mod0000 -M_T0_RID87_S0_NZ_JBDYLZ010000008.1:117199-117277_length:79_mod0000 -M_T0_RID87_S1_NZ_JBDYRX010000002.1:176453-176540_length:88_mod0000 -M_T0_RID89_S0_NC_028814.1:25832-25905_length:74_mod0000 -M_T0_RID89_S0_NZ_JBDYLZ010000010.1:109306-109408_length:103_mod0000 -M_T0_RID89_S1_NC_029064.1:9889-9971_length:83_mod0000 -M_T0_RID91_S0_NC_029997.2:19677-19742_length:66_mod0000 -M_T0_RID91_S0_NZ_JBDYSJ010000002.1:541980-542048_length:69_mod0001 -M_T0_RID91_S1_NC_028636.1:131522-131574_length:53_mod0000 -M_T0_RID91_S1_NZ_JBDYLZ010000015.1:73113-73211_length:99_mod0000 -M_T0_RID91_S1_NZ_JBDYRX010000002.1:531098-531224_length:127_mod0000 -M_T0_RID91_S1_NZ_JBDYSJ010000001.1:75425-75512_length:88_mod0000 -M_T0_RID92_S0_NC_033847.1:907-971_length:65_mod0001 -M_T0_RID92_S0_NZ_JBDYRX010000001.1:204153-204204_length:52_mod0000 -M_T0_RID93_S0_NC_029131.1:6029-6095_length:67_mod0000 -M_T0_RID93_S1_NZ_JBDYRX010000002.1:30248-30359_length:112_mod0000 -M_T0_RID94_S0_NC_028142.1:627-700_length:74_mod0000 -M_T0_RID94_S0_NC_033702.1:1317-1400_length:84_mod0000 -M_T0_RID94_S0_NC_033717.1:1284-1386_length:103_mod0000 -M_T0_RID95_S0_NC_018072.1:2591-2635_length:45_mod0000 -M_T0_RID95_S0_NC_027136.1:2231-2280_length:50_mod0000 -M_T0_RID95_S0_NC_029996.1:90789-90865_length:77_mod0000 -M_T0_RID95_S0_NZ_JBDYRX010000002.1:319590-319635_length:46_mod0000 -M_T0_RID95_S1_NC_033620.1:5347-5437_length:91_mod0000 -M_T0_RID96_S0_NC_028636.1:10556-10617_length:62_mod0000 -M_T0_RID96_S1_NC_028143.1:314-390_length:77_mod0000 -M_T0_RID97_S1_NZ_JBDYRX010000001.1:866338-866401_length:64_mod0001 -M_T0_RID97_S1_NZ_JBDYRX010000003.1:178272-178304_length:33_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000013.1:5680-5725_length:46_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000028.1:866-932_length:67_mod0000 -M_T0_RID98_S1_NC_029996.1:10631-10716_length:86_mod0000 -M_T0_RID99_S0_NC_030838.1:2068-2122_length:55_mod0000 -M_T0_RID99_S0_NC_031248.1:3321-3367_length:47_mod0000 -M_T0_RID99_S1_NC_027916.2:30126-30210_length:85_mod0000 -M_T0_RID99_S1_NC_030240.1:40035-40122_length:88_mod0000 -M_T0_RID99_S1_NC_031336.1:14128-14251_length:124_mod0001 -M_T0_RID99_S1_NZ_JBDYSJ010000001.1:396202-396267_length:66_mod0000 -M_T0_RID100_S0_NC_028376.1:14572-14682_length:111_mod0000 -M_T0_RID100_S0_NC_030697.1:970-1055_length:86_mod0000 -M_T0_RID100_S0_NZ_JBDYRX010000002.1:758402-758505_length:104_mod0000 -M_T0_RID101_S0_NZ_JBDYSJ010000001.1:645109-645147_length:39_mod0000 -M_T0_RID102_S0_NC_029255.1:63250-63323_length:74_mod0000 -M_T0_RID102_S0_NZ_JBDYSJ010000001.1:237444-237513_length:70_mod0000 -M_T0_RID103_S0_NC_028476.1:713-824_length:112_mod0000 -M_T0_RID103_S1_NC_031314.1:1276-1385_length:110_mod0000 -M_T0_RID103_S1_NC_031463.1:18479-18581_length:103_mod0000 -M_T0_RID103_S1_NZ_JBDYRX010000003.1:535271-535363_length:93_mod0000 -M_T0_RID105_S0_NC_030118.1:8503-8572_length:70_mod0000 -M_T0_RID105_S1_NC_027712.1:9939-9971_length:33_mod0000 -M_T0_RID105_S1_NC_030472.1:4177-4227_length:51_mod0000 -M_T0_RID106_S1_NC_028382.1:483-531_length:49_mod0000 -M_T0_RID106_S1_NZ_JBDYLZ010000017.1:12627-12692_length:66_mod0000 -M_T0_RID106_S1_NZ_JBDYRX010000001.1:885175-885267_length:93_mod0000 -M_T0_RID106_S1_NZ_JBDYSJ010000001.1:754603-754673_length:71_mod0000 -M_T0_RID107_S0_NZ_JBDYRX010000002.1:887203-887264_length:62_mod0000 -M_T0_RID107_S1_NC_027016.1:87956-88044_length:89_mod0000 -M_T0_RID107_S1_NC_028478.1:299-392_length:94_mod0000 -M_T0_RID107_S1_NZ_JBDYRX010000003.1:166903-166964_length:62_mod0001 -M_T0_RID107_S1_NZ_JBDYSJ010000001.1:252763-252845_length:83_mod0000 -M_T0_RID108_S1_NC_033767.1:689-744_length:56_mod0000 -M_T0_RID108_S1_NZ_JBDYSJ010000003.1:468268-468339_length:72_mod0000 -M_T0_RID109_S0_NZ_JBDYRX010000001.1:988451-988536_length:86_mod0000 -M_T0_RID110_S1_NC_028099.1:36637-36726_length:90_mod0000 -M_T0_RID110_S1_NZ_JBDYLZ010000015.1:71842-71908_length:67_mod0000 -M_T0_RID111_S0_NC_030232.1:3068-3100_length:33_mod0000 -M_T0_RID111_S0_NZ_JBDYRX010000002.1:284375-284457_length:83_mod0000 -M_T0_RID111_S1_NC_028491.1:22651-22727_length:77_mod0000 -M_T0_RID112_S1_NZ_JBDYRX010000004.1:227206-227261_length:56_mod0000 -M_T0_RID112_S1_NZ_JBDYSJ010000003.1:186720-186750_length:31_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000008.1:103905-103950_length:46_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000017.1:43421-43530_length:110_mod0000 -M_T0_RID114_S0_NZ_JBDYSJ010000001.1:888974-889061_length:88_mod0000 -M_T0_RID114_S1_NC_028485.1:4265-4351_length:87_mod0000 -M_T0_RID114_S1_NC_030654.1:5564-5612_length:49_mod0000 -M_T0_RID114_S1_NC_033763.1:670-745_length:76_mod0000 -M_T0_RID114_S1_NZ_JBDYSJ010000001.1:20373-20432_length:60_mod0000 -M_T0_RID115_S0_NC_033781.1:4795-4906_length:112_mod0000 -M_T0_RID115_S1_NC_031236.1:618-674_length:57_mod0000 -M_T0_RID116_S0_NC_028833.1:24900-24930_length:31_mod0000 -M_T0_RID116_S0_NZ_JBDYSJ010000001.1:278209-278280_length:72_mod0000 -M_T0_RID117_S0_NC_028491.1:76819-76945_length:127_mod0000 -M_T0_RID117_S0_NC_028636.1:51360-51406_length:47_mod0000 -M_T0_RID117_S0_NZ_JBDYRX010000002.1:695385-695511_length:127_mod0000 -M_T0_RID117_S0_NZ_JBDYSJ010000004.1:214232-214301_length:70_mod0000 -M_T0_RID117_S1_NZ_JBDYSJ010000001.1:254125-254189_length:65_mod0000 -M_T0_RID118_S1_NC_017967.1:3728-3792_length:65_mod0000 -M_T0_RID118_S1_NZ_JBDYLZ010000012.1:104385-104434_length:50_mod0000 -M_T0_RID118_S1_NZ_JBDYRX010000003.1:569089-569158_length:70_mod0000 -M_T0_RID119_S0_NC_027138.1:1980-2027_length:48_mod0000 -M_T0_RID119_S0_NZ_JBDYRX010000001.1:479636-479698_length:63_mod0000 -M_T0_RID119_S1_NC_030750.1:2333-2363_length:31_mod0000 -M_T0_RID120_S0_NZ_JBDYRX010000004.1:143311-143407_length:97_mod0000 -M_T0_RID120_S0_NZ_JBDYSJ010000002.1:211897-211962_length:66_mod0000 -M_T0_RID120_S1_NC_029255.1:99346-99425_length:80_mod0000 -M_T0_RID120_S1_NZ_JBDYLZ010000008.1:182987-183039_length:53_mod0000 -M_T0_RID121_S1_NZ_JBDYRX010000003.1:22645-22773_length:129_mod0000 -M_T0_RID122_S0_NZ_JBDYSJ010000002.1:28060-28162_length:103_mod0000 -M_T0_RID122_S1_NZ_JBDYRX010000002.1:593335-593394_length:60_mod0000 -M_T0_RID123_S1_NC_029932.1:780-841_length:62_mod0000 -M_T0_RID123_S1_NZ_JBDYRX010000002.1:624572-624628_length:57_mod0000 -M_T0_RID123_S1_NZ_JBDYSJ010000003.1:205052-205133_length:82_mod0000 -M_T0_RID124_S0_NC_018105.1:1032-1078_length:47_mod0000 -M_T0_RID124_S0_NC_027016.1:37306-37377_length:72_mod0000 -M_T0_RID124_S0_NC_027430.1:2075-2124_length:50_mod0000 -M_T0_RID124_S0_NC_033751.1:1175-1283_length:109_mod0000 -M_T0_RID124_S0_NZ_JBDYLZ010000012.1:107683-107735_length:53_mod0000 -M_T0_RID124_S1_NC_029783.1:12839-12935_length:97_mod0000 -M_T0_RID125_S1_NC_024911.1:585-717_length:133_mod0000 -M_T0_RID125_S1_NZ_JBDYRX010000002.1:524061-524121_length:61_mod0000 -M_T0_RID126_S0_NZ_JBDYSJ010000003.1:204369-204435_length:67_mod0000 -M_T0_RID126_S1_NC_027136.1:6692-6786_length:95_mod0000 -M_T0_RID126_S1_NZ_JBDYLZ010000007.1:147969-148026_length:58_mod0000 -M_T0_RID126_S1_NZ_JBDYSJ010000001.1:849768-849826_length:59_mod0000 -M_T0_RID127_S0_NZ_JBDYLZ010000019.1:20624-20673_length:50_mod0000 -M_T0_RID127_S1_NC_033619.1:4029-4155_length:127_mod0000 -M_T0_RID127_S1_NZ_JBDYRX010000004.1:112527-112563_length:37_mod0000 -M_T0_RID128_S0_NC_033620.1:26172-26261_length:90_mod0000 -M_T0_RID128_S0_NZ_JBDYSJ010000001.1:127550-127596_length:47_mod0000 -M_T0_RID128_S1_NZ_JBDYLZ010000010.1:81225-81326_length:102_mod0000 -M_T0_RID129_S0_NC_028372.1:12347-12414_length:68_mod0001 -M_T0_RID129_S0_NC_030844.1:4967-5083_length:117_mod0001 -M_T0_RID129_S1_NZ_JBDYSJ010000001.1:451837-451880_length:44_mod0000 -M_T0_RID130_S0_NZ_JBDYSJ010000001.1:904477-904569_length:93_mod0000 -M_T0_RID130_S1_NC_030400.1:8920-8964_length:45_mod0000 -M_T0_RID131_S0_NC_030200.1:24540-24653_length:114_mod0000 -M_T0_RID131_S0_NZ_JBDYRX010000004.1:307376-307435_length:60_mod0001 -M_T0_RID131_S1_NZ_JBDYRX010000002.1:215925-215981_length:57_mod0000 -M_T0_RID132_S0_NC_029132.1:26524-26609_length:86_mod0000 -M_T0_RID132_S0_NZ_JBDYRX010000002.1:856095-856160_length:66_mod0000 -M_T0_RID132_S1_NC_028099.1:70003-70100_length:98_mod0000 -M_T0_RID132_S1_NC_028636.1:77454-77493_length:40_mod0000 -M_T0_RID133_S0_NC_027210.1:8798-8910_length:113_mod0000 -M_T0_RID133_S1_NZ_JBDYLZ010000014.1:82781-82835_length:55_mod0000 -M_T0_RID134_S0_NC_034266.1:203255-203287_length:33_mod0000 -M_T0_RID134_S1_NC_033705.1:7105-7262_length:158_mod0000 -M_T0_RID135_S0_NC_033733.1:6746-6806_length:61_mod0000 -M_T0_RID135_S1_NZ_JBDYSJ010000004.1:255279-255341_length:63_mod0000 -M_T0_RID136_S0_NZ_JBDYSJ010000001.1:562721-562768_length:48_mod0000 -M_T0_RID136_S1_NC_030200.1:80911-80976_length:66_mod0001 -M_T0_RID136_S1_NZ_JBDYLZ010000009.1:44314-44384_length:71_mod0000 -M_T0_RID136_S1_NZ_JBDYLZ010000018.1:9886-9961_length:76_mod0000 -M_T0_RID136_S1_NZ_JBDYRX010000001.1:825042-825123_length:82_mod0000 -M_T0_RID137_S0_NC_031083.1:11357-11420_length:64_mod0000 -M_T0_RID137_S0_NZ_JBDYSJ010000002.1:311215-311270_length:56_mod0000 -M_T0_RID137_S1_NC_034266.1:15288-15392_length:105_mod0000 -M_T0_RID137_S1_NZ_JBDYSJ010000002.1:109720-109762_length:43_mod0000 -M_T0_RID138_S0_NC_033730.1:4735-4793_length:59_mod0000 -M_T0_RID139_S0_NC_029076.1:5391-5472_length:82_mod0000 -M_T0_RID139_S0_NC_029131.1:3428-3518_length:91_mod0000 -M_T0_RID139_S1_NC_027128.1:7467-7524_length:58_mod0000 -M_T0_RID139_S1_NC_033730.1:8262-8350_length:89_mod0000 -M_T0_RID140_S0_NC_031216.1:8965-9047_length:83_mod0000 -M_T0_RID140_S1_NC_029996.1:128484-128577_length:94_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000007.1:238838-238873_length:36_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000015.1:16859-16896_length:38_mod0000 -M_T0_RID142_S0_NC_027916.2:139729-139809_length:81_mod0001 -M_T0_RID142_S0_NC_030873.1:562-633_length:72_mod0000 -M_T0_RID142_S0_NZ_JBDYSJ010000003.1:9947-10048_length:102_mod0001 -M_T0_RID144_S0_NC_030200.1:1026-1085_length:60_mod0001 -M_T0_RID144_S0_NZ_JBDYRX010000002.1:297802-297909_length:108_mod0000 -M_T0_RID145_S0_NZ_JBDYSJ010000001.1:690815-690908_length:94_mod0000 -M_T0_RID146_S0_NC_028636.1:8587-8640_length:54_mod0000 -M_T0_RID147_S0_NC_030839.1:401-442_length:42_mod0000 -M_T0_RID147_S1_NZ_JBDYRX010000002.1:330619-330694_length:76_mod0000 -M_T0_RID148_S1_NZ_JBDYRX010000002.1:14264-14309_length:46_mod0000 -M_T0_RID149_S0_NZ_JBDYSJ010000001.1:617340-617447_length:108_mod0000 -M_T0_RID149_S1_NC_028249.1:10239-10323_length:85_mod0000 -M_T0_RID149_S1_NZ_JBDYLZ010000008.1:120921-120959_length:39_mod0000 -M_T0_RID150_S1_NZ_JBDYRX010000004.1:384747-384794_length:48_mod0000 -M_T0_RID152_S1_NZ_JBDYRX010000004.1:353714-353802_length:89_mod0000 -M_T0_RID153_S0_NZ_JBDYRX010000003.1:52603-52715_length:113_mod0000 -M_T0_RID153_S1_NC_028364.1:137-249_length:113_mod0000 -M_T0_RID154_S0_NZ_JBDYRX010000003.1:602237-602274_length:38_mod0000 -M_T0_RID154_S1_NC_028386.1:1116-1181_length:66_mod0000 -M_T0_RID154_S1_NC_033620.1:12644-12716_length:73_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000002.1:675599-675679_length:81_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000003.1:514528-514581_length:54_mod0000 -M_T0_RID155_S0_NC_033701.1:9275-9317_length:43_mod0000 -M_T0_RID156_S1_NC_023295.1:2064-2141_length:78_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000006.1:281471-281567_length:97_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000011.1:132268-132312_length:45_mod0000 -M_T0_RID158_S1_NC_028241.1:531-607_length:77_mod0000 -M_T0_RID159_S0_NC_029311.1:69011-69045_length:35_mod0000 -M_T0_RID159_S0_NC_031216.1:6290-6405_length:116_mod0000 -M_T0_RID159_S0_NC_033620.1:32537-32621_length:85_mod0000 -M_T0_RID159_S0_NZ_JBDYSJ010000002.1:600959-600995_length:37_mod0000 -M_T0_RID161_S1_NC_030240.1:83741-83790_length:50_mod0000 -M_T0_RID162_S0_NZ_JBDYLZ010000008.1:5183-5216_length:34_mod0000 -M_T0_RID162_S1_NC_017862.1:7381-7452_length:72_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:584559-584609_length:51_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:726659-726738_length:80_mod0000 -M_T0_RID163_S0_NC_033620.1:156883-156969_length:87_mod0000 -M_T0_RID163_S1_NC_030275.1:100083-100169_length:87_mod0000 -M_T0_RID164_S0_NZ_JBDYLZ010000018.1:17968-18030_length:63_mod0000 -M_T0_RID164_S1_NC_033620.1:130668-130713_length:46_mod0000 -M_T0_RID164_S1_NZ_JBDYRX010000004.1:519479-519563_length:85_mod0000 -M_T0_RID165_S0_NC_027917.1:1959-2051_length:93_mod0000 -M_T0_RID166_S0_NZ_JBDYRX010000004.1:59696-59805_length:110_mod0000 -M_T0_RID167_S0_NZ_JBDYLZ010000007.1:38370-38443_length:74_mod0000 -M_T0_RID168_S0_NC_030225.1:5381-5465_length:85_mod0001 -M_T0_RID168_S0_NC_030236.1:5080-5154_length:75_mod0000 -M_T0_RID169_S0_NC_028263.1:913-994_length:82_mod0000 -M_T0_RID169_S0_NZ_JBDYLZ010000007.1:16953-17017_length:65_mod0000 -M_T0_RID169_S1_NC_017970.1:7200-7322_length:123_mod0000 -M_T0_RID169_S1_NC_027016.1:84360-84421_length:62_mod0000 -M_T0_RID169_S1_NC_031295.1:1211-1283_length:73_mod0001 -M_T0_RID170_S1_NZ_JBDYRX010000001.1:71554-71642_length:89_mod0000 -M_T0_RID171_S0_NC_023429.1:1938-1983_length:46_mod0000 -M_T0_RID171_S0_NZ_JBDYRX010000001.1:944221-944313_length:93_mod0001 -M_T0_RID171_S1_NC_028891.1:8612-8645_length:34_mod0000 -M_T0_RID172_S0_NC_031455.1:2261-2316_length:56_mod0000 -M_T0_RID172_S1_NC_028383.1:1536-1621_length:86_mod0000 -M_T0_RID172_S1_NC_031293.1:5209-5302_length:94_mod0000 -M_T0_RID172_S1_NZ_JBDYSJ010000002.1:22259-22312_length:54_mod0000 -M_T0_RID173_S0_NC_033710.1:8523-8561_length:39_mod0000 -M_T0_RID173_S0_NZ_JBDYRX010000004.1:391209-391337_length:129_mod0000 -M_T0_RID173_S1_NZ_JBDYLZ010000022.1:5769-5818_length:50_mod0000 -M_T0_RID173_S1_NZ_JBDYSJ010000001.1:629973-630049_length:77_mod0000 -M_T0_RID174_S1_NC_030158.1:2752-2787_length:36_mod0000 -M_T0_RID174_S1_NC_031339.1:433-463_length:31_mod0000 -M_T0_RID174_S1_NZ_JBDYLZ010000006.1:10668-10748_length:81_mod0000 -M_T0_RID175_S0_NZ_JBDYLZ010000018.1:25042-25131_length:90_mod0000 -M_T0_RID175_S1_NZ_JBDYSJ010000001.1:899529-899569_length:41_mod0000 -M_T0_RID176_S0_NC_030200.1:58204-58287_length:84_mod0000 -M_T0_RID176_S0_NZ_JBDYRX010000002.1:668726-668775_length:50_mod0000 -M_T0_RID176_S1_NZ_JBDYSJ010000003.1:471518-471566_length:49_mod0001 -M_T0_RID177_S1_NZ_JBDYRX010000002.1:466682-466753_length:72_mod0000 -M_T0_RID178_S0_NC_028099.1:31084-31207_length:124_mod0000 -M_T0_RID178_S0_NC_033620.1:149729-149799_length:71_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000001.1:853106-853172_length:67_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000002.1:203092-203185_length:94_mod0000 -M_T0_RID179_S0_NC_023442.1:39001-39088_length:88_mod0000 -M_T0_RID179_S0_NZ_JBDYRX010000004.1:52140-52225_length:86_mod0000 -M_T0_RID179_S0_NZ_JBDYSJ010000001.1:721050-721084_length:35_mod0001 -M_T0_RID180_S0_NZ_JBDYSJ010000002.1:534591-534638_length:48_mod0000 -M_T0_RID180_S1_NC_029801.1:1212-1290_length:79_mod0000 -M_T0_RID181_S0_NC_023420.2:1575-1682_length:108_mod0000 -M_T0_RID181_S0_NZ_JBDYSJ010000001.1:400625-400659_length:35_mod0000 -M_T0_RID181_S1_NZ_JBDYLZ010000022.1:10488-10567_length:80_mod0000 -M_T0_RID182_S1_NC_030115.1:4690-4735_length:46_mod0000 -M_T0_RID183_S0_NC_029996.1:43664-43722_length:59_mod0000 -M_T0_RID185_S1_NZ_JBDYRX010000003.1:308336-308406_length:71_mod0001 -M_T0_RID185_S1_NZ_JBDYRX010000004.1:191608-191699_length:92_mod0000 -M_T0_RID187_S0_NC_029132.1:3505-3621_length:117_mod0000 -M_T0_RID187_S1_NC_028833.1:12138-12185_length:48_mod0001 -M_T0_RID187_S1_NZ_JBDYLZ010000007.1:48250-48349_length:100_mod0000 -M_T0_RID187_S1_NZ_JBDYRX010000001.1:251442-251541_length:100_mod0000 -M_T0_RID188_S0_NC_033620.1:60461-60546_length:86_mod0000 -M_T0_RID188_S0_NC_033745.1:5844-5924_length:81_mod0000 -M_T0_RID188_S1_NC_030746.1:5743-5836_length:94_mod0000 -M_T0_RID188_S1_NZ_JBDYSJ010000001.1:693404-693463_length:60_mod0000 -M_T0_RID190_S0_NC_028099.1:110295-110391_length:97_mod0000 -M_T0_RID190_S0_NC_031463.1:15502-15572_length:71_mod0000 -M_T0_RID190_S0_NZ_JBDYSJ010000002.1:205146-205255_length:110_mod0000 -M_T0_RID190_S1_NC_031291.1:89-172_length:84_mod0000 -M_T0_RID190_S1_NZ_JBDYRX010000001.1:953429-953485_length:57_mod0001 -M_T0_RID191_S0_NC_028811.1:13630-13691_length:62_mod0000 -M_T0_RID191_S0_NC_029255.1:128444-128478_length:35_mod0000 -M_T0_RID191_S1_NC_027706.1:673-702_length:30_mod0000 -M_T0_RID192_S0_NC_030202.1:1974-2037_length:64_mod0000 -M_T0_RID192_S0_NZ_JBDYSJ010000002.1:499003-499042_length:40_mod0000 -M_T0_RID192_S1_NC_028266.1:2491-2562_length:72_mod0000 -M_T0_RID192_S1_NC_029935.1:3672-3749_length:78_mod0000 -M_T0_RID193_S0_NC_030796.1:1139-1218_length:80_mod0000 -M_T0_RID193_S0_NZ_JBDYLZ010000006.1:65091-65167_length:77_mod0000 -M_T0_RID193_S1_NC_029311.1:3962-4023_length:62_mod0000 -M_T0_RID193_S1_NC_029854.1:2071-2138_length:68_mod0001 -M_T0_RID193_S1_NZ_JBDYLZ010000018.1:32241-32282_length:42_mod0000 -M_T0_RID193_S1_NZ_JBDYSJ010000004.1:33272-33325_length:54_mod0000 -M_T0_RID194_S0_NZ_JBDYRX010000001.1:29953-30068_length:116_mod0000 -M_T0_RID194_S1_NC_027117.1:4-75_length:72_mod0000 -M_T0_RID194_S1_NZ_JBDYSJ010000002.1:458031-458124_length:94_mod0000 -M_T0_RID195_S0_NC_029126.1:5551-5630_length:80_mod0000 -M_T0_RID195_S0_NC_030117.1:78912-78948_length:37_mod0000 -M_T0_RID195_S0_NZ_JBDYLZ010000010.1:56983-57024_length:42_mod0000 -M_T0_RID196_S0_NC_028891.1:12640-12710_length:71_mod0000 -M_T0_RID196_S0_NZ_JBDYSJ010000001.1:166064-166125_length:62_mod0000 -M_T0_RID196_S1_NC_029306.1:173-274_length:102_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000001.1:85071-85115_length:45_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000003.1:358250-358311_length:62_mod0001 -M_T0_RID198_S1_NZ_JBDYLZ010000012.1:46495-46566_length:72_mod0000 -M_T0_RID198_S1_NZ_JBDYSJ010000001.1:185655-185715_length:61_mod0000 -M_T0_RID199_S0_NZ_JBDYRX010000001.1:904336-904396_length:61_mod0000 -M_T0_RID200_S1_NZ_JBDYRX010000001.1:660511-660552_length:42_mod0000 -M_T0_RID201_S0_NZ_JBDYLZ010000028.1:698-764_length:67_mod0000 -M_T0_RID201_S1_NZ_JBDYSJ010000001.1:587635-587727_length:93_mod0000 -M_T0_RID202_S0_NZ_JBDYLZ010000009.1:73121-73183_length:63_mod0000 -M_T0_RID203_S1_NC_027923.1:89467-89574_length:108_mod0000 -M_T0_RID203_S1_NC_028470.1:6286-6372_length:87_mod0000 -M_T0_RID204_S0_NZ_JBDYSJ010000003.1:424711-424783_length:73_mod0000 -M_T0_RID204_S1_NZ_JBDYLZ010000009.1:157953-158008_length:56_mod0000 -M_T0_RID205_S0_NC_028806.1:14973-15042_length:70_mod0001 -M_T0_RID205_S0_NC_031336.1:5585-5707_length:123_mod0000 -M_T0_RID205_S0_NC_033710.1:1140-1174_length:35_mod0001 -M_T0_RID205_S0_NC_034377.1:309-345_length:37_mod0000 -M_T0_RID205_S0_NZ_JBDYRX010000001.1:648020-648102_length:83_mod0000 -M_T0_RID206_S0_NZ_JBDYRX010000003.1:657781-657875_length:95_mod0000 -M_T0_RID206_S1_NZ_JBDYSJ010000002.1:507837-507900_length:64_mod0000 -M_T0_RID207_S0_NC_029782.1:2571-2655_length:85_mod0000 -M_T0_RID207_S0_NC_033756.1:9757-9804_length:48_mod0000 -M_T0_RID207_S1_NC_028470.1:3881-3944_length:64_mod0000 -M_T0_RID207_S1_NC_029111.1:391-425_length:35_mod0000 -M_T0_RID208_S1_NC_028137.1:3146-3238_length:93_mod0000 -M_T0_RID209_S1_NC_027016.1:200405-200534_length:130_mod0000 -M_T0_RID209_S1_NZ_JBDYRX010000003.1:693765-693849_length:85_mod0000 -M_T0_RID211_S0_NC_030749.1:1821-1921_length:101_mod0000 -M_T0_RID211_S0_NZ_JBDYSJ010000002.1:199161-199238_length:78_mod0000 -M_T0_RID212_S0_NC_028462.1:2849-2888_length:40_mod0000 -M_T0_RID212_S0_NC_031272.1:7400-7455_length:56_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:220611-220694_length:84_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:824198-824247_length:50_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000002.1:522607-522670_length:64_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000003.1:35532-35575_length:44_mod0000 -M_T0_RID213_S1_NC_027619.1:3998-4074_length:77_mod0000 -M_T0_RID214_S0_NC_017990.1:4036-4109_length:74_mod0000 -M_T0_RID214_S0_NZ_JBDYRX010000004.1:6306-6380_length:75_mod0000 -M_T0_RID214_S1_NZ_JBDYLZ010000016.1:26291-26346_length:56_mod0001 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:332282-332360_length:79_mod0000 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:457564-457597_length:34_mod0000 -M_T0_RID215_S1_NZ_JBDYRX010000004.1:547476-547541_length:66_mod0000 -M_T0_RID217_S0_NC_030922.1:6414-6531_length:118_mod0000 -M_T0_RID217_S0_NZ_JBDYRX010000001.1:366993-367094_length:102_mod0000 -M_T0_RID217_S1_NC_017970.1:8697-8737_length:41_mod0000 -M_T0_RID217_S1_NC_018482.1:2018-2099_length:82_mod0000 -M_T0_RID219_S0_NZ_JBDYLZ010000006.1:135272-135372_length:101_mod0001 -M_T0_RID219_S1_NZ_JBDYRX010000003.1:132173-132251_length:79_mod0000 -M_T0_RID220_S0_NC_033725.1:8661-8722_length:62_mod0000 -M_T0_RID220_S1_NZ_JBDYRX010000003.1:133141-133229_length:89_mod0000 -M_T0_RID221_S0_NZ_JBDYRX010000001.1:771011-771087_length:77_mod0000 -M_T0_RID222_S0_NC_037572.1:1818-1871_length:54_mod0000 -M_T0_RID222_S1_NC_028485.1:810-872_length:63_mod0000 -M_T0_RID222_S1_NC_030793.1:2889-2992_length:104_mod0000 -M_T0_RID222_S1_NZ_JBDYRX010000001.1:301419-301533_length:115_mod0001 -M_T0_RID223_S1_NC_033620.1:157690-157751_length:62_mod0000 -M_T0_RID224_S0_NC_017937.1:2859-2949_length:91_mod0000 -M_T0_RID224_S1_NC_028388.1:2224-2291_length:68_mod0001 -M_T0_RID224_S1_NC_033700.1:22817-22886_length:70_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000001.1:692859-692944_length:86_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000004.1:483631-483701_length:71_mod0000 -M_T0_RID225_S1_NC_029311.1:72416-72523_length:108_mod0000 -M_T0_RID225_S1_NC_030240.1:91908-91984_length:77_mod0000 -M_T0_RID226_S0_NZ_JBDYRX010000001.1:678003-678073_length:71_mod0000 -M_T0_RID226_S1_NZ_JBDYRX010000001.1:984964-985038_length:75_mod0000 -M_T0_RID227_S0_NC_028636.1:35420-35507_length:88_mod0000 -M_T0_RID227_S0_NZ_JBDYLZ010000014.1:18260-18351_length:92_mod0000 -M_T0_RID227_S1_NZ_JBDYLZ010000010.1:2424-2519_length:96_mod0000 -M_T0_RID229_S0_NZ_JBDYRX010000002.1:664717-664801_length:85_mod0000 -M_T0_RID230_S0_NC_033822.1:1869-1967_length:99_mod0000 -M_T0_RID230_S0_NZ_JBDYRX010000002.1:244562-244600_length:39_mod0000 -M_T0_RID231_S0_NC_034017.1:4341-4449_length:109_mod0000 -M_T0_RID231_S0_NZ_JBDYRX010000002.1:364966-365054_length:89_mod0000 -M_T0_RID231_S1_NZ_JBDYRX010000004.1:275949-276005_length:57_mod0001 -M_T0_RID233_S0_NC_030402.1:4056-4127_length:72_mod0000 -M_T0_RID234_S0_NZ_JBDYSJ010000001.1:910286-910315_length:30_mod0000 -M_T0_RID234_S1_NZ_JBDYSJ010000003.1:84105-84229_length:125_mod0000 -M_T0_RID235_S0_NC_029997.2:52965-53016_length:52_mod0000 -M_T0_RID235_S0_NZ_JBDYRX010000004.1:469577-469661_length:85_mod0000 -M_T0_RID235_S1_NC_029993.1:68-156_length:89_mod0000 -M_T0_RID236_S0_NC_027209.1:15-106_length:92_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000001.1:879200-879251_length:52_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000002.1:665177-665206_length:30_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:172535-172571_length:37_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:365370-365448_length:79_mod0000 -M_T0_RID237_S1_NZ_JBDYRX010000003.1:311400-311455_length:56_mod0000 -M_T0_RID237_S1_NZ_JBDYSJ010000001.1:341900-342051_length:152_mod0001 -M_T0_RID237_S1_NZ_JBDYSJ010000002.1:210078-210161_length:84_mod0000 -M_T0_RID239_S1_NZ_JBDYLZ010000008.1:60180-60243_length:64_mod0000 -M_T0_RID240_S0_NC_028376.1:8889-8978_length:90_mod0000 -M_T0_RID240_S0_NZ_JBDYLZ010000011.1:107039-107086_length:48_mod0000 -M_T0_RID240_S1_NC_029255.1:88189-88282_length:94_mod0000 -M_T0_RID242_S0_NC_031275.1:6726-6767_length:42_mod0000 -M_T0_RID242_S1_NZ_JBDYRX010000003.1:456427-456495_length:69_mod0000 -M_T0_RID243_S0_NC_038232.1:593-634_length:42_mod0000 -M_T0_RID244_S0_NZ_JBDYRX010000004.1:71169-71250_length:82_mod0000 -M_T0_RID244_S1_NC_031105.1:1094-1177_length:84_mod0000 -M_T0_RID244_S1_NZ_JBDYRX010000003.1:93344-93453_length:110_mod0000 -M_T0_RID245_S1_NC_027916.2:74440-74509_length:70_mod0000 -M_T0_RID246_S0_NZ_JBDYLZ010000007.1:253179-253255_length:77_mod0000 -M_T0_RID246_S0_NZ_JBDYRX010000003.1:373773-373844_length:72_mod0000 -M_T0_RID247_S1_NC_034240.1:6159-6240_length:82_mod0000 -M_T0_RID247_S1_NZ_JBDYLZ010000006.1:319402-319479_length:78_mod0000 -M_T0_RID248_S1_NZ_JBDYLZ010000021.1:15403-15484_length:82_mod0000 -M_T0_RID248_S1_NZ_JBDYSJ010000002.1:614316-614362_length:47_mod0000 -M_T0_RID249_S1_NZ_JBDYSJ010000002.1:599779-599834_length:56_mod0000 -M_T0_RID250_S0_NC_027916.2:147626-147747_length:122_mod0000 -M_T0_RID250_S0_NC_033620.1:26136-26203_length:68_mod0000 -M_T0_RID251_S1_NZ_JBDYRX010000003.1:388429-388516_length:88_mod0001 -M_T0_RID252_S0_NZ_JBDYRX010000003.1:533554-533659_length:106_mod0000 -M_T0_RID252_S0_NZ_JBDYSJ010000004.1:89796-89871_length:76_mod0000 -M_T0_RID254_S0_NC_029312.1:1320-1415_length:96_mod0000 -M_T0_RID254_S1_NC_033722.1:1513-1562_length:50_mod0000 -M_T0_RID254_S1_NZ_JBDYRX010000003.1:600746-600803_length:58_mod0000 -M_T0_RID255_S1_NZ_JBDYLZ010000009.1:84943-85024_length:82_mod0000 -M_T0_RID256_S0_NZ_JBDYRX010000002.1:72764-72831_length:68_mod0000 -M_T0_RID256_S1_NZ_JBDYSJ010000003.1:105583-105635_length:53_mod0001 -M_T0_RID257_S0_NC_029997.2:11591-11678_length:88_mod0000 -M_T0_RID257_S0_NZ_JBDYLZ010000007.1:42813-42887_length:75_mod0000 -M_T0_RID258_S0_NC_030151.1:5275-5349_length:75_mod0000 -M_T0_RID258_S1_NC_023442.1:46718-46759_length:42_mod0000 -M_T0_RID258_S1_NC_027641.1:2606-2691_length:86_mod0000 -M_T0_RID259_S0_NZ_JBDYRX010000001.1:515399-515441_length:43_mod0000 -M_T0_RID259_S1_NC_033710.1:2139-2199_length:61_mod0001 -M_T0_RID260_S0_NZ_JBDYRX010000004.1:304887-304994_length:108_mod0000 -M_T0_RID261_S0_NC_024913.1:363-436_length:74_mod0000 -M_T0_RID261_S1_NZ_JBDYSJ010000003.1:83891-83937_length:47_mod0000 -M_T0_RID262_S0_NC_028964.1:8465-8506_length:42_mod0000 -M_T0_RID262_S1_NC_028369.1:11507-11563_length:57_mod0000 -M_T0_RID263_S1_NZ_JBDYLZ010000007.1:59938-60023_length:86_mod0000 -M_T0_RID264_S1_NC_030240.1:10284-10380_length:97_mod0000 -M_T0_RID266_S0_NZ_JBDYRX010000003.1:575037-575078_length:42_mod0000 -M_T0_RID268_S0_NZ_JBDYRX010000001.1:768153-768245_length:93_mod0000 -M_T0_RID268_S0_NZ_JBDYSJ010000001.1:798703-798770_length:68_mod0000 -M_T0_RID270_S0_NC_029132.1:95722-95798_length:77_mod0000 -M_T0_RID270_S1_NZ_JBDYSJ010000004.1:222075-222158_length:84_mod0000 -M_T0_RID271_S0_NC_033620.1:162451-162504_length:54_mod0000 -M_T0_RID272_S0_NC_033620.1:33874-33960_length:87_mod0000 -M_T0_RID273_S1_NC_030744.1:7300-7340_length:41_mod0000 -M_T0_RID273_S1_NZ_JBDYRX010000002.1:841729-841840_length:112_mod0000 -M_T0_RID274_S1_NC_037571.1:1402-1475_length:74_mod0000 -M_T0_RID274_S1_NC_037615.1:1507-1556_length:50_mod0000 -M_T0_RID274_S1_NZ_JBDYRX010000002.1:803747-803830_length:84_mod0001 -M_T0_RID276_S0_NZ_JBDYSJ010000001.1:37440-37524_length:85_mod0000 -M_T0_RID276_S1_NZ_JBDYSJ010000003.1:418336-418453_length:118_mod0000 -M_T0_RID277_S1_NZ_JBDYLZ010000010.1:25227-25303_length:77_mod0000 -M_T0_RID277_S1_NZ_JBDYRX010000004.1:42366-42442_length:77_mod0000 -M_T0_RID280_S1_NC_029255.1:110657-110707_length:51_mod0000 -M_T0_RID280_S1_NZ_JBDYLZ010000007.1:148039-148124_length:86_mod0000 -M_T0_RID280_S1_NZ_JBDYSJ010000003.1:358558-358656_length:99_mod0000 -M_T0_RID281_S0_NZ_JBDYRX010000001.1:319973-320043_length:71_mod0000 -M_T0_RID281_S1_NC_033717.1:9058-9157_length:100_mod0000 -M_T0_RID281_S1_NZ_JBDYLZ010000009.1:175718-175802_length:85_mod0000 -M_T0_RID282_S0_NZ_JBDYRX010000002.1:378265-378345_length:81_mod0001 -M_T0_RID283_S1_NC_027016.1:6355-6413_length:59_mod0000 -M_T0_RID283_S1_NC_028230.1:391-510_length:120_mod0000 -M_T0_RID285_S1_NC_034376.1:1364-1410_length:47_mod0000 -M_T0_RID286_S1_NC_027918.1:6177-6259_length:83_mod0000 -M_T0_RID287_S0_NZ_JBDYRX010000003.1:370134-370205_length:72_mod0000 -M_T0_RID289_S0_NZ_JBDYRX010000001.1:744827-744955_length:129_mod0000 -M_T0_RID289_S1_NC_028259.1:3827-3878_length:52_mod0000 -M_T0_RID290_S0_NC_030240.1:45198-45233_length:36_mod0000 -M_T0_RID290_S0_NC_030691.1:1722-1773_length:52_mod0000 -M_T0_RID290_S1_NC_029133.1:4034-4132_length:99_mod0000 -M_T0_RID291_S1_NC_028981.1:5970-6046_length:77_mod0000 -M_T0_RID291_S1_NZ_JBDYSJ010000002.1:464139-464169_length:31_mod0000 -M_T0_RID293_S1_NC_030232.1:2260-2327_length:68_mod0000 -M_T0_RID295_S1_NC_027916.2:61867-61920_length:54_mod0000 -M_T0_RID295_S1_NC_028806.1:27530-27608_length:79_mod0000 -M_T0_RID296_S0_NZ_JBDYSJ010000001.1:184354-184410_length:57_mod0000 -M_T0_RID296_S1_NC_028867.1:5870-5944_length:75_mod0000 -M_T0_RID296_S1_NC_029034.2:6068-6170_length:103_mod0000 -M_T0_RID296_S1_NC_029575.1:1786-1824_length:39_mod0000 -M_T0_RID296_S1_NC_031313.1:8320-8423_length:104_mod0000 -M_T0_RID296_S1_NZ_JBDYRX010000001.1:732093-732144_length:52_mod0000 -M_T0_RID300_S0_NC_030870.1:888-963_length:76_mod0000 -M_T0_RID300_S1_NC_028239.1:12981-13075_length:95_mod0001 -M_T0_RID301_S0_NC_027016.1:47977-48089_length:113_mod0000 -M_T0_RID301_S0_NC_029997.2:77533-77588_length:56_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000001.1:795273-795348_length:76_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000003.1:723584-723651_length:68_mod0000 -M_T0_RID302_S1_NC_033820.1:4695-4770_length:76_mod0000 -M_T0_RID303_S0_NZ_JBDYSJ010000002.1:596456-596511_length:56_mod0000 -M_T0_RID303_S1_NZ_JBDYLZ010000013.1:92895-92926_length:32_mod0000 -M_T0_RID304_S0_NC_031463.1:20675-20751_length:77_mod0000 -M_T0_RID306_S0_NC_027916.2:96621-96699_length:79_mod0000 -M_T0_RID307_S0_NC_028266.1:10941-10980_length:40_mod0000 -M_T0_RID308_S1_NZ_JBDYLZ010000010.1:103191-103276_length:86_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:370261-370296_length:36_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:387786-387861_length:76_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000003.1:389721-389777_length:57_mod0000 -M_T0_RID309_S1_NC_026944.1:4310-4395_length:86_mod0000 -M_T0_RID309_S1_NZ_JBDYSJ010000001.1:151328-151382_length:55_mod0000 -M_T0_RID311_S0_NZ_JBDYLZ010000006.1:59717-59765_length:49_mod0000 -M_T0_RID311_S1_NZ_JBDYLZ010000023.1:5604-5703_length:100_mod0000 -M_T0_RID312_S1_NC_018382.1:3769-3816_length:48_mod0000 -M_T0_RID313_S1_NZ_JBDYRX010000002.1:139751-139865_length:115_mod0000 -M_T0_RID314_S0_NZ_JBDYSJ010000004.1:132522-132621_length:100_mod0000 -M_T0_RID315_S0_NC_033823.1:7820-7860_length:41_mod0000 -M_T0_RID317_S0_NC_034214.1:5951-5996_length:46_mod0000 -M_T0_RID317_S0_NZ_JBDYLZ010000015.1:71185-71277_length:93_mod0000 -M_T0_RID317_S0_NZ_JBDYRX010000004.1:174342-174382_length:41_mod0000 -M_T0_RID317_S1_NC_030293.1:5902-5968_length:67_mod0001 -M_T0_RID318_S0_NC_028814.1:27392-27476_length:85_mod0000 -M_T0_RID318_S0_NZ_JBDYRX010000001.1:771856-771930_length:75_mod0000 -M_T0_RID318_S1_NZ_JBDYLZ010000006.1:119310-119391_length:82_mod0000 -M_T0_RID319_S0_NC_034266.1:62140-62218_length:79_mod0000 -M_T0_RID319_S1_NC_028981.1:4292-4341_length:50_mod0000 -M_T0_RID319_S1_NC_031455.1:2498-2551_length:54_mod0000 -M_T0_RID319_S1_NZ_JBDYRX010000004.1:60929-61033_length:105_mod0000 -M_T0_RID322_S1_NZ_JBDYRX010000003.1:440227-440291_length:65_mod0000 -M_T0_RID323_S0_NC_030240.1:40893-40967_length:75_mod0000 -M_T0_RID323_S0_NZ_JBDYLZ010000007.1:249215-249268_length:54_mod0000 -M_T0_RID324_S0_NC_029311.1:87639-87764_length:126_mod0000 -M_T0_RID324_S0_NZ_JBDYSJ010000002.1:545609-545688_length:80_mod0000 -M_T0_RID324_S1_NZ_JBDYSJ010000003.1:210751-210786_length:36_mod0000 -M_T0_RID325_S1_NC_031240.1:7762-7813_length:52_mod0000 -M_T0_RID326_S0_NZ_JBDYLZ010000009.1:5470-5539_length:70_mod0000 -M_T0_RID328_S1_NZ_JBDYRX010000002.1:171169-171268_length:100_mod0000 -M_T0_RID329_S0_NZ_JBDYRX010000002.1:757356-757453_length:98_mod0000 -M_T0_RID329_S1_NZ_JBDYLZ010000008.1:68972-69065_length:94_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:680879-680974_length:96_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:706464-706551_length:88_mod0000 -M_T0_RID331_S0_NC_029255.1:77095-77131_length:37_mod0000 -M_T0_RID331_S0_NC_030240.1:62248-62311_length:64_mod0000 -M_T0_RID331_S1_NC_030126.1:1582-1653_length:72_mod0001 -M_T0_RID331_S1_NC_033707.1:5319-5406_length:88_mod0000 -M_T0_RID331_S1_NZ_JBDYLZ010000016.1:42739-42823_length:85_mod0000 -M_T0_RID332_S0_NZ_JBDYSJ010000004.1:35297-35358_length:62_mod0000 -M_T0_RID333_S0_NZ_JBDYLZ010000014.1:79014-79074_length:61_mod0000 -M_T0_RID333_S1_NC_027647.1:655-726_length:72_mod0000 -M_T0_RID333_S1_NC_033620.1:54726-54845_length:120_mod0000 -M_T0_RID334_S0_NZ_JBDYRX010000002.1:455003-455101_length:99_mod0000 -M_T0_RID335_S0_NZ_JBDYRX010000002.1:694573-694718_length:146_mod0000 -M_T0_RID335_S1_NZ_JBDYSJ010000001.1:102384-102461_length:78_mod0000 -M_T0_RID337_S0_NC_028368.1:13695-13792_length:98_mod0000 -M_T0_RID338_S0_NZ_JBDYRX010000001.1:578324-578379_length:56_mod0000 -M_T0_RID338_S1_NZ_JBDYRX010000003.1:471689-471760_length:72_mod0000 -M_T0_RID339_S1_NC_028362.1:1132-1236_length:105_mod0000 -M_T0_RID339_S1_NZ_JBDYRX010000003.1:626110-626150_length:41_mod0000 -M_T0_RID339_S1_NZ_JBDYSJ010000002.1:576422-576503_length:82_mod0000 -M_T0_RID340_S0_NC_028973.1:4682-4727_length:46_mod0000 -M_T0_RID340_S0_NC_029132.1:93532-93576_length:45_mod0000 -M_T0_RID341_S0_NC_030240.1:112206-112263_length:58_mod0000 -M_T0_RID341_S0_NC_034252.1:1229-1329_length:101_mod0000 -M_T0_RID342_S0_NZ_JBDYLZ010000011.1:111949-111982_length:34_mod0001 -M_T0_RID342_S1_NZ_JBDYLZ010000008.1:135318-135406_length:89_mod0001 -M_T0_RID343_S0_NC_029996.1:68953-69051_length:99_mod0000 -M_T0_RID344_S1_NC_030148.1:11118-11172_length:55_mod0000 -M_T0_RID345_S0_NZ_JBDYRX010000002.1:64932-64977_length:46_mod0000 -M_T0_RID346_S1_NZ_JBDYRX010000003.1:433612-433704_length:93_mod0000 -M_T0_RID347_S0_NC_036636.1:7712-7773_length:62_mod0000 -M_T0_RID347_S1_NZ_JBDYRX010000002.1:59074-59138_length:65_mod0000 -M_T0_RID347_S1_NZ_JBDYSJ010000003.1:117376-117430_length:55_mod0001 -M_T0_RID348_S0_NZ_JBDYRX010000001.1:1015831-1015930_length:100_mod0000 -M_T0_RID348_S1_NZ_JBDYRX010000001.1:141445-141557_length:113_mod0000 -M_T0_RID349_S0_NC_030391.1:4068-4155_length:88_mod0001 -M_T0_RID349_S0_NZ_JBDYRX010000001.1:226925-227009_length:85_mod0000 -M_T0_RID349_S1_NZ_JBDYRX010000003.1:358370-358434_length:65_mod0000 -M_T0_RID351_S0_NC_033753.1:4226-4317_length:92_mod0000 -M_T0_RID352_S1_NC_028259.1:56-127_length:72_mod0000 -M_T0_RID352_S1_NC_028395.1:155-248_length:94_mod0000 -M_T0_RID352_S1_NC_029931.1:9204-9241_length:38_mod0000 -M_T0_RID353_S0_NZ_JBDYLZ010000009.1:48165-48236_length:72_mod0000 -M_T0_RID354_S1_NZ_JBDYLZ010000012.1:45797-45922_length:126_mod0000 -M_T0_RID356_S0_NC_028378.1:3454-3530_length:77_mod0000 -M_T0_RID357_S0_NZ_JBDYRX010000002.1:120553-120591_length:39_mod0000 -M_T0_RID357_S1_NZ_JBDYSJ010000004.1:245908-245957_length:50_mod0000 -M_T0_RID358_S0_NC_029126.1:5901-5938_length:38_mod0000 -M_T0_RID358_S1_NC_028140.1:1554-1651_length:98_mod0000 -M_T0_RID358_S1_NZ_JBDYSJ010000002.1:580725-580785_length:61_mod0001 -M_T0_RID359_S0_NZ_JBDYRX010000001.1:601220-601298_length:79_mod0000 -M_T0_RID360_S0_NC_027916.2:77660-77740_length:81_mod0001 -M_T0_RID360_S0_NZ_JBDYLZ010000012.1:70482-70531_length:50_mod0000 -M_T0_RID360_S1_NC_017862.1:2881-2912_length:32_mod0000 -M_T0_RID360_S1_NC_028373.1:7802-7900_length:99_mod0000 -M_T0_RID361_S0_NZ_JBDYRX010000003.1:274684-274747_length:64_mod0000 -M_T0_RID362_S0_NC_029996.1:102820-102944_length:125_mod0001 -M_T0_RID362_S1_NC_027916.2:110368-110450_length:83_mod0000 -M_T0_RID362_S1_NZ_JBDYSJ010000002.1:480705-480765_length:61_mod0000 -M_T0_RID363_S0_NC_031089.1:6455-6543_length:89_mod0000 -M_T0_RID363_S0_NC_031218.1:1568-1623_length:56_mod0000 -M_T0_RID365_S1_NZ_JBDYSJ010000002.1:271975-272051_length:77_mod0000 -M_T0_RID366_S0_NZ_JBDYSJ010000001.1:487398-487484_length:87_mod0001 -M_T0_RID366_S1_NC_030843.1:4921-5005_length:85_mod0000 -M_T0_RID367_S0_NC_030127.1:2548-2589_length:42_mod0000 -M_T0_RID367_S0_NZ_JBDYLZ010000011.1:24860-24971_length:112_mod0000 -M_T0_RID367_S1_NZ_JBDYLZ010000006.1:96139-96201_length:63_mod0000 -M_T0_RID368_S0_NZ_JBDYSJ010000002.1:604782-604905_length:124_mod0001 -M_T0_RID369_S1_NC_031464.1:5161-5234_length:74_mod0000 -M_T0_RID370_S0_NC_027542.1:1019-1100_length:82_mod0000 -M_T0_RID371_S1_NC_028144.1:5011-5099_length:89_mod0000 -M_T0_RID371_S1_NZ_JBDYRX010000002.1:678499-678596_length:98_mod0000 -M_T0_RID372_S0_NZ_JBDYRX010000003.1:526040-526077_length:38_mod0000 -M_T0_RID372_S0_NZ_JBDYSJ010000002.1:283416-283463_length:48_mod0001 -M_T0_RID373_S0_NC_033705.1:55-95_length:41_mod0000 -M_T0_RID374_S0_NC_027016.1:151413-151449_length:37_mod0000 -M_T0_RID374_S0_NZ_JBDYSJ010000003.1:310288-310375_length:88_mod0000 -M_T0_RID374_S1_NZ_JBDYLZ010000012.1:57726-57851_length:126_mod0000 -M_T0_RID375_S0_NC_034377.1:6340-6385_length:46_mod0000 -M_T0_RID375_S1_NC_028099.1:112413-112504_length:92_mod0001 -M_T0_RID378_S0_NC_018448.1:5936-6007_length:72_mod0000 -M_T0_RID379_S1_NZ_JBDYRX010000001.1:727009-727109_length:101_mod0000 -M_T0_RID380_S0_NC_034253.1:5146-5187_length:42_mod0000 -M_T0_RID380_S1_NC_029905.1:2051-2094_length:44_mod0000 -M_T0_RID381_S0_NC_030240.1:103311-103373_length:63_mod0000 -M_T0_RID381_S0_NZ_JBDYLZ010000009.1:178104-178162_length:59_mod0000 -M_T0_RID382_S0_NC_027210.1:5895-5968_length:74_mod0000 -M_T0_RID382_S0_NC_029996.1:87376-87478_length:103_mod0000 -M_T0_RID382_S1_NC_027916.2:84236-84307_length:72_mod0000 -M_T0_RID383_S0_NZ_JBDYSJ010000001.1:683370-683456_length:87_mod0000 -M_T0_RID383_S1_NC_029132.1:79856-79920_length:65_mod0000 -M_T0_RID385_S0_NZ_JBDYLZ010000009.1:69071-69118_length:48_mod0000 -M_T0_RID386_S0_NC_034225.1:1556-1648_length:93_mod0000 -M_T0_RID387_S1_NC_028636.1:123682-123742_length:61_mod0000 -M_T0_RID388_S0_NZ_JBDYLZ010000008.1:71860-71983_length:124_mod0000 -M_T0_RID389_S0_NC_029051.1:9270-9318_length:49_mod0000 -M_T0_RID389_S0_NZ_JBDYLZ010000016.1:61192-61254_length:63_mod0000 -M_T0_RID390_S1_NC_028981.1:1738-1830_length:93_mod0000 -M_T0_RID391_S0_NC_028371.1:6428-6495_length:68_mod0000 -M_T0_RID391_S0_NZ_JBDYRX010000004.1:272450-272500_length:51_mod0000 -M_T0_RID391_S1_NZ_JBDYSJ010000002.1:543099-543205_length:107_mod0000 -M_T0_RID392_S0_NC_028970.1:5031-5099_length:69_mod0000 -M_T0_RID392_S1_NC_028824.1:19380-19469_length:90_mod0000 -M_T0_RID392_S1_NZ_JBDYLZ010000009.1:26519-26597_length:79_mod0000 -M_T0_RID393_S0_NZ_JBDYLZ010000015.1:66736-66802_length:67_mod0000 -M_T0_RID395_S0_NC_031304.1:4214-4304_length:91_mod0000 -M_T0_RID396_S0_NZ_JBDYSJ010000001.1:683444-683483_length:40_mod0000 -M_T0_RID397_S0_NC_028125.1:5157-5221_length:65_mod0000 -M_T0_RID398_S0_NC_028814.1:21296-21329_length:34_mod0000 -M_T0_RID398_S0_NZ_JBDYLZ010000008.1:89568-89611_length:44_mod0000 -M_T0_RID398_S1_NZ_JBDYRX010000003.1:160428-160514_length:87_mod0000 -M_T0_RID399_S1_NZ_JBDYRX010000002.1:383166-383266_length:101_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000006.1:321094-321166_length:73_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000017.1:46480-46536_length:57_mod0000 -M_T0_RID402_S0_NC_028491.1:36087-36159_length:73_mod0000 -M_T0_RID406_S0_NC_033720.1:8569-8637_length:69_mod0000 -M_T0_RID406_S0_NZ_JBDYSJ010000002.1:605544-605617_length:74_mod0000 -M_T0_RID406_S1_NC_033620.1:71763-71841_length:79_mod0000 -M_T0_RID407_S0_NC_028491.1:95220-95304_length:85_mod0000 -M_T0_RID407_S0_NZ_JBDYRX010000004.1:531865-531922_length:58_mod0000 -M_T0_RID408_S0_NZ_JBDYLZ010000006.1:20241-20331_length:91_mod0000 -M_T0_RID408_S1_NC_030391.1:1047-1152_length:106_mod0000 -M_T0_RID409_S1_NC_029904.1:2927-3013_length:87_mod0000 -M_T0_RID410_S0_NC_028369.1:7176-7240_length:65_mod0000 -M_T0_RID410_S1_NC_027923.1:107200-107294_length:95_mod0000 -M_T0_RID411_S1_NC_027916.2:12656-12743_length:88_mod0000 -M_T0_RID412_S0_NC_028362.1:1734-1810_length:77_mod0000 -M_T0_RID414_S0_NC_027646.1:3518-3556_length:39_mod0000 -M_T0_RID415_S1_NC_033703.1:4454-4536_length:83_mod0000 -M_T0_RID415_S1_NZ_JBDYRX010000004.1:398358-398416_length:59_mod0000 -M_T0_RID419_S0_NZ_JBDYSJ010000002.1:339543-339583_length:41_mod0000 -M_T0_RID420_S0_NC_029919.1:1092-1170_length:79_mod0000 -M_T0_RID420_S1_NC_029132.1:86139-86240_length:102_mod0000 -M_T0_RID421_S0_NZ_JBDYRX010000004.1:42510-42680_length:171_mod0001 -M_T0_RID421_S1_NC_028099.1:99392-99421_length:30_mod0000 -M_T0_RID422_S0_NC_028236.1:7738-7797_length:60_mod0000 -M_T0_RID422_S0_NZ_JBDYLZ010000014.1:21662-21716_length:55_mod0000 -M_T0_RID422_S0_NZ_JBDYSJ010000002.1:476168-476219_length:52_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:131159-131244_length:86_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:465551-465658_length:108_mod0000 -M_T0_RID424_S0_NC_029132.1:124479-124602_length:124_mod0000 -M_T0_RID424_S1_NZ_JBDYLZ010000006.1:180426-180481_length:56_mod0000 -M_T0_RID424_S1_NZ_JBDYSJ010000003.1:445372-445447_length:76_mod0000 -M_T0_RID425_S0_NZ_JBDYLZ010000006.1:11120-11222_length:103_mod0000 -M_T0_RID426_S1_NZ_JBDYRX010000002.1:460851-460904_length:54_mod0000 -M_T0_RID426_S1_NZ_JBDYSJ010000001.1:882579-882628_length:50_mod0000 -M_T0_RID427_S0_NZ_JBDYSJ010000001.1:460394-460459_length:66_mod0000 -M_T0_RID428_S1_NZ_JBDYLZ010000007.1:203593-203667_length:75_mod0000 -M_T0_RID432_S1_NZ_JBDYRX010000004.1:37215-37282_length:68_mod0000 -M_T0_RID433_S0_NC_028371.1:7751-7803_length:53_mod0000 -M_T0_RID433_S0_NZ_JBDYRX010000001.1:940205-940283_length:79_mod0000 -M_T0_RID434_S0_NZ_JBDYRX010000003.1:278075-278140_length:66_mod0000 -M_T0_RID435_S1_NC_031225.1:6315-6360_length:46_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000001.1:992235-992354_length:120_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000002.1:28179-28253_length:75_mod0000 -M_T0_RID436_S0_NZ_JBDYRX010000004.1:193926-194033_length:108_mod0000 -M_T0_RID438_S0_NZ_JBDYRX010000004.1:427488-427551_length:64_mod0000 -M_T0_RID441_S1_NC_028486.1:4288-4332_length:45_mod0000 -M_T0_RID441_S1_NC_031135.1:1215-1254_length:40_mod0000 -M_T0_RID441_S1_NC_033620.1:171185-171273_length:89_mod0000 -M_T0_RID441_S1_NZ_JBDYRX010000001.1:944430-944505_length:76_mod0000 -M_T0_RID442_S1_NZ_JBDYSJ010000001.1:795030-795132_length:103_mod0000 -M_T0_RID444_S1_NC_029927.1:739-780_length:42_mod0000 -M_T0_RID445_S0_NC_030400.1:9136-9237_length:102_mod0000 -M_T0_RID445_S1_NC_037578.1:3062-3107_length:46_mod0000 -M_T0_RID446_S0_NC_029996.1:10622-10695_length:74_mod0000 -M_T0_RID446_S1_NC_034266.1:27796-27894_length:99_mod0000 -M_T0_RID447_S1_NC_031259.1:1711-1781_length:71_mod0000 -M_T0_RID450_S0_NZ_JBDYRX010000003.1:719829-719908_length:80_mod0000 -M_T0_RID451_S0_NC_027214.1:8775-8830_length:56_mod0000 -M_T0_RID451_S0_NC_028367.1:5391-5502_length:112_mod0000 -M_T0_RID451_S1_NZ_JBDYRX010000002.1:31090-31200_length:111_mod0000 -M_T0_RID452_S1_NC_030205.1:1725-1812_length:88_mod0000 -M_T0_RID453_S0_NC_033761.1:8903-9009_length:107_mod0001 -M_T0_RID455_S0_NC_027799.1:284-375_length:92_mod0000 -M_T0_RID455_S1_NZ_JBDYLZ010000014.1:95838-95936_length:99_mod0000 -M_T0_RID455_S1_NZ_JBDYSJ010000002.1:210490-210557_length:68_mod0000 -M_T0_RID456_S0_NZ_JBDYLZ010000007.1:109571-109660_length:90_mod0000 -M_T0_RID456_S1_NC_030240.1:55430-55543_length:114_mod0000 -M_T0_RID457_S1_NZ_JBDYLZ010000009.1:123168-123262_length:95_mod0000 -M_T0_RID457_S1_NZ_JBDYSJ010000004.1:21364-21417_length:54_mod0000 -M_T0_RID458_S1_NC_034266.1:128171-128258_length:88_mod0000 -M_T0_RID458_S1_NZ_JBDYLZ010000008.1:129533-129587_length:55_mod0000 -M_T0_RID458_S1_NZ_JBDYRX010000002.1:29087-29147_length:61_mod0000 -M_T0_RID459_S0_NZ_JBDYRX010000001.1:1023086-1023182_length:97_mod0000 -M_T0_RID459_S1_NC_023442.1:114262-114356_length:95_mod0000 -M_T0_RID460_S0_NC_029052.1:1193-1273_length:81_mod0000 -M_T0_RID462_S1_NZ_JBDYRX010000001.1:1005315-1005420_length:106_mod0000 -M_T0_RID463_S0_NC_028372.1:9914-9999_length:86_mod0000 -M_T0_RID463_S1_NZ_JBDYSJ010000004.1:218365-218453_length:89_mod0000 -M_T0_RID465_S0_NZ_JBDYSJ010000001.1:787887-787945_length:59_mod0000 -M_T0_RID465_S1_NC_029311.1:1797-1831_length:35_mod0000 -M_T0_RID466_S0_NZ_JBDYRX010000003.1:730520-730588_length:69_mod0000 -M_T0_RID470_S1_NC_033820.1:3073-3102_length:30_mod0000 -M_T0_RID471_S1_NZ_JBDYLZ010000008.1:35202-35290_length:89_mod0000 -M_T0_RID472_S0_NZ_JBDYLZ010000011.1:10802-10846_length:45_mod0000 -M_T0_RID472_S1_NZ_JBDYRX010000001.1:652634-652707_length:74_mod0000 -M_T0_RID474_S0_NC_030225.1:5289-5336_length:48_mod0000 -M_T0_RID475_S0_NZ_JBDYLZ010000006.1:151548-151631_length:84_mod0000 -M_T0_RID475_S0_NZ_JBDYRX010000002.1:464041-464153_length:113_mod0000 -M_T0_RID476_S0_NZ_JBDYLZ010000015.1:62860-62918_length:59_mod0000 -M_T0_RID477_S0_NC_027214.1:4315-4391_length:77_mod0000 -M_T0_RID477_S0_NC_030231.1:4362-4445_length:84_mod0000 -M_T0_RID477_S1_NC_027926.1:5336-5385_length:50_mod0000 -M_T0_RID479_S0_NC_034240.1:10006-10105_length:100_mod0000 -M_T0_RID479_S0_NC_034377.1:6973-7006_length:34_mod0000 -M_T0_RID479_S1_NC_029309.1:1183-1291_length:109_mod0000 -M_T0_RID479_S1_NZ_JBDYRX010000004.1:294593-294685_length:93_mod0000 -M_T0_RID480_S0_NC_030148.1:14092-14146_length:55_mod0000 -M_T0_RID481_S1_NC_027920.1:4910-4956_length:47_mod0000 -M_T0_RID481_S1_NC_028252.1:1447-1525_length:79_mod0000 -M_T0_RID481_S1_NC_029038.1:3990-4034_length:45_mod0000 -M_T0_RID482_S0_NC_031287.1:3748-3826_length:79_mod0000 -M_T0_RID483_S0_NC_029311.1:111589-111673_length:85_mod0000 -M_T0_RID484_S0_NZ_JBDYRX010000001.1:874633-874662_length:30_mod0000 -M_T0_RID484_S1_NZ_JBDYRX010000002.1:457659-457735_length:77_mod0000 -M_T0_RID487_S0_NC_023339.1:3452-3542_length:91_mod0000 -M_T0_RID488_S1_NC_030800.1:3767-3843_length:77_mod0000 -M_T0_RID490_S1_NC_028249.1:6706-6755_length:50_mod0000 -M_T0_RID490_S1_NC_033815.1:382-420_length:39_mod0000 -M_T0_RID491_S0_NC_029549.1:1543-1601_length:59_mod0000 -M_T0_RID491_S1_NC_023442.1:106362-106456_length:95_mod0001 -M_T0_RID491_S1_NZ_JBDYSJ010000002.1:433503-433622_length:120_mod0000 -M_T0_RID492_S1_NC_017967.1:4737-4790_length:54_mod0000 -M_T0_RID497_S1_NC_028231.1:2435-2530_length:96_mod0000 -M_T0_RID498_S1_NC_028368.1:10324-10389_length:66_mod0000 -M_T0_RID498_S1_NC_031088.1:10285-10350_length:66_mod0000 -M_T0_RID499_S0_NZ_JBDYLZ010000012.1:63930-64011_length:82_mod0000 -M_T0_RID500_S0_NZ_JBDYSJ010000003.1:369722-369827_length:106_mod0000 -M_T0_RID501_S0_NC_034214.1:4534-4626_length:93_mod0000 -M_T0_RID503_S1_NZ_JBDYLZ010000014.1:65584-65643_length:60_mod0001 -M_T0_RID504_S0_NC_033727.1:6181-6283_length:103_mod0000 -M_T0_RID504_S0_NC_037572.1:353-481_length:129_mod0000 -M_T0_RID506_S0_NZ_JBDYSJ010000001.1:230782-230869_length:88_mod0000 -M_T0_RID506_S1_NZ_JBDYRX010000001.1:155361-155441_length:81_mod0000 -M_T0_RID507_S0_NZ_JBDYRX010000001.1:64196-64251_length:56_mod0001 -M_T0_RID507_S0_NZ_JBDYRX010000002.1:311911-312021_length:111_mod0000 -M_T0_RID508_S1_NC_028382.1:618-664_length:47_mod0000 -M_T0_RID509_S0_NZ_JBDYRX010000002.1:83623-83710_length:88_mod0000 -M_T0_RID509_S0_NZ_JBDYSJ010000002.1:32694-32813_length:120_mod0000 -M_T0_RID512_S0_NC_031301.1:7499-7600_length:102_mod0000 -M_T0_RID512_S0_NZ_JBDYSJ010000001.1:497297-497384_length:88_mod0001 -M_T0_RID512_S1_NC_023299.1:173-222_length:50_mod0000 -M_T0_RID514_S0_NC_028144.1:1039-1130_length:92_mod0000 -M_T0_RID515_S1_NC_028239.1:1870-1935_length:66_mod0000 -M_T0_RID516_S0_NC_028099.1:69736-69811_length:76_mod0000 -M_T0_RID518_S0_NZ_JBDYSJ010000002.1:172879-172954_length:76_mod0000 -M_T0_RID518_S1_NC_028374.1:22488-22593_length:106_mod0000 -M_T0_RID519_S0_NZ_JBDYSJ010000004.1:83804-83909_length:106_mod0000 -M_T0_RID519_S1_NC_023442.1:37132-37228_length:97_mod0000 -M_T0_RID520_S1_NC_033821.1:5336-5462_length:127_mod0000 -M_T0_RID521_S1_NC_028362.1:8323-8409_length:87_mod0000 -M_T0_RID521_S1_NC_033620.1:165922-166009_length:88_mod0000 -M_T0_RID526_S0_NZ_JBDYLZ010000008.1:191196-191301_length:106_mod0000 -M_T0_RID527_S0_NZ_JBDYRX010000001.1:664374-664450_length:77_mod0000 -M_T0_RID530_S1_NC_029255.1:118676-118738_length:63_mod0000 -M_T0_RID531_S0_NC_030240.1:18050-18083_length:34_mod0000 -M_T0_RID535_S0_NZ_JBDYRX010000003.1:273784-273814_length:31_mod0000 -M_T0_RID535_S0_NZ_JBDYSJ010000001.1:408974-409045_length:72_mod0000 -M_T0_RID536_S1_NZ_JBDYLZ010000007.1:187492-187559_length:68_mod0001 -M_T0_RID537_S0_NC_031106.1:5925-5990_length:66_mod0000 -M_T0_RID539_S0_NC_023442.1:25605-25715_length:111_mod0000 -M_T0_RID539_S0_NC_030922.1:6177-6250_length:74_mod0000 -M_T0_RID539_S1_NC_033732.1:488-545_length:58_mod0000 -M_T0_RID539_S1_NZ_JBDYRX010000003.1:428710-428748_length:39_mod0000 -M_T0_RID540_S1_NC_028636.1:8122-8203_length:82_mod0000 -M_T0_RID540_S1_NC_033777.1:478-533_length:56_mod0000 -M_T0_RID541_S0_NZ_JBDYLZ010000009.1:17788-17882_length:95_mod0000 -M_T0_RID543_S0_NZ_JBDYLZ010000006.1:137222-137319_length:98_mod0000 -M_T0_RID545_S1_NC_033620.1:141319-141407_length:89_mod0000 -M_T0_RID547_S0_NC_029901.1:2272-2382_length:111_mod0000 -M_T0_RID548_S0_NC_027916.2:50899-50962_length:64_mod0000 -M_T0_RID549_S0_NZ_JBDYRX010000003.1:184280-184329_length:50_mod0000 -M_T0_RID549_S1_NC_027016.1:166476-166540_length:65_mod0001 -M_T0_RID552_S0_NC_031244.1:259-371_length:113_mod0000 -M_T0_RID552_S1_NZ_JBDYSJ010000001.1:904809-904898_length:90_mod0000 -M_T0_RID555_S0_NC_029255.1:86976-87025_length:50_mod0000 -M_T0_RID555_S0_NC_033700.1:23881-23958_length:78_mod0000 -M_T0_RID555_S1_NZ_JBDYSJ010000003.1:459317-459387_length:71_mod0000 -M_T0_RID556_S0_NC_029800.1:2415-2467_length:53_mod0000 -M_T0_RID556_S0_NZ_JBDYRX010000003.1:269557-269627_length:71_mod0000 -M_T0_RID556_S1_NC_018151.1:436-524_length:89_mod0000 -M_T0_RID556_S1_NC_029997.2:2602-2635_length:34_mod0000 -M_T0_RID560_S0_NC_030691.1:8709-8769_length:61_mod0000 -M_T0_RID563_S0_NZ_JBDYSJ010000001.1:279557-279665_length:109_mod0000 -M_T0_RID563_S1_NC_029255.1:16285-16387_length:103_mod0000 -M_T0_RID563_S1_NC_030651.1:8044-8106_length:63_mod0000 -M_T0_RID564_S1_NC_030380.1:905-947_length:43_mod0000 -M_T0_RID566_S0_NZ_JBDYRX010000002.1:228758-228796_length:39_mod0000 -M_T0_RID566_S1_NC_027916.2:158878-158953_length:76_mod0000 -M_T0_RID568_S0_NC_033718.1:5028-5099_length:72_mod0000 -M_T0_RID569_S1_NZ_JBDYSJ010000002.1:4445-4500_length:56_mod0000 -M_T0_RID571_S1_NC_030200.1:53402-53457_length:56_mod0000 -M_T0_RID571_S1_NC_031291.1:6265-6343_length:79_mod0000 -M_T0_RID573_S0_NZ_JBDYSJ010000001.1:821929-821988_length:60_mod0000 -M_T0_RID573_S1_NZ_JBDYRX010000002.1:420333-420420_length:88_mod0000 -M_T0_RID578_S0_NC_028389.1:883-929_length:47_mod0000 -M_T0_RID578_S1_NC_027920.1:2737-2802_length:66_mod0000 -M_T0_RID578_S1_NZ_JBDYRX010000001.1:125147-125264_length:118_mod0000 -M_T0_RID579_S1_NC_028636.1:80919-81006_length:88_mod0000 -M_T0_RID579_S1_NZ_JBDYRX010000003.1:600760-600842_length:83_mod0000 -M_T0_RID579_S1_NZ_JBDYSJ010000001.1:621908-622008_length:101_mod0000 -M_T0_RID580_S0_NC_031236.1:9639-9701_length:63_mod0000 -M_T0_RID580_S0_NC_033620.1:115666-115748_length:83_mod0000 -M_T0_RID584_S1_NZ_JBDYRX010000003.1:30143-30232_length:90_mod0000 -M_T0_RID587_S1_NC_030236.1:1921-2018_length:98_mod0000 -M_T0_RID588_S0_NZ_JBDYRX010000004.1:487902-487980_length:79_mod0000 -M_T0_RID592_S0_NZ_JBDYRX010000004.1:290162-290207_length:46_mod0000 -M_T0_RID596_S0_NC_028491.1:22873-22918_length:46_mod0000 -M_T0_RID597_S0_NZ_JBDYRX010000004.1:248380-248414_length:35_mod0000 -M_T0_RID598_S0_NZ_JBDYLZ010000013.1:99135-99225_length:91_mod0000 -M_T0_RID598_S0_NZ_JBDYRX010000004.1:521129-521194_length:66_mod0000 -M_T0_RID598_S1_NC_027781.1:1542-1623_length:82_mod0000 -M_T0_RID598_S1_NC_033828.1:1452-1571_length:120_mod0000 -M_T0_RID599_S0_NZ_JBDYLZ010000018.1:17132-17215_length:84_mod0000 -M_T0_RID601_S1_NZ_JBDYRX010000004.1:64749-64831_length:83_mod0000 -M_T0_RID601_S1_NZ_JBDYSJ010000004.1:72990-73054_length:65_mod0000 -M_T0_RID603_S1_NZ_JBDYRX010000003.1:148174-148218_length:45_mod0000 -M_T0_RID606_S1_NZ_JBDYRX010000004.1:81494-81540_length:47_mod0000 -M_T0_RID608_S1_NZ_JBDYLZ010000006.1:54120-54159_length:40_mod0000 -M_T0_RID608_S1_NZ_JBDYSJ010000003.1:75571-75624_length:54_mod0000 -M_T0_RID609_S0_NZ_JBDYLZ010000017.1:21746-21833_length:88_mod0000 -M_T0_RID610_S1_NZ_JBDYRX010000004.1:416636-416711_length:76_mod0000 -M_T0_RID617_S1_NZ_JBDYLZ010000013.1:81956-82016_length:61_mod0000 -M_T0_RID618_S0_NZ_JBDYRX010000001.1:154047-154079_length:33_mod0000 -M_T0_RID619_S0_NZ_JBDYRX010000001.1:929162-929284_length:123_mod0000 -M_T0_RID620_S1_NZ_JBDYRX010000004.1:231083-231194_length:112_mod0000 -M_T0_RID622_S0_NC_029117.1:1274-1341_length:68_mod0000 -M_T0_RID625_S1_NZ_JBDYRX010000003.1:351246-351297_length:52_mod0000 -M_T0_RID626_S0_NZ_JBDYRX010000003.1:54224-54264_length:41_mod0000 -M_T0_RID627_S1_NZ_JBDYRX010000002.1:425465-425547_length:83_mod0000 -M_T0_RID629_S1_NC_028264.1:4326-4405_length:80_mod0000 -M_T0_RID630_S0_NZ_JBDYSJ010000002.1:388835-388868_length:34_mod0000 -M_T0_RID633_S1_NZ_JBDYRX010000003.1:253941-254012_length:72_mod0000 -M_T0_RID634_S1_NC_033815.1:2695-2865_length:171_mod0000 -M_T0_RID635_S1_NC_033700.1:17426-17511_length:86_mod0000 -M_T0_RID636_S0_NC_029086.1:7004-7042_length:39_mod0000 -M_T0_RID638_S1_NZ_JBDYSJ010000001.1:82298-82352_length:55_mod0000 -M_T0_RID640_S0_NC_033756.1:5658-5786_length:129_mod0001 -M_T0_RID641_S0_NC_027706.1:187-292_length:106_mod0000 -M_T0_RID642_S0_NC_034266.1:154137-154203_length:67_mod0000 -M_T0_RID642_S0_NZ_JBDYRX010000003.1:290122-290229_length:108_mod0000 -M_T0_RID643_S0_NC_017937.1:1077-1164_length:88_mod0000 -M_T0_RID643_S0_NZ_JBDYRX010000002.1:527817-527928_length:112_mod0000 -M_T0_RID645_S0_NC_030799.1:4650-4688_length:39_mod0000 -M_T0_RID645_S1_NZ_JBDYLZ010000008.1:186276-186348_length:73_mod0000 -M_T0_RID651_S1_NC_033733.1:2956-3039_length:84_mod0001 -M_T0_RID651_S1_NZ_JBDYRX010000001.1:479171-479229_length:59_mod0000 -M_T0_RID653_S1_NC_029311.1:77186-77261_length:76_mod0000 -M_T0_RID654_S0_NZ_JBDYSJ010000001.1:904727-904802_length:76_mod0000 -M_T0_RID655_S0_NZ_JBDYSJ010000001.1:482269-482365_length:97_mod0000 -M_T0_RID655_S1_NZ_JBDYRX010000002.1:520330-520420_length:91_mod0000 -M_T0_RID656_S0_NC_028259.1:1542-1591_length:50_mod0000 -M_T0_RID656_S0_NZ_JBDYLZ010000019.1:6097-6185_length:89_mod0000 -M_T0_RID660_S1_NC_034266.1:157401-157477_length:77_mod0000 -M_T0_RID664_S0_NC_027916.2:59946-59993_length:48_mod0000 -M_T0_RID664_S0_NZ_JBDYLZ010000015.1:82686-82741_length:56_mod0000 -M_T0_RID664_S0_NZ_JBDYSJ010000003.1:87421-87503_length:83_mod0000 -M_T0_RID668_S0_NZ_JBDYRX010000004.1:18573-18663_length:91_mod0000 -M_T0_RID670_S0_NC_027920.1:1301-1393_length:93_mod0000 -M_T0_RID673_S1_NC_033703.1:545-616_length:72_mod0000 -M_T0_RID673_S1_NZ_JBDYRX010000001.1:644803-644895_length:93_mod0000 -M_T0_RID679_S0_NZ_JBDYRX010000002.1:605076-605139_length:64_mod0000 -M_T0_RID679_S1_NC_033703.1:1306-1364_length:59_mod0000 -M_T0_RID680_S0_NZ_JBDYRX010000002.1:632837-632879_length:43_mod0000 -M_T0_RID681_S1_NZ_JBDYSJ010000002.1:496144-496188_length:45_mod0000 -M_T0_RID682_S0_NZ_JBDYSJ010000001.1:116469-116509_length:41_mod0000 -M_T0_RID683_S0_NZ_JBDYRX010000001.1:675311-675352_length:42_mod0000 -M_T0_RID683_S0_NZ_JBDYSJ010000004.1:71365-71456_length:92_mod0000 -M_T0_RID683_S1_NC_029255.1:7610-7675_length:66_mod0000 -M_T0_RID686_S0_NC_027429.1:2932-2966_length:35_mod0000 -M_T0_RID686_S1_NC_027923.1:107955-107999_length:45_mod0000 -M_T0_RID686_S1_NC_029132.1:95050-95160_length:111_mod0000 -M_T0_RID689_S1_NZ_JBDYSJ010000004.1:138231-138318_length:88_mod0000 -M_T0_RID691_S1_NC_033710.1:3870-3926_length:57_mod0000 -M_T0_RID692_S1_NC_027531.1:1508-1612_length:105_mod0000 -M_T0_RID695_S0_NC_030200.1:124072-124139_length:68_mod0000 -M_T0_RID697_S0_NC_028921.1:5390-5470_length:81_mod0000 -M_T0_RID699_S0_NC_031083.1:4910-4975_length:66_mod0000 -M_T0_RID699_S1_NZ_JBDYLZ010000010.1:101894-101946_length:53_mod0000 -M_T0_RID700_S1_NZ_JBDYSJ010000001.1:915360-915453_length:94_mod0000 -M_T0_RID702_S1_NC_028099.1:63829-63929_length:101_mod0000 -M_T0_RID706_S0_NC_027210.1:7432-7505_length:74_mod0000 -M_T0_RID707_S1_NZ_JBDYRX010000002.1:367432-367522_length:91_mod0001 -M_T0_RID707_S1_NZ_JBDYSJ010000004.1:260063-260128_length:66_mod0000 -M_T0_RID709_S1_NZ_JBDYRX010000003.1:29327-29484_length:158_mod0000 -M_T0_RID710_S1_NC_033720.1:7987-8089_length:103_mod0000 -M_T0_RID711_S0_NZ_JBDYLZ010000006.1:173182-173278_length:97_mod0000 -M_T0_RID711_S1_NC_033700.1:20537-20567_length:31_mod0000 -M_T0_RID711_S1_NZ_JBDYSJ010000001.1:181184-181271_length:88_mod0000 -M_T0_RID714_S0_NC_037612.1:3005-3122_length:118_mod0000 -M_T0_RID715_S0_NC_027788.1:468-551_length:84_mod0000 -M_T0_RID715_S1_NZ_JBDYLZ010000006.1:219162-219260_length:99_mod0000 -M_T0_RID717_S0_NC_030654.1:1669-1721_length:53_mod0000 -M_T0_RID719_S1_NZ_JBDYSJ010000001.1:826609-826678_length:70_mod0000 -M_T0_RID722_S1_NC_027923.1:41169-41259_length:91_mod0001 -M_T0_RID727_S0_NC_029997.2:28478-28523_length:46_mod0000 -M_T0_RID728_S0_NZ_JBDYRX010000002.1:879157-879230_length:74_mod0000 -M_T0_RID729_S1_NZ_JBDYLZ010000008.1:194207-194253_length:47_mod0000 -M_T0_RID731_S1_NC_030117.1:17286-17318_length:33_mod0000 -M_T0_RID736_S0_NZ_JBDYRX010000001.1:178466-178588_length:123_mod0000 -M_T0_RID737_S0_NC_028491.1:18226-18284_length:59_mod0000 -M_T0_RID739_S1_NZ_JBDYLZ010000011.1:127333-127376_length:44_mod0000 -M_T0_RID743_S0_NC_037573.1:1169-1247_length:79_mod0000 -M_T0_RID747_S1_NZ_JBDYRX010000002.1:430138-430204_length:67_mod0000 -M_T0_RID749_S1_NZ_JBDYRX010000003.1:71924-71986_length:63_mod0000 -M_T0_RID752_S0_NC_031336.1:9006-9046_length:41_mod0000 -M_T0_RID753_S0_NZ_JBDYSJ010000003.1:446526-446575_length:50_mod0000 -M_T0_RID757_S0_NC_028136.1:1312-1355_length:44_mod0000 -M_T0_RID757_S1_NC_027016.1:202899-202969_length:71_mod0000 -M_T0_RID757_S1_NZ_JBDYRX010000004.1:461576-461693_length:118_mod0000 -M_T0_RID759_S1_NC_029691.1:3622-3733_length:112_mod0000 -M_T0_RID763_S1_NC_027916.2:99012-99086_length:75_mod0000 -M_T0_RID763_S1_NC_028265.1:10302-10344_length:43_mod0000 -M_T0_RID763_S1_NC_030798.1:7132-7233_length:102_mod0000 -M_T0_RID763_S1_NZ_JBDYLZ010000015.1:37189-37249_length:61_mod0000 -M_T0_RID765_S0_NC_028261.1:4356-4443_length:88_mod0000 -M_T0_RID767_S1_NC_027916.2:86943-87045_length:103_mod0000 -M_T0_RID768_S0_NC_028491.1:2854-2933_length:80_mod0000 -M_T0_RID768_S0_NC_030200.1:40203-40312_length:110_mod0000 -M_T0_RID771_S0_NZ_JBDYLZ010000019.1:13804-13871_length:68_mod0000 -M_T0_RID778_S1_NC_031275.1:5153-5201_length:49_mod0000 -M_T0_RID781_S1_NZ_JBDYRX010000003.1:540287-540355_length:69_mod0000 -M_T0_RID783_S1_NZ_JBDYLZ010000010.1:89260-89349_length:90_mod0000 -M_T0_RID785_S1_NC_027199.1:11719-11818_length:100_mod0000 -M_T0_RID786_S1_NZ_JBDYLZ010000008.1:173777-173859_length:83_mod0000 -M_T0_RID788_S0_NC_030922.1:1394-1483_length:90_mod0000 -M_T0_RID793_S0_NZ_JBDYRX010000003.1:539904-539954_length:51_mod0001 -M_T0_RID797_S1_NZ_JBDYRX010000004.1:414620-414694_length:75_mod0000 -M_T0_RID807_S1_NC_030117.1:45331-45378_length:48_mod0000 -M_T0_RID810_S0_NC_028491.1:85062-85136_length:75_mod0001 -M_T0_RID811_S1_NC_030697.1:295-351_length:57_mod0000 -M_T0_RID813_S1_NC_027016.1:91244-91325_length:82_mod0000 -M_T0_RID817_S1_NC_030240.1:108663-108730_length:68_mod0001 -M_T0_RID823_S0_NC_033620.1:158427-158465_length:39_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000003.1:241332-241406_length:75_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000004.1:228843-228928_length:86_mod0000 -M_T0_RID827_S0_NZ_JBDYSJ010000004.1:239871-239973_length:103_mod0000 -M_T0_RID832_S0_NZ_JBDYLZ010000015.1:88774-88854_length:81_mod0000 -M_T0_RID833_S0_NZ_JBDYSJ010000001.1:590978-591039_length:62_mod0000 -M_T0_RID837_S1_NZ_JBDYRX010000001.1:656888-656964_length:77_mod0000 -M_T0_RID840_S0_NC_028396.1:529-621_length:93_mod0000 -M_T0_RID844_S1_NZ_JBDYLZ010000007.1:237741-237786_length:46_mod0000 -M_T0_RID847_S0_NZ_JBDYRX010000003.1:703429-703507_length:79_mod0000 -M_T0_RID852_S0_NC_030240.1:105292-105367_length:76_mod0000 -M_T0_RID856_S0_NZ_JBDYRX010000003.1:28070-28132_length:63_mod0000 -M_T0_RID856_S1_NC_027644.1:3712-3804_length:93_mod0000 -M_T0_RID858_S0_NZ_JBDYSJ010000003.1:197400-197485_length:86_mod0000 -M_T0_RID858_S1_NZ_JBDYSJ010000004.1:175908-175948_length:41_mod0000 -M_T0_RID859_S0_NC_033777.1:2010-2066_length:57_mod0000 -M_T0_RID862_S1_NC_030799.1:1806-1881_length:76_mod0000 -M_T0_RID865_S1_NZ_JBDYSJ010000002.1:326035-326087_length:53_mod0000 -M_T0_RID873_S1_NC_028119.1:2502-2583_length:82_mod0000 -M_T0_RID880_S0_NC_033620.1:55069-55148_length:80_mod0000 -M_T0_RID882_S0_NZ_JBDYRX010000002.1:484332-484416_length:85_mod0000 -M_T0_RID882_S1_NC_034266.1:103121-103153_length:33_mod0000 -M_T0_RID885_S0_NZ_JBDYRX010000003.1:244205-244252_length:48_mod0000 -M_T0_RID885_S1_NC_036636.1:5051-5143_length:93_mod0000 -M_T0_RID887_S0_NC_029132.1:58239-58309_length:71_mod0000 -M_T0_RID895_S1_NZ_JBDYRX010000004.1:290403-290535_length:133_mod0000 -M_T0_RID900_S0_NZ_JBDYRX010000003.1:442650-442708_length:59_mod0000 -M_T0_RID903_S0_NC_029994.1:1129-1161_length:33_mod0000 -M_T0_RID910_S1_NC_030801.1:531-591_length:61_mod0000 -M_T0_RID913_S1_NZ_JBDYSJ010000001.1:289314-289350_length:37_mod0000 -M_T0_RID923_S1_NC_028374.1:1835-1919_length:85_mod0000 -M_T0_RID930_S0_NC_033727.1:5848-5935_length:88_mod0000 -M_T0_RID941_S0_NZ_JBDYLZ010000020.1:17961-18008_length:48_mod0000 -M_T0_RID951_S0_NZ_JBDYLZ010000007.1:258088-258169_length:82_mod0000 -M_T0_RID960_S1_NZ_JBDYRX010000001.1:365497-365549_length:53_mod0000 -M_T0_RID963_S0_NZ_JBDYSJ010000002.1:471116-471242_length:127_mod0000 -M_T0_RID967_S0_NC_028145.1:2423-2491_length:69_mod0000 -M_T0_RID969_S1_NC_027917.1:3392-3477_length:86_mod0000 -M_T0_RID973_S1_NC_028243.1:233-298_length:66_mod0000 -M_T0_RID975_S0_NZ_JBDYLZ010000006.1:262785-262833_length:49_mod0000 -M_T0_RID977_S0_NC_029311.1:110890-110930_length:41_mod0000 -M_T0_RID978_S1_NC_033707.1:4471-4569_length:99_mod0000 -M_T0_RID978_S1_NZ_JBDYLZ010000011.1:12262-12308_length:47_mod0000 -M_T0_RID987_S1_NZ_JBDYRX010000002.1:268856-268924_length:69_mod0000 -M_T0_RID993_S0_NZ_JBDYSJ010000002.1:495946-496025_length:80_mod0000 -M_T0_RID997_S0_NC_029303.1:1692-1771_length:80_mod0000 -M_T0_RID1003_S0_NZ_JBDYSJ010000001.1:678727-678783_length:57_mod0000 -M_T0_RID1022_S1_NC_030746.1:3635-3726_length:92_mod0000 -M_T0_RID1023_S1_NZ_JBDYLZ010000006.1:264893-265013_length:121_mod0000 -M_T0_RID1048_S0_NZ_JBDYLZ010000008.1:126930-127042_length:113_mod0000 -M_T0_RID1070_S0_NZ_JBDYRX010000003.1:112054-112158_length:105_mod0000 -M_T0_RID250_S0_NC_028636.1:14337-14398_length:62_mod0000 diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/config.yaml b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/config.yaml deleted file mode 100644 index ae3df34..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/config.yaml +++ /dev/null @@ -1,142 +0,0 @@ - -# - Only tested with Phred33 quality scores - -samples: config/samples.tsv - -units: config/units.tsv - - - -############# -### READS ### -############# -trim: - trim: - activate: true - tool: adapterremoval - params: "--trimns --maxns 10 --trimqualities --minlength 30 --mask-degenerate-bases --seed 12345" - - # Ignored for SE - collapse: - activate: true - params: "--collapse-conservatively" - -derep: - extension: - activate: false - k: 16 - params: "ibb=t prefilter=0 el=100 er=100 ecc=f ecco=f ignorebadquality extendrollback=0" - - derep: - activate: true - # vsearch or seqkit - tool: seqkit - params: "" - - low_complex: - params: "entropy=0.7 entropywindow=30 entropyk=4" - - - -############# -### ALIGN ### -############# -prefilter: - taxa: "Bacteria,Archaea,Viruses" - - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: - prok: - n_shards: 2 - path: "data/prok.{n_shard}-of-2.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal -N 1" - bt2l: False - acc2taxid: "data/prok.acc2taxid.gz" - virus: - n_shards: 1 - path: "data/virus.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/virus.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 25 --weight_type 1 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2" - - -euk: - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: - mitoch: - n_shards: 1 - path: "data/mitoch.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/mitoch.acc2taxid.gz" - plastid: - n_shards: 1 - path: "data/plastid.1-of-1.fas.gz" - map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False - acc2taxid: "data/plastid.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 15 --sim_score_low 0.95 --weight_type 0 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2 --seed 12345" - - -############ -## REPORT ## -############ -report: - multiqc: "--no-ai --verbose --cl-config 'custom_logo: data/KU_long.png' --cl-config 'custom_logo_title: CAEG - Center for Ancient Environmental Genomics' --cl-config 'custom_logo_url: https://globe.ku.dk/research/caeg/'" - multiqc_db_url: "test_qc.sqlite" diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/samples.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/samples.tsv deleted file mode 100644 index 5994081..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/samples.tsv +++ /dev/null @@ -1,2 +0,0 @@ -sample alias group condition -Lib ancient diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/units.tsv b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/units.tsv deleted file mode 100644 index 4a8a376..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/config/config/units.tsv +++ /dev/null @@ -1,4 +0,0 @@ -sample library flowcell lane seq_type library_type material data machine run_n sample_n date center platform adapters -Lib LVsim1 BHXXXXXXXX L001 PE ds DNA data/test_L001_R{Read}.fq.gz SIMULATED 0000 S1 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Lib LVsim1 BHXXXXXXXX L002 PE ds DNA data/test_L002_R{Read}.fq.gz SIMULATED 0000 S2 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Lib LVsim2 BHXXXXXXXX L001 PE ds DNA data/test_L003_R{Read}.fq.gz SIMULATED 0000 S3 2025-10-09 CAEG ILLUMINA AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/prok.acc2taxid.gz b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/prok.acc2taxid.gz deleted file mode 100644 index 5dbe5f2c237214001d7b8d28aebf9192854d1107..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 392 zcmb2|=3sE>exAX=oO|W0ACsei>qAqUo|(I@?)UDM?mXxs9B8)hf3yah!1EX}9jni* zyIy~J(;vUP{rLIkkA+UZU!M0ZVpq4XThEGH8B-#vw(QLL7^9rq7k0_-maOcO=8_5D zmQL`y^it!0fzE=B7PmZ`O=Ou+ZW^)Ax^Pe+~ z0P$w*+_bE~v~{L-HdpxMibF}hMW&tVI@eUNa#l{X`QTX(HvlC)bRug+fLUu&zMqvNP% zv^G-FdsED2x3CkZX2ss$op1f-ZQ9Etr+y?)^+}1^>^CiCXIk@`2~$N^KcD^aOVR&* zw{GuWdiliWUdvmZtES9fU%8b15_6_~@K?blN>djr`Cck9@#M}d+%h5T(yI*B+$Co( gy4~{Jy?AcP1U`56mnw7n&b>9)-cX=l#l^q?0BzL4k^lez diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/names.dmp b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/names.dmp deleted file mode 100644 index a2db560..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/names.dmp +++ /dev/null @@ -1,6450 +0,0 @@ -1 | all | | synonym -1 | root | | scientific name -2 | "Bacteria" Cavalier-Smith 1987 | | authority -2 | "Bacteriobiota" Luketa 2012 | | authority -2 | Bacteria | Bacteria | scientific name -2 | Bacteria (ex Cavalier-Smith 1987) | | synonym -2 | Bacteria Woese et al. 2024 | | synonym -2 | Bacteriobiota | | synonym -2 | Monera | Monera | in-part -2 | Procaryotae | Procaryotae | in-part -2 | Prokaryota | Prokaryota | in-part -2 | Prokaryotae | Prokaryotae | in-part -2 | bacteria | bacteria | blast name -2 | bacteria | bacteria | genbank common name -2 | eubacteria | | common name -2 | prokaryote | prokaryote | in-part -2 | prokaryotes | prokaryotes | in-part -543 | Enterobacteraceae | | synonym -543 | Enterobacteraceae (ex Lapage 1979) Lapage 1982 | | authority -543 | Enterobacteriaceae | | scientific name -543 | Enterobacteriaceae (ex Rahn 1937) Ewing et al. 1980 | | authority -543 | Enterobacteriaceae Rahn 1937 (Approved Lists 1980) emend. Adeolu et al. 2016 | | authority -543 | enterobacteria | enterobacteria | blast name -543 | enterobacteria | enterobacteria | genbank common name -543 | gamma-3 proteobacteria | gamma-3 proteobacteria | in-part -548 | "Aerobacter aerogenes" Hormaeche and Edwards 1958 | | authority -548 | ATCC 13048 | ATCC 13048 | type material -548 | Aerobacter aerogenes | | synonym -548 | CCUG 1429 | CCUG 1429 | type material -548 | CIP 60.86 | CIP 60.86 | type material -548 | DSM 30053 | DSM 30053 | type material -548 | Enterobacter aerogenes | | synonym -548 | Enterobacter aerogenes Hormaeche and Edwards 1960 | | authority -548 | HAMBI 101 | HAMBI 101 | type material -548 | HAMBI 1898 | HAMBI 1898 | type material -548 | IFO 13534 | IFO 13534 | type material -548 | JCM 1235 | JCM 1235 | type material -548 | KCTC 2190 | KCTC 2190 | type material -548 | Klebsiella aerogenes | | scientific name -548 | Klebsiella aerogenes (Hormaeche and Edwards 1960) Tindall et al. 2017 | | authority -548 | Klebsiella mobilis | | synonym -548 | Klebsiella mobilis Bascomb et al. 1971 | | authority -548 | LMG 2094 | LMG 2094 | type material -548 | LMG:2094 | LMG:2094 | type material -548 | NBRC 13534 | NBRC 13534 | type material -548 | NCAIM B.01467 | NCAIM B.01467 | type material -548 | NCTC 10006 | NCTC 10006 | type material -568 | Hafnia | | scientific name -568 | Hafnia Moller 1954 | | authority -570 | "Donovania" Anderson et al. 1944 | | authority -570 | "Hyalococcus" Schroeter 1886 | | authority -570 | Calymmatobacterium | | synonym -570 | Calymmatobacterium Aragao and Vianna 1913 | | authority -570 | Donovania | | synonym -570 | Hyalococcus | | synonym -570 | Klebsiella | | scientific name -570 | Klebsiella Trevisan 1885 (Approved Lists 1980) | | authority -570 | Klebsiella Trevisan 1885 (Approved Lists 1980) emend. Carter et al. 1999 | | authority -570 | Klebsiella Trevisan 1885 (Approved Lists 1980) emend. Drancourt et al. 2001 | | authority -570 | Klebsiella Trevisan 1885 (Approved Lists 1980) emend. Ma et al. 2021 | | authority -573 | "Bacillus pneumoniae" (Schroeter 1886) Flugge 1886 | | authority -573 | "Bacterium pneumoniae crouposae" Zopf 1885 | | authority -573 | "Hyalococcus pneumoniae" Schroeter 1886 | | authority -573 | 'Klebsiella aerogenes' (Kruse) Taylor et al. 1956 | | synonym -573 | ATCC 13883 | ATCC 13883 | type material -573 | Bacillus pneumoniae | | synonym -573 | Bacterium pneumoniae crouposae | | synonym -573 | CCUG 225 | CCUG 225 | type material -573 | CDC 298-53 | CDC 298-53 | type material -573 | CIP 82.91 | CIP 82.91 | type material -573 | DSM 30104 | DSM 30104 | type material -573 | HAMBI 450 | HAMBI 450 | type material -573 | Hyalococcus pneumoniae | | synonym -573 | IAM 14200 | IAM 14200 | type material -573 | IFO 14940 | IFO 14940 | type material -573 | JCM 1662 | JCM 1662 | type material -573 | Klebsiella pneumoniae | | scientific name -573 | Klebsiella pneumoniae (Schroeter 1886) Trevisan 1887 | | authority -573 | Klebsiella pneumoniae aerogenes | | synonym -573 | Klebsiella sp. 2N3 | | includes -573 | Klebsiella sp. C1(2016) | | includes -573 | Klebsiella sp. M-AI-2 | | includes -573 | Klebsiella sp. PB12 | | includes -573 | Klebsiella sp. RCE-7 | | includes -573 | LMG 2095 | LMG 2095 | type material -573 | LMG:2095 | LMG:2095 | type material -573 | NBRC 14940 | NBRC 14940 | type material -573 | NCTC 9633 | NCTC 9633 | type material -574 | "Bacillus mucosus azaenae" Abel 1893 | | authority -574 | "Bacillus ozaenae" Abel 1893 | | authority -574 | "Bacterium ozaenae" (Abel 1893) Lehmann and Neumann 1896 | | authority -574 | ATCC 11296 | ATCC 11296 | type material -574 | Bacillus mucosus azaenae | | synonym -574 | Bacillus ozaenae | | synonym -574 | Bacterium ozaenae | | synonym -574 | CCUG 15938 | CCUG 15938 | type material -574 | CIP 52.211 | CIP 52.211 | type material -574 | DSM 16358 | DSM 16358 | type material -574 | JCM 1663 | JCM 1663 | type material -574 | Klebsiella ozaenae | | synonym -574 | Klebsiella ozaenae (Abel 1893) Bergey et al. 1925 (Approved Lists 1980) | | authority -574 | Klebsiella pneumoniae (SUBSP. OZAENAE) | | synonym -574 | Klebsiella pneumoniae ozaenae | | synonym -574 | Klebsiella pneumoniae subsp. ozaenae | | scientific name -574 | Klebsiella pneumoniae subsp. ozaenae (Abel 1893) Orskov 1984 | | authority -574 | Klebsiella sp. VTT E-96667 | | includes -574 | LMG 3113 | LMG 3113 | type material -574 | LMG:3113 | LMG:3113 | type material -574 | NBRC 105683 | NBRC 105683 | type material -574 | NBRC-105683 | NBRC-105683 | type material -574 | NBRC105683 | NBRC105683 | type material -574 | NBRC:105683 | NBRC:105683 | type material -574 | NCTC 5050 | NCTC 5050 | type material -1224 | "Alphaproteobacteriota" Whitman et al. 2018 | | synonym -1224 | "Proteobacteria" Garrity et al. 2005 | | authority -1224 | "Proteobacteriota" Panda et al. 2022 | | authority -1224 | Alphaproteobacteriota | | synonym -1224 | Proteobacteria | | synonym -1224 | Proteobacteria Stackebrandt et al. 1988 | | authority -1224 | Proteobacteriota | | synonym -1224 | Pseudomonadota | | scientific name -1224 | Pseudomonadota corrig. Garrity et al. 2021 | | authority -1224 | proteobacteria | proteobacteria | blast name -1224 | proteobacteria | proteobacteria | genbank common name -1224 | purple photosynthetic bacteria and relatives | | common name -1236 | "Pseudomonadia" Oren et al. 2016 | | authority -1236 | Gammaproteobacteria | | scientific name -1236 | Gammaproteobacteria Garrity et al. 2005 emend. Williams and Kelly 2013 | | authority -1236 | Proteobacteria gamma subdivision | | synonym -1236 | Pseudomonadia | | synonym -1236 | Purple bacteria, gamma subdivision | | synonym -1236 | g-proteobacteria | g-proteobacteria | blast name -1236 | g-proteobacteria | g-proteobacteria | genbank common name -1236 | gamma proteobacteria | | synonym -1236 | gamma subdivision | | synonym -1236 | gamma subgroup | | synonym -2157 | "Archaea" Woese et al. 1990 | | authority -2157 | "Archaebacteria" (sic) Woese and Fox 1977 | | authority -2157 | "Archaebiota" Luketa 2012 | | authority -2157 | Archaea | | scientific name -2157 | Archaea Woese et al. 2024 | | authority -2157 | Archaebacteria | | synonym -2157 | Archaebiota | | synonym -2157 | Mendosicutes | | synonym -2157 | Metabacteria | | synonym -2157 | Monera | Monera | in-part -2157 | Procaryotae | Procaryotae | in-part -2157 | Prokaryota | Prokaryota | in-part -2157 | Prokaryotae | Prokaryotae | in-part -2157 | archaea | | blast name -2157 | prokaryote | prokaryote | in-part -2157 | prokaryotes | prokaryotes | in-part -2235 | "Haloarchaeales" DasSarma and DasSarma 2008 | | authority -2235 | Haloarchaeales | | synonym -2235 | Halobacteriales | | scientific name -2235 | Halobacteriales Grant and Larsen 1989 | | authority -2235 | Halobacteriales Grant and Larsen 1989 emend. Gupta et al. 2015 | | authority -2235 | Haloferacales | | synonym -2235 | Haloferacales Gupta et al. 2015 | | authority -2235 | Natrialbales | | synonym -2235 | Natrialbales Gupta et al. 2015 | | authority -2759 | Eucarya | | synonym -2759 | Eucaryotae | | synonym -2759 | Eukarya | | synonym -2759 | Eukaryota | | scientific name -2759 | Eukaryotae | | synonym -2759 | eukaryotes | eukaryotes | blast name -2759 | eukaryotes | eukaryotes | genbank common name -2763 | Rhodophyceae | | synonym -2763 | Rhodophycota | | synonym -2763 | Rhodophyta | | scientific name -2763 | algae | algae | in-part -2763 | red algae | red algae | blast name -2763 | red algae | red algae | genbank common name -2763 | rhodophytes | | common name -2781 | Gracilariopsis | | scientific name -2781 | Gracilariopsis E.Y.Dawson, 1949 | | authority -2806 | Florideophyceae | | scientific name -2806 | Florideophycideae | | synonym -2870 | Chromophycota | | synonym -2870 | Fucophyceae | | synonym -2870 | Phaeophyceae | | scientific name -2870 | Phaeophyta | | synonym -2870 | algae | algae | in-part -2870 | brown algae | brown algae | blast name -2870 | brown algae | brown algae | genbank common name -2886 | Laminariales | | scientific name -2887 | Alariaceae | | scientific name -2888 | Alaria | Alaria | scientific name -3041 | Chlorophycota | | synonym -3041 | Chlorophyta | | scientific name -3041 | Chlorophyta Pascher, 1914 | | authority -3041 | Chlorophyta sensu Bremer 1985 | | synonym -3041 | Prasinophyceae | | includes -3041 | algae | algae | in-part -3041 | green algae | green algae | blast name -3041 | green algae | green algae | genbank common name -3041 | prasinophyte clade VII | | includes -3041 | prasinophytes | prasinophytes | in-part -3166 | Chlorophyceae | | scientific name -3166 | Chlorophyceae Christensen, 1994 | | authority -3176 | Zygnematales | | scientific name -3176 | Zygnematales C.E.Bessey, 1907 | | authority -3178 | Zygnemataceae | | scientific name -3178 | Zygnemataceae Kuetzing, 1843 | | authority -3193 | Embryophyta | | scientific name -3193 | higher plants | | common name -3193 | land plants | land plants | blast name -3193 | land plants | land plants | genbank common name -3193 | plants | | common name -3208 | Bryophyta | | scientific name -3208 | Musci | | synonym -3208 | bryophytes | bryophytes | in-part -3208 | mosses | mosses | blast name -3208 | mosses | mosses | genbank common name -3214 | Bryopsida | | scientific name -3214 | Bryopsida Pax, 1900 | | authority -3296 | Cycadophyta | | equivalent name -3296 | Cycadopsida | | scientific name -3296 | cycads | | genbank common name -3297 | Cycadales | | scientific name -3297 | Cycadales Pers. ex Bercht. & J.Presl, 1820 | | authority -3313 | Coniferales | | synonym -3313 | Pinidae | | scientific name -3313 | Pinidae Cronquist, Takht. & Zimmerm., 1966 | | authority -3394 | Cycadaceae | | scientific name -3394 | Cycadaceae Pers., 1807 | | authority -3395 | Cycas | | scientific name -3395 | Cycas L. | | authority -3395 | Epicycas | | synonym -3395 | Epicycas de Laub. | | authority -3398 | Angiospermae | | synonym -3398 | Magnoliophyta | | synonym -3398 | Magnoliopsida | | scientific name -3398 | angiosperms | | common name -3398 | flowering plants | flowering plants | blast name -3398 | flowering plants | flowering plants | genbank common name -3400 | Magnoliales | | scientific name -3400 | Magnoliales Bromhead, 1838 | | authority -3400 | Magnolianae | | in-part -3400 | Magnoliineae | | includes -3401 | Magnoliaceae | | scientific name -3401 | Magnoliaceae Juss., 1789 | | authority -3401 | magnolia family | | common name -3402 | Alcimandra | | synonym -3402 | Alcimandra Dandy, 1927 | | authority -3402 | Aromadendron | | synonym -3402 | Aromadendron Blume, 1825 | | authority -3402 | Dugandiodendron | | synonym -3402 | Dugandiodendron Lozano, 1975 | | authority -3402 | Elmerrillia | | synonym -3402 | Elmerrillia Dandy, 1927 | | authority -3402 | Kmeria | | synonym -3402 | Kmeria Dandy, 1927 | | authority -3402 | Lirianthe | | synonym -3402 | Lirianthe Spach, 1839 | | authority -3402 | Magnolia | | scientific name -3402 | Magnolia L., 1753 | | authority -3402 | Michelia | | synonym -3402 | Michelia L., 1753 | | authority -3402 | Pachylarnax | | synonym -3402 | Pachylarnax Dandy, 1927 | | authority -3402 | Parakmeria | | synonym -3402 | Parakmeria Hu & W.C.Cheng, 1951 | | authority -3402 | Talauma | | synonym -3402 | Talauma Juss., 1789 | | authority -3402 | Tsoongiodendron | | includes -3440 | Ranunculaceae | | scientific name -3440 | Ranunculaceae Juss., 1789 | | authority -3440 | buttercup family | | common name -3487 | Moraceae | | scientific name -3487 | Moraceae Gaudich., 1835 | | authority -3487 | mulberry family | | common name -3502 | Casuarinales | | includes -3502 | Casuarinales Bercht. & J. Presl, 1820 | | authority -3502 | Fagales | | scientific name -3502 | Fagales Engl., 1892 | | authority -3502 | Juglandales | | includes -3502 | Juglandales Bercht. & J. Presl, 1820 | | authority -3502 | Myricineae | | includes -3503 | Fagaceae | | scientific name -3503 | Fagaceae Dumort., 1829 | | authority -3503 | beech family | | common name -3511 | Quercus | | scientific name -3511 | Quercus L. | | authority -3524 | Caryophyllales | | scientific name -3524 | Caryophyllales Juss. ex Bercht. & J.Presl, 1820 | | authority -3524 | Centrospermae | | synonym -3524 | Nepenthineae | | includes -3524 | Physenales | | includes -3524 | Polygonales | | includes -3650 | Cucurbitaceae | | scientific name -3650 | Cucurbitaceae Juss., 1789 | | authority -3650 | cucumber family | | common name -3669 | Luffa | | scientific name -3669 | Luffa Mill., 1754 | | authority -3744 | Rhamnales | | includes -3744 | Rosales | | scientific name -3744 | Rosales Bercht. & J.Presl, 1820 | | authority -3744 | Rosanae | | includes -3744 | Urticales | | includes -3745 | Malaceae | | synonym -3745 | Malaceae Sm., 1903 | | authority -3745 | Rosaceae | | scientific name -3745 | Rosaceae Juss., 1789 | | authority -3745 | rose family | | common name -3764 | Rosa | | scientific name -3764 | Rosa L., 1753 | | authority -3803 | Fabaceae | | scientific name -3803 | Fabaceae Lindl., 1836 | | authority -3803 | Leguminosae | | synonym -3803 | pea family | | common name -3814 | Faboideae | | synonym -3814 | Faboideae Rudd, 1968 | | authority -3814 | Papilionoideae | | scientific name -3841 | Erythrina | | scientific name -3841 | Erythrina L. | | authority -4011 | Anacardiaceae | | scientific name -4011 | Anacardiaceae R.Br., 1818 | | authority -4011 | sumac family | | common name -4036 | Apiales | | scientific name -4036 | Apiales Nakai, 1930 | | authority -4036 | Araliales | | synonym -4036 | Araliales Juss. ex Bercht. & J.Presl, 1820 | | authority -4037 | Apiaceae | | scientific name -4037 | Apiaceae Lindl., 1836 | | authority -4037 | Umbelliferae | | synonym -4037 | carrot family | | common name -4055 | Gentianales | | scientific name -4055 | Gentianales Juss. ex Bercht. & J.Presl, 1820 | | authority -4143 | Lamiales | | scientific name -4143 | Lamiales Bromhead, 1838 | | authority -4143 | Scrophulariales | | includes -4149 | Buddlejaceae | | includes -4149 | Buddlejaceae K.Wilh., 1910 | | authority -4149 | Myoporaceae | | includes -4149 | Myoporaceae R.Br., 1810 | | authority -4149 | Scrophulariaceae | Scrophulariaceae | scientific name -4149 | Scrophulariaceae Juss., 1789 | | authority -4149 | Selaginaceae | | includes -4149 | Selaginaceae Choisy, 1823 | | authority -4149 | figwort family | | common name -4199 | Dipsacales | | scientific name -4199 | Dipsacales Juss. ex Bercht. & J.Presl, 1820 | | authority -4200 | Caprifoliaceae | | scientific name -4200 | Caprifoliaceae Juss., 1789 | | authority -4200 | honeysuckle famly | | common name -4209 | Asterales | | scientific name -4209 | Asterales Link, 1829 | | authority -4209 | Campanulales | | includes -4210 | Asteraceae | | scientific name -4210 | Asteraceae Bercht. & J.Presl, 1820 | | authority -4210 | Compositae | | equivalent name -4210 | daisy family | | common name -4231 | Helianthus | | scientific name -4231 | Helianthus L., 1753 | | authority -4231 | sunflowers | | common name -4321 | Icacinaceae | Icacinaceae | scientific name -4321 | Icacinaceae Miers, 1851 | | authority -4447 | Liliopsida | | scientific name -4447 | Monocotyledoneae | | synonym -4447 | monocots | monocots | blast name -4447 | monocots | monocots | genbank common name -4447 | monocotyledons | | common name -4454 | Araceae | | scientific name -4454 | Araceae Juss., 1789 | | authority -4454 | Lemnaceae | | includes -4454 | arum family | | common name -4479 | Bambusaceae | | synonym -4479 | Bambusaceae Nakai, 1943 | | authority -4479 | Gramineae | | synonym -4479 | Poaceae | | scientific name -4479 | Poaceae Barnhart, 1895 | | authority -4479 | grass family | | common name -4496 | Avena | | scientific name -4496 | Avena L., 1753 | | authority -4500 | Avena longiglumis | | scientific name -4500 | Avena longiglumis Durieu, 1845 | | authority -4523 | Neurachne | | scientific name -4523 | Neurachne R.Br. | | authority -4581 | Bambusa | | scientific name -4581 | Bambusa Schreb. | | authority -4581 | bamboos | | genbank common name -4667 | Liliales | | scientific name -4667 | Liliales Perleb, 1826 | | authority -4667 | Liliales/Asparagales group | Liliales/Asparagales group | in-part -4667 | Liliiflorae | Liliiflorae | in-part -4667 | Orchidales | | includes -4734 | Commelinidae | | synonym -4734 | Commeliniflorae | | synonym -4734 | commelinids | | scientific name -4747 | Orchidaceae | | scientific name -4747 | Orchidaceae Juss., 1789 | | authority -4747 | orchid family | | common name -4751 | Fungi | | scientific name -4751 | Mycota | | synonym -4751 | fungi | | blast name -4762 | Oomycetes | | synonym -4762 | Oomycetes G. Winter, 1880 | | authority -4762 | Oomycota | | scientific name -4762 | Oomycota Arx, 1967 | | authority -4762 | oomycetes | | blast name -4763 | Saprolegniales | | scientific name -4763 | Saprolegniales Prantl, 1874 | | authority -4764 | Saprolegniaceae | | scientific name -4769 | Saprolegnia | | scientific name -4890 | Ascomycota | | scientific name -4890 | ascomycete fungi | ascomycete fungi | blast name -4890 | ascomycete fungi | ascomycete fungi | genbank common name -4890 | sac fungi | | common name -4958 | Debaryomyces | | scientific name -4958 | Debaryomyces Lodder & Kreger-van Rij ex Kreger-van Rij, 1984 | | authority -4958 | Wingea | | synonym -4972 | ATCC 24291 | ATCC 24291 | type material -4972 | Bullera armeniaca | | synonym -4972 | CBS 4214 | CBS 4214 | type material -4972 | CCRC 21600 | CCRC 21600 | type material -4972 | CCRC:21600 | CCRC:21600 | type material -4972 | Cryptococcus hungaricus | | synonym -4972 | Cryptococcus sp. GU67 | | includes -4972 | DBVPG 7152 | DBVPG 7152 | type material -4972 | Dioszegia hungarica | | scientific name -4972 | Dioszegia hungarica Zsolt, 1957 | | authority -4972 | IFO 1052 | IFO 1052 | type material -4972 | IGC 3954 | IGC 3954 | type material -4972 | JCM 9046 | JCM 9046 | type material -4972 | MUCL 30660 | MUCL 30660 | type material -4972 | NRRL Y-6667 | NRRL Y-6667 | type material -4972 | UCD 68-187 | UCD 68-187 | type material -4972 | specimen-voucher:NRRL:Y:6667 | specimen-voucher:NRRL:Y:6667 | type material -5036 | Histoplasma | | scientific name -5036 | Histoplasma Darling, 1906 | | authority -5037 | ATCC 22635 [[Emmonsiella capsulata]] | ATCC 22635 [[Emmonsiella capsulata]] | type material -5037 | Ajellomyces capsulatus (Kwon-Chung) McGinnis & Katz, 1979 | | synonym -5037 | CBS 136.72 [[Emmonsiella capsulata]] | CBS 136.72 [[Emmonsiella capsulata]] | type material -5037 | Cryptococcus capsulatus | | synonym -5037 | Cryptococcus capsulatus (Darling) Castell. & Chalm., 1919 | | authority -5037 | Emmonsiella capsulata | | synonym -5037 | Emmonsiella capsulata Kwon-Chung, 1972 | | authority -5037 | Histoplasma capsulatum | | scientific name -5037 | Histoplasma capsulatum Darling, 1906 | | authority -5039 | ATCC 18188 | ATCC 18188 | type material -5039 | Ajellomyces dermatitidis | | synonym -5039 | Ajellomyces dermatitidis McDonough & A.L. Lewis, 1968 | | authority -5039 | Blastomyces dermatitidis | | scientific name -5039 | Blastomyces dermatitidis Gilchrist & W.R. Stokes, 1898 | | authority -5039 | Blastomycoides dermatitidis | | synonym -5039 | CBS 674.68 | CBS 674.68 | type material -5039 | UAMH 3539 | UAMH 3539 | type material -5039 | UAMH-3539 | UAMH-3539 | type material -5039 | UAMH3539 | UAMH3539 | type material -5039 | UAMH:3539 | UAMH:3539 | type material -5125 | Hypocreales | | scientific name -5125 | Hypocreales Lindau, 1897 | | authority -5125 | Pyrenomycetes | Pyrenomycetes | in-part -5139 | Sordariales | | scientific name -5139 | Sordariales Chadef. ex D. Hawksw. & O.E. Erikss., 1986 | | authority -5149 | Chaetomium | | scientific name -5149 | Chaetomium Kunze, 1817 | | authority -5197 | Lecanorales | | scientific name -5197 | Lecanorales Nannf., 1932 | | authority -5198 | Cladiaceae | | includes -5198 | Cladoniaceae | | scientific name -5198 | Cladoniaceae Zenker, 1827 | | authority -5199 | Cladina | | includes -5199 | Cladina (Nyl.) Nyl., 1866 | | authority -5199 | Cladonia | | scientific name -5204 | Basidiomycota | | scientific name -5204 | basidiomycete fungi | basidiomycete fungi | blast name -5204 | basidiomycete fungi | basidiomycete fungi | genbank common name -5204 | basidiomycetes | | common name -5234 | Christianseniales | | includes -5234 | Tremellales | | scientific name -5234 | Tremellales Fr., 1821 | | authority -5234 | anamorphic Tremellales | | includes -5234 | jelly fungi | | genbank common name -5234 | mitosporic Tremellales | | includes -5302 | Agaricomycotina | | scientific name -5302 | Agaricomycotina Doweld, 2001 | | authority -5302 | Hymenomycetes | | equivalent name -5303 | Aphyllophorales | | synonym -5303 | Polyporales | | scientific name -5303 | Polyporales Gaum., 1926 | | authority -5303 | anamorphic Aphyllophorales | | includes -5303 | anamorphic Polyporales | | includes -5303 | mitosporic Aphyllophorales | | includes -5303 | mitosporic Polyporales | | includes -5305 | Phanerochaete | | scientific name -5305 | Phanerochaete P. Karst., 1889 | | authority -5314 | Ganoderma | | scientific name -5314 | Ganoderma P. Karst., 1881 | | authority -5314 | Magoderna | | synonym -5314 | Magoderna Steyaert, 1972 | | authority -5317 | Coriolaceae | | synonym -5317 | Cryptoporaceae | | synonym -5317 | Echinochaetaceae | | synonym -5317 | Fomitaceae | | synonym -5317 | Ganodermataceae | | synonym -5317 | Grammotheleaceae | | synonym -5317 | Haddowiaceae | | synonym -5317 | Lentinaceae | | synonym -5317 | Lentinaceae Julich | | synonym -5317 | Lophariaceae | | synonym -5317 | Microporaceae | | synonym -5317 | Pachykytosporaceae | | synonym -5317 | Perenniporiaceae | | synonym -5317 | Polyporaceae | | scientific name -5317 | Sparsitubaceae | | synonym -5317 | Trametaceae | | synonym -5317 | bracket fungi | | genbank common name -5338 | Agaricales | | scientific name -5338 | Agaricales Underw., 1899 | | authority -5338 | Agaricales anamorphs | | synonym -5338 | Hymenogastrales | | synonym -5338 | Lycoperdales | | synonym -5338 | Nidulariales | | synonym -5338 | Tulostomatales | | synonym -5338 | anamorphic Agaricales | | synonym -5338 | gasteromycetes | gasteromycetes | includes -5338 | gill mushrooms | | genbank common name -5338 | mitosporic Agaricales | | includes -5455 | Colletotrichum | | scientific name -5455 | Colletotrichum Corda, 1831 | | authority -5455 | Glomerella | Glomerella | synonym -5455 | Glomerella Spauld. & H. Schrenk 1903 | | authority -5500 | Coccidioides | | scientific name -5500 | Coccidioides C.W. Stiles, 1896 | | authority -5501 | CBS 120936 | CBS 120936 | type material -5501 | CBS 144.34 | CBS 144.34 | type material -5501 | CBS H-19842 | CBS H-19842 | type material -5501 | Coccidioides immitis | | scientific name -5501 | Coccidioides immitis G.W. Stiles, 1896 | | authority -5501 | RMSCC 2394 | RMSCC 2394 | type material -5506 | Albonectria | | synonym -5506 | Albonectria Rossman & Samuels, 1999 | | authority -5506 | Bisifusarium | | synonym -5506 | Bisifusarium L. Lombard, Crous & W. Gams, 2015 | | authority -5506 | Cyanonectria | | synonym -5506 | Cyanonectria Samuels & P. Chaverri, 2009 | | authority -5506 | Fusarium | | scientific name -5506 | Fusarium Link, 1809 | | authority -5506 | Fusarium sect. Setofusarium | | synonym -5506 | Fusarium sect. Setofusarium Nirenberg & Samuels, 1989 | | authority -5506 | Fusisporium | | synonym -5506 | Fusisporium Link, 1809 | | authority -5506 | Geejayessia | | synonym -5506 | Geejayessia Schroers, Grafenhan & Seifert, 2011 | | authority -5506 | Gibberella | | synonym -5506 | Gibberella Sacc., 1877 | | authority -5506 | Haematonectria | | synonym -5506 | Haematonectria Samuels & Nirenberg, 1999 | | authority -5506 | Luteonectria | | synonym -5506 | Luteonectria Sand.-Den., L. Lombard, Schroers & Rossman, 2021 | | synonym -5506 | Neocosmospora | | synonym -5506 | Neocosmospora E.F. Sm., 1899 | | authority -5506 | Nothofusarium | | synonym -5506 | Nothofusarium Crous, Sand.-Den. & L. Lombard, 2021 | | authority -5506 | Rectifusarium | | synonym -5506 | Rectifusarium L. Lombard, Crous & W. Gams, 2015 | | authority -5506 | Setofusarium | | synonym -5506 | Setofusarium (Nirenberg & Samuels) Crous & Sand.-Den., 2021 | | authority -5550 | Bodinia | | synonym -5550 | Bodinia M. Ota & Langeron, 1923 | | authority -5550 | Grubyella | | synonym -5550 | Grubyella M. Ota & Langeron, 1923 | | authority -5550 | Trichophyton | | scientific name -5550 | Trichophyton Malmsten, 1848 | | authority -5551 | ATCC 32871 [[Trichophyton fischeri]] | ATCC 32871 [[Trichophyton fischeri]] | type material -5551 | ATCC 42631 [[Trichophyton raubitschekii]] | ATCC 42631 [[Trichophyton raubitschekii]] | type material -5551 | ATCC 62345 [[Trichophyton kanei]] | ATCC 62345 [[Trichophyton kanei]] | type material -5551 | CBS 100081 [[Trichophyton fischeri]] | CBS 100081 [[Trichophyton fischeri]] | type material -5551 | CBS 100084 [[Trichophyton raubitschekii]] | CBS 100084 [[Trichophyton raubitschekii]] | type material -5551 | CBS 289.86 [[Trichophyton kanei]] | CBS 289.86 [[Trichophyton kanei]] | type material -5551 | CBS 392.58 | CBS 392.58 | type material -5551 | Epidermophyton rubrum | | synonym -5551 | Epidermophyton rubrum Castell., 1910 | | authority -5551 | IMI 213848 [[Trichophyton fischeri]] | IMI 213848 [[Trichophyton fischeri]] | type material -5551 | Microsporum rubrum | | synonym -5551 | Microsporum rubrum Cazalbou, 1913 | | authority -5551 | Sabouraudites ruber | | synonym -5551 | Sabouraudites ruber (Cazalbou) Nann., 1934 | | synonym -5551 | TRTC 50887 [[Trichophyton kanei]] | TRTC 50887 [[Trichophyton kanei]] | type material -5551 | Trichophyton fischeri | | synonym -5551 | Trichophyton fischeri J. Kane, 1977 | | authority -5551 | Trichophyton kanei | | synonym -5551 | Trichophyton kanei Summerb., 1987 | | authority -5551 | Trichophyton megninii | | synonym -5551 | Trichophyton megninii R. Blanch., 1895 | | authority -5551 | Trichophyton raubitschekii | | synonym -5551 | Trichophyton raubitschekii J. Kane, Salkin, Weitzman & Smitka, 1981 | | authority -5551 | Trichophyton rubrum | | scientific name -5551 | Trichophyton rubrum (Castell.) Sabour., 1911 | | authority -5551 | Trichophyton rubrum var. raubitschekii | | synonym -5794 | Apicomplexa | | scientific name -5794 | Apicomplexa Levine 1980, emend. Adl et al. 2005 | | authority -5794 | apicomplexans | apicomplexans | blast name -5794 | apicomplexans | apicomplexans | genbank common name -5796 | Coccidia | | scientific name -5796 | coccidians | | synonym -5809 | Sarcocystidae | | scientific name -5809 | Sarcocystids | | synonym -5819 | Haemosporida | | scientific name -5819 | Haemosporina | | synonym -5819 | Haemospororida | | synonym -5819 | haemosporidians | | genbank common name -5820 | Plasmodium | Plasmodium | scientific name -5820 | Saurocytozoon | | synonym -5825 | Plasmodium chabaudi | | scientific name -5857 | Plasmodium fragile | | scientific name -5860 | Plasmodium vinckei | | scientific name -5860 | Plasmodium vinckei (Rodhain, 1952) | | authority -5863 | Piroplasmida | | scientific name -5863 | Piroplasmids | | genbank common name -5872 | Babesia equi | | synonym -5872 | Babesia equi Laveran, 1901 | | authority -5872 | Theileria equi | | scientific name -5872 | Theileria equi (Laveran, 1901) Mehlhorn & Schein 1998 | | authority -5873 | Theileria | | scientific name -5873 | Theileria Bettencourt et al. 1907 | | authority -5874 | Theileria annulata | | scientific name -6072 | Eumetazoa | | scientific name -6073 | Cnidaria | | scientific name -6073 | Coelenterata | Coelenterata | in-part -6073 | cnidarians | cnidarians | blast name -6073 | cnidarians | cnidarians | genbank common name -6073 | coelenterates | coelenterates | common name -6101 | Anthozoa | | scientific name -6101 | anthozoans | anthozoans | blast name -6101 | anthozoans | anthozoans | genbank common name -6102 | Ceriantipatharia | | includes -6102 | Hexacorallia | | scientific name -6125 | Madreporaria | | synonym -6125 | Scleractinia | | scientific name -6125 | stony corals | stony corals | blast name -6125 | stony corals | stony corals | genbank common name -6126 | Acroporidae | | scientific name -6127 | Acropora | | scientific name -6127 | staghorn corals | | genbank common name -6157 | Neorhabdocoela | | includes -6157 | Platyhelminthes | | scientific name -6157 | Proplicastomata | | includes -6157 | Turbellaria | | includes -6157 | Turbellarian Platyhelminths | | includes -6157 | flatworm | | common name -6157 | flatworms | flatworms | blast name -6157 | flatworms | flatworms | genbank common name -6159 | Tricladida | | scientific name -6199 | Cestoda | | scientific name -6199 | tapeworms | | genbank common name -6200 | Eucestoda | | scientific name -6217 | Nemertea | | scientific name -6217 | Nemertini | | synonym -6217 | bootlace worms | | common name -6217 | nemertines | | common name -6217 | ribbon worms | ribbon worms | blast name -6217 | ribbon worms | ribbon worms | genbank common name -6218 | Anopla | | synonym -6218 | Pilidiophora | | scientific name -6219 | Heteronemertea | | scientific name -6219 | Heteronemertini | | synonym -6219 | heteronemertine worms | | genbank common name -6222 | Cerebratulidae | | synonym -6222 | Lineidae | | scientific name -6231 | Nemata | | synonym -6231 | Nematoda | | scientific name -6231 | nematode | | common name -6231 | nematodes | nematodes | blast name -6231 | nematodes | nematodes | genbank common name -6231 | roundworm | | common name -6231 | roundworms | | common name -6236 | Rhabditida | | scientific name -6236 | Strongylida | | synonym -6249 | Ascaridida | | synonym -6249 | Ascaridomorpha | | scientific name -6267 | Anisakidae | | scientific name -6274 | Spirurida | | synonym -6274 | Spirurina | | scientific name -6447 | Mollusca | | scientific name -6447 | molluscs | molluscs | blast name -6447 | molluscs | molluscs | genbank common name -6447 | mollusks | | common name -6544 | Bivalvia | | scientific name -6544 | Lamellibranchiata | | synonym -6544 | Pelecypoda | | synonym -6544 | bivalves | bivalves | blast name -6544 | bivalves | bivalves | genbank common name -6599 | Heteroconchia | | scientific name -6656 | Arthropoda | | scientific name -6656 | arthropods | arthropods | blast name -6656 | arthropods | arthropods | genbank common name -6657 | Crustacea | | scientific name -6657 | crustaceans | crustaceans | blast name -6657 | crustaceans | crustaceans | genbank common name -6681 | Malacostraca | | scientific name -6682 | Eucarida | | scientific name -6683 | Decapoda | | scientific name -6692 | Pleocyemata | | scientific name -6712 | Astacidea | | scientific name -6712 | Astacura | | synonym -6712 | true lobsters and crayfishes | | genbank common name -6738 | Anomura | | scientific name -6738 | hermit crabs | hermit crabs | genbank common name -6744 | Coenobitoidea | | includes -6744 | Paguroidea | | scientific name -6745 | Paguridae | | scientific name -6746 | Pagurus | | scientific name -6746 | hermit crabs | hermit crabs | common name -6752 | Brachyura | | scientific name -6752 | short-tailed crabs | | genbank common name -6752 | true crabs | | common name -6960 | Atelocerata | Atelocerata | in-part -6960 | Hexapoda | | scientific name -6960 | Tracheata | Tracheata | in-part -6960 | Uniramia | Uniramia | in-part -6960 | hexapods | hexapods | blast name -6960 | hexapods | hexapods | genbank common name -6961 | Odonata | | scientific name -6961 | dragonflies & damselflies | dragonflies & damselflies | blast name -6961 | dragonflies & damselflies | dragonflies & damselflies | genbank common name -6970 | Dictyoptera | Dictyoptera | scientific name -6993 | Orthoptera | | scientific name -6993 | Saltatoria | | synonym -6993 | grasshoppers, crickets & katydids | grasshoppers, crickets & katydids | blast name -6993 | grasshoppers, crickets & katydids | grasshoppers, crickets & katydids | genbank common name -6994 | Ensifera | Ensifera | scientific name -6994 | crickets & katydids | | genbank common name -7041 | Coleoptera | | scientific name -7041 | beetles | beetles | blast name -7041 | beetles | beetles | genbank common name -7042 | Curculionidae | | scientific name -7042 | weevils | | genbank common name -7088 | Lepidoptera | | scientific name -7088 | moths & butterflies | moths & butterflies | blast name -7088 | moths & butterflies | moths & butterflies | genbank common name -7089 | Bombycidae | | scientific name -7089 | silkworm moths | | genbank common name -7100 | Noctuidae | | scientific name -7100 | noctuid moths | | common name -7100 | owlet moths | | genbank common name -7147 | Diptera | | scientific name -7147 | flies | flies | blast name -7147 | flies | flies | genbank common name -7148 | Nematocera | | scientific name -7157 | Culicidae | | scientific name -7157 | mosquitos | mosquitos | blast name -7157 | mosquitos | mosquitos | genbank common name -7158 | Aedes | Aedes | scientific name -7399 | Hymenoptera | | scientific name -7399 | hymenopterans | hymenopterans | blast name -7399 | hymenopterans | hymenopterans | genbank common name -7400 | Apocrita | | scientific name -7400 | wasps, ants & bees | wasps, ants & bees | blast name -7400 | wasps, ants & bees | wasps, ants & bees | common name -7401 | Ichneumonoidea | | scientific name -7402 | Braconidae | | scientific name -7434 | Aculeata | Aculeata | scientific name -7434 | Aculeata Latreille, 1802 | | authority -7458 | Apidae | | scientific name -7458 | bumble bees and honey bees | | genbank common name -7459 | Apis | | scientific name -7496 | Pterygota | Pterygota | scientific name -7496 | winged insects | | genbank common name -7516 | Neuroptera | | scientific name -7516 | Planipennia | | synonym -7516 | lacewings | | common name -7516 | net-winged insects | | genbank common name -7524 | Hemiptera | | scientific name -7524 | Homoptera | | includes -7524 | true bugs | true bugs | blast name -7524 | true bugs | true bugs | genbank common name -7581 | Comatulida | | scientific name -7586 | Echinodermata | | scientific name -7586 | echinoderms | echinoderms | blast name -7586 | echinoderms | echinoderms | genbank common name -7711 | Chordata | | scientific name -7711 | chordates | chordates | blast name -7711 | chordates | chordates | genbank common name -7742 | Vertebrata | Vertebrata | scientific name -7742 | Vertebrata Cuvier, 1812 | | authority -7742 | vertebrates | vertebrates | blast name -7742 | vertebrates | vertebrates | genbank common name -7776 | Gnathostomata | Gnathostomata | scientific name -7776 | jawed vertebrates | | genbank common name -7777 | Chondrichthyes | | scientific name -7777 | cartilaginous fishes | cartilaginous fishes | blast name -7777 | cartilaginous fishes | cartilaginous fishes | genbank common name -7777 | fish | fish | common name -7777 | fishes | fishes | common name -7778 | Elasmobranchii | | scientific name -7778 | elasmobranchs | | common name -7778 | sharks & rays | sharks & rays | blast name -7778 | sharks & rays | sharks & rays | genbank common name -7898 | Actinopterygi | | synonym -7898 | Actinopterygii | | scientific name -7898 | Osteichthyes | Osteichthyes | in-part -7898 | fish | fish | common name -7898 | fishes | fishes | common name -7898 | ray-finned fishes | ray-finned fishes | blast name -7898 | ray-finned fishes | ray-finned fishes | genbank common name -7952 | Cypriniformes | | scientific name -7952 | carps and others | | genbank common name -7953 | Cyprinidae | | scientific name -7982 | Cobitidae | | scientific name -7982 | loaches | | genbank common name -7983 | Misgurnus | | scientific name -8006 | Salmoniformes | | scientific name -8006 | salmons and trouts | | genbank common name -8015 | Salmonidae | | scientific name -8015 | salmonids | | genbank common name -8033 | Salvelinus | | scientific name -8034 | NHMW:91214 | NHMW:91214 | type material -8034 | NMW:91214 | NMW:91214 | type material -8034 | NMW:91214 | NMW:91214 | type material -8034 | Salmo leucomaenis | | synonym -8034 | Salmo leucomaenis Pallas, 1814 | | authority -8034 | Salvelinus leucomaenis | | scientific name -8034 | Salvelinus leucomaenis (Pallas, 1814) | | authority -8034 | ZMB:23552 | ZMB:23552 | type material -8034 | ZMB:23563 | ZMB:23563 | type material -8034 | amemasu char | | common name -8034 | whitespotted char | | genbank common name -8035 | Salmo pluvius | | synonym -8035 | Salmo pluvius Hilgendorf, 1876 | | authority -8035 | Salvelinus leucomaenis pluvius | | scientific name -8035 | Salvelinus pluvius | | synonym -8111 | Perciformes | | scientific name -8111 | Scorpaeniformes | | synonym -8111 | Serraniformes | | synonym -8111 | perches and others | | genbank common name -8113 | Cichlidae | | scientific name -8113 | cichlids | | genbank common name -8205 | Notothenioidei | | scientific name -8219 | Gobioidei | | scientific name -8220 | Gobiidae | | scientific name -8220 | Microdesmidae | | synonym -8220 | Trypauchenidae | | synonym -8220 | burrowing gobies | | common name -8220 | gobies | | genbank common name -8220 | wormfishes | | common name -8252 | Pleuronectiformes | | scientific name -8252 | flatfishes | | genbank common name -8256 | Pleuronectidae | | scientific name -8256 | righteye flounders | | genbank common name -8287 | Sarcopterygii | | scientific name -8292 | Amphibia | | scientific name -8292 | Lissamphibia | | includes -8292 | amphibians | amphibians | blast name -8292 | amphibians | amphibians | genbank common name -8293 | Caudata | | scientific name -8293 | Urodela | | synonym -8293 | salamanders | salamanders | blast name -8293 | salamanders | salamanders | genbank common name -8294 | Ambystomatidae | | scientific name -8294 | mole salamanders | mole salamanders | genbank common name -8295 | Ambystoma | | scientific name -8295 | big salamanders | | common name -8295 | mole salamanders | mole salamanders | genbank common name -8306 | Ambystoma talpoideum | | scientific name -8306 | Ambystoma talpoideum (Holbrook, 1838) | | authority -8306 | Salamandra talpoidea | | synonym -8306 | Salamandra talpoidea Holbrook, 1838 | | authority -8306 | mole salamander | | genbank common name -8342 | Anura | | scientific name -8342 | Salientia | | synonym -8342 | anurans | | common name -8342 | frogs | | common name -8342 | frogs & toads | frogs & toads | blast name -8342 | frogs & toads | frogs & toads | genbank common name -8416 | Neobatrachia | | scientific name -8426 | Microhyloidea | | scientific name -8427 | Microhylidae | | scientific name -8427 | microhylid toads | | genbank common name -8457 | Sauropsida | | scientific name -8457 | sauropsids | | genbank common name -8492 | Archosauria | | scientific name -8782 | Aves | | scientific name -8782 | avian | | synonym -8782 | birds | birds | blast name -8782 | birds | birds | genbank common name -8825 | Neognathae | | scientific name -8826 | Anseriformes | | scientific name -8826 | ducks, geese & swans | | genbank common name -8827 | Anhimidae | | scientific name -8827 | screamers | | genbank common name -8828 | Chauna | | scientific name -8906 | Charadriiformes | | scientific name -8906 | Turniciformes | | includes -8906 | shorebirds & allies | | genbank common name -8906 | shorebirds and others | | common name -8936 | Coraciadiformes | | synonym -8936 | Coraciiformes | | scientific name -8936 | kingfishers and others | | genbank common name -8940 | Cuculiformes | | scientific name -8940 | cuckoos and others | | genbank common name -8941 | Cuculidae | | scientific name -8941 | cuckoos | | genbank common name -8948 | Falconiformes | | scientific name -8948 | falcons and others | | genbank common name -8949 | Falconidae | | scientific name -8955 | Accipitrinae | | scientific name -9108 | Gruiformes | | scientific name -9108 | cranes, rails & allies | | genbank common name -9108 | terrestrial and marshbirds | | common name -9126 | Passeriformes | | scientific name -9126 | song birds | | genbank common name -9219 | Galbuliformes | | includes -9219 | Piciformes | | scientific name -9219 | jacamars | | common name -9219 | woodpeckers and others | | genbank common name -9223 | Psittaciformes | | scientific name -9223 | parrots and others | | genbank common name -9224 | Psittacidae | | scientific name -9224 | parrot | | common name -9224 | parrots | | genbank common name -9230 | Sphenisciformes | | scientific name -9230 | penguins | penguins | genbank common name -9231 | Spheniscidae | | scientific name -9231 | penguins | penguins | genbank common name -9239 | Spheniscus | | scientific name -9263 | Marsupialia | | synonym -9263 | Metatheria | | scientific name -9263 | marsupials | marsupials | blast name -9263 | marsupials | marsupials | genbank common name -9265 | American opossums | | common name -9265 | Didelphidae | | scientific name -9265 | opossums | | genbank common name -9266 | Didelphis | | scientific name -9347 | Eutheria | | scientific name -9347 | Placentalia | | synonym -9347 | eutherian mammals | | common name -9347 | placental mammals | | common name -9347 | placentals | placentals | blast name -9347 | placentals | placentals | genbank common name -9397 | Chiroptera | | scientific name -9397 | bats | bats | blast name -9397 | bats | bats | genbank common name -9431 | Vespertilionidae | | scientific name -9431 | common bats | | common name -9431 | vesper bats | | genbank common name -9431 | vespertilionid bats | | common name -9434 | Myotis | | scientific name -9655 | Mustelidae | | scientific name -9655 | weasel, mink, badger, martens and others | | genbank common name -9671 | Pteronura | | scientific name -9672 | Pteronura brasiliensis | | scientific name -9672 | Pteronura brasiliensis Zimmermann, 1780 | | authority -9672 | giant otter | | genbank common name -9681 | Felidae | | scientific name -9681 | cat family | | genbank common name -9688 | Leo | | synonym -9688 | Panthera | | scientific name -9688 | Uncia | | synonym -9690 | Panthera onca | | scientific name -9690 | jaguar | | genbank common name -9845 | Ruminantia | | scientific name -9895 | Bovidae | | scientific name -9918 | Bubalus | | scientific name -9975 | Lagomorpha | | scientific name -9975 | Lagomorpha Brandt, 1855 | | authority -9975 | rabbits & hares | | blast name -9979 | Leporidae | | scientific name -9979 | Leporidae Fischer, 1817 | | authority -9979 | rabbits and hares | | genbank common name -9980 | Lepus | | scientific name -9980 | Lepus Linnaeus, 1758 | | authority -9980 | hares | | genbank common name -9989 | Rodentia | | scientific name -9989 | rodent | | common name -9989 | rodents | rodents | blast name -9989 | rodents | rodents | genbank common name -10045 | Gerbillinae | | scientific name -10045 | gerbils | | genbank common name -10066 | Muridae | | scientific name -10239 | Vira | | synonym -10239 | Viridae | | synonym -10239 | Viruses | | scientific name -10239 | viruses | | blast name -10293 | Alphaherpesvirinae | | scientific name -10293 | Alphaherpesviruses | | common name -10294 | Simplexvirus | | scientific name -10319 | Varicellovirus | | scientific name -10357 | Betaherpesvirinae | | scientific name -10357 | Betaherpesviruses | | common name -10358 | Cytomegalovirus | | scientific name -10374 | Gammaherpesvirinae | | scientific name -10374 | Gammaherpesviruses | | common name -10374 | lymphoproliferative virus group | | genbank common name -10404 | Hepadnaviridae | | scientific name -10404 | hepatitis B-type viruses | | genbank common name -10405 | Orthohepadnavirus | | scientific name -10405 | mammalian hepatitis B-type viruses | | genbank common name -10442 | Baculoviridae | | scientific name -10566 | Human Papilloma Virus | | equivalent name -10566 | Human papillomavirus | | scientific name -10566 | human papillomavirus HPV | | equivalent name -10567 | Iotapapillomavirus 1 | | scientific name -10567 | Mastomys natalensis papillomavirus | | equivalent name -10567 | Multimammate rat papillomavirus | | equivalent name -10567 | Praomys natalensis papillomavirus | | equivalent name -10639 | Caulimovirus | | scientific name -10652 | Badnavirus | | scientific name -10652 | Commelina yellow mottle virus group | | equivalent name -10780 | Parvoviridae | | scientific name -10803 | Dependoparvovirus | | scientific name -10803 | Dependovirus | | equivalent name -10803 | dependoviruses | | common name -10811 | Geminiviridae | | scientific name -10811 | Geminivirus | | equivalent name -10812 | Geminivirus subgroup I | | equivalent name -10812 | Mastrevirus | | scientific name -10812 | Subgroup I Geminivirus | | equivalent name -10814 | Begomovirus | | scientific name -10814 | Geminivirus subgroup III | | equivalent name -10814 | Subgroup III Geminivirus | | equivalent name -10841 | Microviridae | | scientific name -10841 | bacterial virus | bacterial virus | in-part -10841 | bacterial viruses | bacterial viruses | in-part -10841 | isometric ssDNA phages | | genbank common name -10841 | prokaryotic virus | prokaryotic virus | in-part -10882 | Orthoreovirus | | scientific name -10882 | RAM-1 | | acronym -10882 | Reoviruses | | equivalent name -10892 | Orbiviridae | | equivalent name -10892 | Orbivirus | | scientific name -10892 | Orbiviruses | | equivalent name -10979 | Aquareovirus | | scientific name -10988 | Fijivirus | | scientific name -10988 | plant reovirus 2 | | genbank common name -10989 | MRDV | | acronym -10989 | Maize rough dwarf fijivirus | | equivalent name -10989 | Maize rough dwarf virus | | scientific name -10993 | Birnaviridae | | scientific name -11006 | Totiviridae | | scientific name -11006 | monopartite dsRNA genome mycoviruses | | genbank common name -11007 | Totivirus | | scientific name -11012 | Partitiviridae | | scientific name -11050 | Flaviviridae | | scientific name -11050 | Flavivirus (arbovirus group B) | | equivalent name -11095 | Pestivirus | | scientific name -11102 | Hepacivirus | | scientific name -11102 | Hepatitis C virus group | | equivalent name -11102 | Hepatitis C viruses | | equivalent name -11102 | Hepatitis C-like viruses | | equivalent name -11118 | Coronaviridae | | scientific name -11157 | Mononegavirales | | scientific name -11157 | negative-sense genome single-stranded RNA viruses | | genbank common name -11158 | Paramyxoviridae | | scientific name -11229 | Morbillivirus | | scientific name -11229 | Morbilliviruses | | equivalent name -11240 | Phocine distemper virus | | equivalent name -11240 | Phocine morbillivirus | | scientific name -11240 | phocid distemper virus | | equivalent name -11240 | phocid distemper virus PDV | | equivalent name -11240 | phocine distemper virus PDV | | equivalent name -11270 | Rhabdoviridae | | scientific name -11271 | Vesiculovirus | | scientific name -11308 | Orthomyxoviridae | | scientific name -11318 | Dhori thogotovirus | | equivalent name -11318 | Dhori virus | | equivalent name -11318 | Thogotovirus dhoriense | | scientific name -11318 | Tick-borne virus | | equivalent name -11319 | Dhori virus (strain Indian/1313/61) | | scientific name -11572 | Bunyavirus | | equivalent name -11572 | Bunyaviruses | | equivalent name -11572 | Orthobunyavirus | | scientific name -11582 | Aino virus | | scientific name -11584 | Phlebovirus | | scientific name -11584 | Phleboviruses | | equivalent name -11617 | Arenaviridae | | scientific name -11632 | Retroviridae | | scientific name -11974 | Caliciviridae | | scientific name -12027 | Bacteriophage SP | | equivalent name -12027 | Enterobacteria phage SP | | scientific name -12027 | phage SP | | equivalent name -12030 | Bacteriophage TW19 | | equivalent name -12030 | Enterobacteria phage TW19 | | scientific name -12031 | Bacteriophage TW28 | | equivalent name -12031 | Enterobacteria phage TW28 | | scientific name -12031 | phage TW19 | | equivalent name -12031 | phage TW28 | | equivalent name -12036 | Luteovirus | | scientific name -12036 | Luteovirus subgroup I | | equivalent name -12050 | Maize chlorotic dwarf virus group | | equivalent name -12050 | Waikavirus | | scientific name -12051 | Marafivirus | | scientific name -12058 | Picornaviridae | | scientific name -12058 | Picornavirus | | synonym -12059 | Enterovirus | | scientific name -12059 | Enteroviruses | | equivalent name -12059 | Rhinovirus | | includes -12059 | Rhinoviruses | | includes -12059 | common cold viruses | | includes -12091 | Hepatovirus | | scientific name -12109 | Aphthovirus | | scientific name -12109 | Aphthoviruses | | equivalent name -12137 | Sobemovirus | | scientific name -12137 | Velvet tobacco mottle virus group | | equivalent name -12141 | Tombusvirus | | scientific name -12160 | Closterovirus | | scientific name -12163 | Carlavirus | | scientific name -12174 | Capillovirus | | scientific name -12176 | Potexvirus | | scientific name -12195 | Potyvirus | | scientific name -12234 | Tobamoviridae | | equivalent name -12234 | Tobamovirus | | scientific name -12258 | Comovirus | | scientific name -12270 | Nepovirus | | scientific name -12283 | Nodaviridae | | scientific name -12289 | Enamovirus | | scientific name -12289 | Pea enation mosaic virus group | | equivalent name -12316 | Ilarvirus | | scientific name -12429 | unassigned viruses | | equivalent name -12429 | unclassified virus | | equivalent name -12429 | unclassified viruses | | scientific name -12456 | HAstV-1 | | acronym -12456 | Human astrovirus 1 | | scientific name -12456 | Human astrovirus type 1 | | equivalent name -12456 | human astrovirus serotype 1 | | equivalent name -12471 | Solanum nodiflorum mottle virus | | scientific name -12701 | H-Ast2 | | acronym -12701 | Human astrovirus 2 | | scientific name -12701 | Human astrovirus serotype 2 H-Ast2 | | equivalent name -12701 | Human astrovirus type 2 | | equivalent name -12877 | Satellites | | synonym -12877 | unclassified satellites | | scientific name -12929 | Amazona | | scientific name -13366 | Brettanomyces | | scientific name -13366 | Brettanomyces N.H. Claussen ex Custers, 1940 | | authority -13366 | Dekkera | | synonym -13366 | Eeniella | | synonym -13502 | ATCC 48014 | ATCC 48014 | type material -13502 | Brettanomyces nanus | | scientific name -13502 | Brettanomyces nanus (M.T. Sm., Bat. Vegte & Scheffers) M.T. Sm., Boekhout, Kurtzman & O'Donnell, 1994 | | authority -13502 | CBS 1945 | CBS 1945 | type material -13502 | CCRC 21335 | CCRC 21335 | type material -13502 | CCRC:21335 | CCRC:21335 | type material -13502 | Eeniella nana | | synonym -13502 | Eeniella nana M.T. Sm., Bat. Vegte & Scheffers, 1981 | | authority -13502 | NRRL Y-17527 | NRRL Y-17527 | type material -13502 | specimen-voucher:NRRL:Y:17527 | specimen-voucher:NRRL:Y:17527 | type material -14366 | Cymbidium | | scientific name -14366 | Cymbidium Sw., 1799 | | authority -16360 | Alismatales | | scientific name -16360 | Alismatales R.Br. ex Bercht. & J.Presl, 1820 | | authority -16360 | Alismatiflorae | | in-part -16360 | Arales | | includes -16360 | Arales Lindl.,1833 | | authority -16360 | Ariflorae | | in-part -16360 | Najadales | | includes -16360 | Najadales Dumort., 1929 | | authority -16360 | Spathiflorae | | synonym -16360 | Zosterales | | includes -16360 | Zosterales J.Presl, 1846 | | authority -23461 | Mangifera | | scientific name -23461 | Mangifera L. | | authority -24966 | Dialypetalanthaceae | | includes -24966 | Dialypetalanthaceae Rizzini & Occhioni, 1948 | | authority -24966 | Rubiaceae | | scientific name -24966 | Rubiaceae Juss., 1789 | | authority -24966 | madder family | | common name -25623 | Taxaceae | | scientific name -25623 | Taxaceae Gray, 1822 | | authority -25623 | yew family | | common name -25628 | Taxus | | scientific name -25628 | Taxus L. | | authority -26473 | Buddleia | | synonym -26473 | Buddleja | | scientific name -26473 | Buddleja L., 1753 | | authority -26867 | Bougueria | | synonym -26867 | Plantago | | scientific name -26867 | Plantago L. | | authority -26867 | ribworts | | common name -27319 | Metschnikowiaceae | | scientific name -27319 | Metschnikowiaceae T. Kamienski ex Doweld, 2013 | | authority -27337 | CBS 130341 | CBS 130341 | type material -27337 | NRRL 54785 | NRRL 54785 | type material -27337 | PD322 | PD322 | type material -27337 | UC 1953893 | UC 1953893 | type material -27337 | Verticillium dahliae | | scientific name -27337 | Verticillium dahliae Klebahn, 1913 | | authority -27434 | Dermaptera | | scientific name -27434 | earwigs | earwigs | blast name -27434 | earwigs | earwigs | genbank common name -27483 | Evanioidea | | scientific name -27592 | Bovinae | | scientific name -27668 | Myotis leibii | | scientific name -27668 | Vespertilio leibii | | synonym -27668 | Vespertilio leibii Audubon & Bachman, 1842 | | authority -27668 | eastern small-footed myotis | | genbank common name -27708 | Cyprinus conchonius | | synonym -27708 | Cyprinus conchonius Hamilton, 1822 | | authority -27708 | Pethia conchonius | | scientific name -27708 | Pethia conchonius (Hamilton, 1822) | | authority -27708 | Puntius conchonius | | synonym -27708 | Puntius conchonius (Hamilton, 1822) | | authority -27708 | rosy barb | | genbank common name -27994 | Theileriidae | | scientific name -27994 | Theileriidae du Toit, 1918 | | authority -28267 | Phocine distemper virus-2 | | scientific name -28725 | Corvidae | | scientific name -28843 | Diphyllobothriidae | | scientific name -28843 | Ligulidae | | synonym -28890 | "Euryarchaeota" Woese et al. 1990 | | authority -28890 | "Methanobacteraeota" Oren et al. 2015 | | authority -28890 | "Methanobacteriota" Whitman et al. 2018 | | authority -28890 | Euryarchaeota | | synonym -28890 | Euryarchaeota Garrity and Holt 2002 | | authority -28890 | Methanobacteraeota | | synonym -28890 | Methanobacteriota | | scientific name -28890 | Methanobacteriota Garrity and Holt 2023 | | authority -28890 | euryarchaeotes | euryarchaeotes | blast name -28890 | euryarchaeotes | euryarchaeotes | genbank common name -29961 | Parastacoidea | | scientific name -29962 | Grapsidoidea | | synonym -29962 | Grapsoidea | | scientific name -30092 | Psyllidae | | scientific name -30093 | Trioza | | scientific name -30093 | Trioza Foerster, 1848 | | authority -30102 | Cicadellidae | | scientific name -30102 | Jassidae | | synonym -30102 | leafhoppers | | genbank common name -30367 | Ambystomatoidea | | synonym -30367 | Salamandroidea | | scientific name -30388 | Chaja torquata | | synonym -30388 | Chaja torquata Oken, 1816 | | authority -30388 | Chauna torquata | | scientific name -30388 | southern screamer | | genbank common name -30449 | Procellariiformes | | scientific name -30449 | petrels and albatrosses | | genbank common name -30560 | Microchiroptera | | synonym -30560 | Vespertilioniformes | | synonym -30560 | Yangochiroptera | | scientific name -30725 | Catostomoidea | | synonym -30725 | Cobitoidei | | scientific name -30727 | Cyprinoidea | | synonym -30727 | Cyprinoidei | | scientific name -30806 | Channichthyidae | | scientific name -30806 | crocodile icefishes | | genbank common name -30806 | white-blooded fish | | common name -30871 | Serranidae | | scientific name -30871 | sea basses | | genbank common name -30942 | Pleuronectoidei | | scientific name -30942 | Soleoidei | | synonym -31271 | Plasmodium chabaudi chabaudi | | scientific name -31370 | Batrachospermales | | scientific name -31371 | Batrachospermaceae | | scientific name -31371 | Brachtospermaceae | | synonym -31468 | Gracilariales | | scientific name -31469 | Gracilariaceae | | scientific name -31612 | Adelaide River virus | | scientific name -31870 | CBS 130836 | CBS 130836 | type material -31870 | Colletotrichopsis graminicola | | synonym -31870 | Colletotrichum graminicola | | scientific name -31870 | Colletotrichum graminicola (Ces.) G.W. Wilson, 1914 | | authority -31870 | Dicladium graminicola | | synonym -31870 | Dicladium graminicola Ces., 1852 | | authority -31870 | Dicladium graminicolum | | synonym -31870 | Glomerella graminicola | | synonym -31870 | Glomerella graminicola D.J. Politis, 1975 | | authority -31870 | M1.001 | M1.001 | type material -31870 | Steirochaete graminicola | | synonym -32443 | Teleostei | | scientific name -32443 | teleost fishes | | genbank common name -32519 | Ostariophysi | | scientific name -32523 | Tetrapoda | | scientific name -32523 | tetrapods | | genbank common name -32524 | Amniota | | scientific name -32524 | amniotes | | genbank common name -32525 | Theria | Theria | scientific name -32525 | Theria Parker & Haswell, 1897 | | authority -32561 | Diapsida | | synonym -32561 | Sauria | | scientific name -32561 | diapsids | | genbank common name -32613 | Ephemerovirus | | scientific name -32620 | Iris severe mosaic virus | | scientific name -33090 | Chlorobionta | | synonym -33090 | Chlorobionta Jeffrey, 1982 | | authority -33090 | Chlorophyta/Embryophyta group | | equivalent name -33090 | Chloroplastida | | synonym -33090 | Chloroplastida Adl et al. 2005 | | authority -33090 | Viridiplantae | | scientific name -33090 | Viridiplantae Cavalier-Smith, 1981 | | authority -33090 | chlorophyte/embryophyte group | | equivalent name -33090 | green plants | green plants | blast name -33090 | green plants | green plants | common name -33154 | Fungi/Metazoa group | | synonym -33154 | Opisthokonta | | scientific name -33154 | Opisthokonta Cavalier-Smith 1987 | | authority -33154 | opisthokonts | | synonym -33183 | Arachnomycetales | | synonym -33183 | Arachnomycetales Gibas, Sigler & Currah, 2002 | | authority -33183 | Ascosphaerales | | synonym -33183 | Gymnoascales | | synonym -33183 | Onygenales | | scientific name -33183 | Onygenales Cif. ex Benny & Kimbr., 1980 | | authority -33184 | Amauroascaceae | | synonym -33184 | Amauroascaceae Arx, 1987 | | authority -33184 | Onygenaceae | | scientific name -33184 | Onygenaceae E. Fisch., 1898 | | authority -33208 | Animalia | | synonym -33208 | Metazoa | | scientific name -33208 | animals | animals | blast name -33208 | animals | animals | genbank common name -33208 | metazoans | | common name -33208 | multicellular animals | | common name -33213 | Bilateria | | scientific name -33256 | Ascaridoidea | | scientific name -33317 | Protostomia | | scientific name -33339 | Palaeoptera | | scientific name -33340 | Neoptera | | scientific name -33341 | Orthopteroidea | | synonym -33341 | Polyneoptera | | scientific name -33342 | Hemipteroidea | | synonym -33342 | Paraneoptera | | scientific name -33342 | hemipteroid assemblage | | includes -33365 | Cicadomorpha | | scientific name -33365 | Clypeorrhyncha | | synonym -33368 | Cicadelloidea | | synonym -33368 | Membracoidea | | scientific name -33372 | Deltocephalinae | | scientific name -33372 | Deltocephalinae Dallas, 1870 | | authority -33373 | Sternorrhyncha | | scientific name -33375 | Psylliformes | | synonym -33375 | Psylloidea | | scientific name -33375 | Psyllomorpha | | synonym -33375 | jumping plant lice | | common name -33375 | psyllids | psyllids | blast name -33375 | psyllids | psyllids | genbank common name -33392 | Endopterygota | | scientific name -33392 | Holometabola | | synonym -33415 | Nymphalidae | | scientific name -33415 | Satyridae | | includes -33415 | brush-footed butterflies | | common name -33415 | brushfoots | | genbank common name -33511 | Deuterostomia | | scientific name -33511 | deuterostomes | | common name -33554 | Carnivora | | scientific name -33554 | carnivores | carnivores | blast name -33554 | carnivores | carnivores | genbank common name -33599 | Coccyzidae | | scientific name -33600 | Piaya | | scientific name -33601 | Cuculus cayanus | | synonym -33601 | Cuculus cayanus Linnaeus, 1766 | | authority -33601 | Piaya cayana | | scientific name -33601 | squirrel cuckoo | | genbank common name -33630 | Alveolata | | scientific name -33630 | alveolates | alveolates | blast name -33630 | alveolates | alveolates | genbank common name -33634 | Chromophyta | Chromophyta | in-part -33634 | Heterokonta | | synonym -33634 | Stramenopiles | | scientific name -33634 | Stramenopiles Patterson 1989, emend. Adl et al. 2005 | | authority -33634 | Straminipila | | synonym -33634 | heterokonts | heterokonts | blast name -33634 | heterokonts | heterokonts | genbank common name -34111 | Monoraphidium | | scientific name -34111 | Monoraphidium Komark-Legn., 1969 | | authority -34145 | Closterium | | scientific name -34145 | Closterium Nitzsch ex Ralfs, 1848 | | authority -34384 | Arthrodermataceae | | scientific name -34384 | Arthrodermataceae Locq. ex Currah, 1985 | | authority -34384 | Arthrodermataceae anamorphs | | synonym -34384 | anamorphic Arthrodermataceae | | synonym -34384 | dermatophytes | | genbank common name -34384 | mitosporic Arthrodermataceae | | includes -34392 | Microsporum | | scientific name -34392 | Microsporum Gruby, 1843 | | authority -34397 | Clavicipitaceae | | scientific name -34397 | anamorphic Clavicipitaceae | | includes -34397 | mitosporic Clavicipitaceae | | includes -34448 | Marasmius | | scientific name -34448 | Marasmius Fr., 1835 | | authority -34667 | Cerambycidae | | scientific name -34667 | long-horned beetles | | genbank common name -34735 | Apoidea | | scientific name -35069 | Crinoidea | | scientific name -35069 | crinoids | crinoids | blast name -35069 | crinoids | crinoids | genbank common name -35070 | Articulata | Articulata | scientific name -35249 | unassigned Gammaherpesvirinae | | equivalent name -35249 | unclassified Gammaherpesvirinae | | scientific name -35278 | ssRNA positive-strand viruses | | equivalent name -35278 | ssRNA positive-strand viruses, no DNA stage | | equivalent name -35278 | unclassified ssRNA positive-strand viruses | | scientific name -35278 | unclassified ssRNA positive-strand viruses, no DNA stage | | equivalent name -35300 | HAstV-4 | | acronym -35300 | Human astrovirus 4 | | scientific name -35300 | Human astrovirus type 4 | | equivalent name -35303 | unassigned Rhabdoviridae | | synonym -35303 | unclassified Dimarhabdovirus supergroup | | includes -35303 | unclassified Rhabdoviridae | | scientific name -35323 | Thogoto-like viruses | | equivalent name -35323 | Thogotovirus | | scientific name -35325 | dsRNA nonenveloped viruses | | equivalent name -35325 | dsRNA viruses | | scientific name -35342 | ssDNA nonenveloped viruses | | equivalent name -35342 | ssDNA viruses | | equivalent name -35342 | unclassified ssDNA nonenveloped viruses | | equivalent name -35342 | unclassified ssDNA viruses | | scientific name -35466 | Selenastraceae | | scientific name -35466 | Selenastraceae Blackman & Tansley, 1903 | | authority -35491 | DO clade | | synonym -35491 | Sphaeropleales | | scientific name -35491 | Sphaeropleales Luerssen, 1877 | | authority -35493 | Streptophyta | | scientific name -35493 | Streptophyta Bremer, 1985 | | authority -35500 | Pecora | | scientific name -35627 | Stylosanthes | | scientific name -35627 | Stylosanthes Sw., 1788 | | authority -35634 | Ischnocera | | scientific name -35634 | Ischnocera Kellogg, 1896 | | authority -35634 | Mallophaga | Mallophaga | in-part -35634 | chewing lice | chewing lice | genbank common name -35709 | Chusquea | | scientific name -35709 | Chusquea Kunth, 1816 | | authority -35718 | Chaetomiaceae | | scientific name -35718 | Chaetomiaceae G. Winter, 1885 | | authority -35740 | HAstV-3 | | acronym -35740 | Human astrovirus 3 | | scientific name -35740 | Human astrovirus type 3 | | equivalent name -35741 | HAstV-5 | | acronym -35741 | Human astrovirus 5 | | scientific name -35741 | Human astrovirus type 5 | | equivalent name -35869 | Zygnema circumcarinatum | | scientific name -35869 | Zygnema circumcarinatum Czurda | | authority -35869 | Zygnemopsis circumcarinata | | synonym -36050 | Fusarium poae | | scientific name -36050 | Fusarium poae (Peck) Wollenw., 1913 | | authority -36050 | NRRL 26941 | NRRL 26941 | type material -36050 | Sporotrichum poae | | synonym -36050 | Sporotrichum poae Peck, 1904 | | authority -36291 | Muscicapidae | | scientific name -36291 | Old World flycatchers | | genbank common name -37130 | HAstV-6 | | acronym -37130 | Human astrovirus 6 | | scientific name -37130 | Human astrovirus type 6 | | equivalent name -37567 | Ditrysia | | scientific name -37569 | Bombycoidea | | scientific name -37569 | Sphingoidea | | synonym -37569 | hawk-moths | | genbank common name -37570 | Noctuoidea | | scientific name -37572 | Papilionoidea | | scientific name -37572 | butterflies | butterflies | blast name -37572 | butterflies | butterflies | genbank common name -37573 | Pyraloidea | | scientific name -37660 | Caribbean stylo | | genbank common name -37660 | Hedysarum hamatum | | synonym -37660 | Hedysarum hamatum L., 1759 | | authority -37660 | Stylosanthes hamata | | scientific name -37660 | Stylosanthes hamata (L.) Taub., 1890 | | authority -37660 | cheesytoes | | common name -37754 | Human papillomavirus unidentified type (ICPX1) | | scientific name -37755 | Human papillomavirus unidentified type (RTRX1) | | scientific name -37756 | Human papillomavirus unidentified type (RTRX2) | | scientific name -37757 | Human papillomavirus unidentified type (RTRX3) | | scientific name -37758 | Human papillomavirus unidentified type (RTRX4) | | scientific name -37759 | Human papillomavirus unidentified type (RTRX5) | | scientific name -37760 | Human papillomavirus unidentified type (RTRX6) | | scientific name -37844 | Monopisthocotylea | | scientific name -37850 | Parastacidae | | scientific name -37945 | Monogenea | | scientific name -37960 | unassigned Partitiviridae | | equivalent name -37960 | unclassified Alphacryptovirus | | equivalent name -37960 | unclassified Partitiviridae | | scientific name -37960 | unclassified Partitivirus | | equivalent name -38033 | CBS 160.62 | CBS 160.62 | type material -38033 | Chaetomium globosum | | scientific name -38033 | Chaetomium globosum Kunze ex Fr. 1829 | | authority -38033 | Chaetomium globosum Kunze ex Fries, 1829 | | authority -38033 | Chaetomium rectum | | synonym -38033 | Chaetomium rectum Sergeeva 1961 | | authority -38033 | Chaetomium sp. MUT 4942 | | includes -38124 | Triozidae | | scientific name -38144 | unclassified Flaviviridae | | scientific name -38605 | Didelphimorphia | | scientific name -38820 | Cyperales | | includes -38820 | Poales | | scientific name -38820 | Typhales | | includes -38950 | HAstV-7 | | acronym -38950 | Human astrovirus 7 | | scientific name -38950 | Human astrovirus type 7 | | equivalent name -39249 | Scrophularia | | scientific name -39249 | Scrophularia L., 1753 | | authority -39249 | figworts | | genbank common name -39724 | Circoviridae | | scientific name -39725 | Circovirus | | scientific name -39729 | Potyviridae | | scientific name -39731 | Bymovirus | | scientific name -39733 | Astroviridae | | scientific name -39734 | Umbravirus | | scientific name -39738 | Tombusviridae | | scientific name -39740 | Bromoviridae | | scientific name -39750 | Aquabirnavirus | | scientific name -39756 | unclassified Totiviridae | | scientific name -39760 | Idaeovirus | | scientific name -39780 | unclassified dsRNA viruses | | scientific name -39804 | Allolevivirus subgroup IV | | equivalent name -39804 | Bacteriophage FI | | equivalent name -39804 | Enterobacteria phage FI | | equivalent name -39804 | Enterobacteria phage isolate FI | | equivalent name -39804 | Escherichia virus FI | | equivalent name -39804 | Qubevirus faecium | | scientific name -39804 | phage FI | | equivalent name -39804 | serumgroup IV | | equivalent name -39829 | Ocypodoidea | | scientific name -39831 | "Bacterium rhinoscleromatis" (Trevisan 1887) Migula 1900 | | authority -39831 | ATCC 13884 | ATCC 13884 | type material -39831 | Bacterium rhinoscleromatis | | synonym -39831 | CCUG 417 | CCUG 417 | type material -39831 | CIP 52.210 | CIP 52.210 | type material -39831 | DSM 16231 | DSM 16231 | type material -39831 | JCM 1664 | JCM 1664 | type material -39831 | Klebsiella pneumoniae subsp. rhinoscleromatis | | scientific name -39831 | Klebsiella pneumoniae subsp. rhinoscleromatis (Trevisan 1887) Orskov 1984 | | authority -39831 | Klebsiella rhinoscleromatis | | synonym -39831 | Klebsiella rhinoscleromatis Trevisan 1887 (Approved Lists 1980) | | authority -39831 | LMG 3184 | LMG 3184 | type material -39831 | LMG:3184 | LMG:3184 | type material -39831 | NCTC 5046 | NCTC 5046 | type material -40065 | Chenuda complex | | equivalent name -40065 | Chenuda virus | | scientific name -40067 | Wad Medani complex | | equivalent name -40067 | Wad Medani virus | | scientific name -40068 | unclassified Orbivirus | | scientific name -40092 | Hesperioidea | | scientific name -40093 | Hesperiidae | | scientific name -40093 | skippers | | genbank common name -40119 | Parvovirinae | | scientific name -40120 | Densovirinae | | scientific name -40122 | Iteradensovirus | | scientific name -40122 | Iteravirus | | equivalent name -40272 | Roseolovirus | | scientific name -40562 | Strophariaceae | | scientific name -40562 | Strophariaceae Singer & A.H. Sm., 1946 | | authority -40588 | Dipterocarpaceae | | scientific name -40588 | Dipterocarpaceae Blume, 1825 | | authority -40588 | meranti family | | common name -40674 | Mammalia | | scientific name -40674 | mammals | mammals | blast name -40674 | mammals | mammals | genbank common name -40948 | Angelica | | scientific name -40948 | Angelica L., 1753 | | authority -41071 | Adephaga | | scientific name -41073 | Carabidae | | scientific name -41073 | ground beetles | | genbank common name -41084 | Polyphaga | Polyphaga | scientific name -41088 | Chrysomeliformia | Chrysomeliformia | includes -41088 | Cucujiformia | | scientific name -41154 | Prioninae | | scientific name -41155 | Lepturinae | | scientific name -41191 | Glossata | | scientific name -41196 | Neolepidoptera | | scientific name -41197 | Heteroneura | | scientific name -41479 | Aster | | scientific name -41479 | Aster L., 1753 | | authority -41549 | Cirsium | | scientific name -41549 | Cirsium Mill., 1754 | | authority -41665 | Neopterygi | | synonym -41665 | Neopterygii | | scientific name -41666 | Batrachia | | scientific name -41705 | Protacanthopterygii | | scientific name -41768 | Berberidales | | includes -41768 | Berberidineae | | includes -41768 | Ranunculales | | scientific name -41768 | Ranunculineae | | includes -41773 | Berberidaceae | | scientific name -41773 | Berberidaceae Juss., 1789 | | authority -41773 | Podophyllaceae | | includes -41773 | barberry family | | common name -41827 | Culicoidea | | scientific name -41937 | Rutanae | | in-part -41937 | Sapindales | | scientific name -41938 | Malvales | | scientific name -41938 | Malvanae | | in-part -43358 | HAstV-8 | | acronym -43358 | Human astrovirus 8 | | scientific name -43358 | Human astrovirus type 8 | | equivalent name -43464 | Circaetus | | scientific name -43786 | Culicomorpha | | scientific name -43817 | Culicinae | | scientific name -43951 | Zygnema | | scientific name -43951 | Zygnema C.Agardh, 1817 | | authority -44560 | AYVV | | acronym -44560 | Ageratum yellow vein virus | | scientific name -45234 | Cordyceps | | scientific name -45234 | Cordyceps Fr., 1833 | | authority -45234 | Parahevansia | | synonym -45234 | Parahevansia Mongkolsamrit & Noisripoom, 2022 | | authority -45357 | ATCC 22991 | ATCC 22991 | type material -45357 | CBS 5149 | CBS 5149 | type material -45357 | Candida haemuli (Uden & Kolip.) S.A. Mey. & Yarrow 1978 | | synonym -45357 | Candida haemulonii | | synonym -45357 | Candida haemulonii type II | | includes -45357 | Candida haemulonis | | synonym -45357 | Candidozyma haemuli | | scientific name -45357 | Candidozyma haemuli (Uden & Kolip.) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai, 2024 | | authority -45357 | DBVPG 6958 | DBVPG 6958 | type material -45357 | IFO 10001 | IFO 10001 | type material -45357 | IGC 3025 | IGC 3025 | type material -45357 | JCM 3762 | JCM 3762 | type material -45357 | NRRL Y-6693 | NRRL Y-6693 | type material -45357 | Torulopsis haemuli Uden & Kolip., 1962 | | synonym -45357 | Torulopsis haemuloni | | synonym -45357 | specimen-voucher:NRRL:Y:6693 | specimen-voucher:NRRL:Y:6693 | type material -45607 | AJ 4995 | AJ 4995 | type material -45607 | ATCC 60130 | ATCC 60130 | type material -45607 | CBS 6739 | CBS 6739 | type material -45607 | CCRC 22618 | CCRC 22618 | type material -45607 | CCRC:22618 | CCRC:22618 | type material -45607 | Candida sorbophila | | synonym -45607 | IFO 1583 | IFO 1583 | type material -45607 | JCM 1514 | JCM 1514 | type material -45607 | NRRL Y-7921 | NRRL Y-7921 | type material -45607 | Torulopsis sorbophila | | synonym -45607 | Torulopsis sorbophila Nakase, 1975 | | authority -45607 | Wickerhamiella sorbophila | | scientific name -45607 | Wickerhamiella sorbophila (Nakase) C. Vega & Lachance, 2017 | | authority -45607 | specimen-voucher:NRRL:Y:7921 | specimen-voucher:NRRL:Y:7921 | type material -45787 | Wickerhamiella | | scientific name -45787 | Wickerhamiella Van der Walt & Liebenberg, 1973 | | authority -45950 | Dreissenidae | | scientific name -45951 | Dreissena | | scientific name -46108 | Suaeda | | scientific name -46108 | Suaeda Forssk. ex J.F.Gmel., 1776 | | authority -46108 | sea-blites | | common name -46108 | seepweeds | | genbank common name -46366 | Bupleurum | | scientific name -46366 | Bupleurum L. | | authority -46569 | Termitidae | | scientific name -46569 | desert termites | | genbank common name -46569 | higher termites | | common name -46619 | Sweet potato G virus | | equivalent name -46619 | Sweet potato virus G | | scientific name -47455 | Pariana | | scientific name -47455 | Pariana Aubl., 1775 | | authority -47456 | Pariana radiciflora | | scientific name -47456 | Pariana radiciflora Sagot ex Doell., 1877 | | authority -47520 | Palaeoheterodonta | | scientific name -47521 | Unionida | | scientific name -47521 | Unionoida | | synonym -47522 | Unionacea | | synonym -47522 | Unionoidea | | scientific name -47523 | Ambleminae | | scientific name -47523 | Pleurobeminae | | includes -47523 | Quadrulinae | | includes -47524 | Amblema | | scientific name -47526 | Unionidae | | scientific name -47567 | Contracaecum | | scientific name -49188 | Aconitum | | scientific name -49188 | Aconitum Finet & Gagnep., 1904 | | authority -49669 | Paris | | scientific name -49669 | Paris L., 1753 | | authority -49817 | Erythrina crista-galli | | scientific name -49817 | Erythrina crista-galli L., 1767 | | authority -49817 | ceibo | | common name -49817 | cockspur coraltree | | genbank common name -49817 | cry-baby tree | | common name -50292 | African green monkey cytomegalovirus | | equivalent name -50292 | CeHV-5 | | acronym -50292 | Cercopithecine betaherpesvirus 5 | | scientific name -50292 | Cercopithecine herpesvirus 5 | | equivalent name -50292 | Simian cytomegalovirus (strain Colburn) | | equivalent name -50362 | Melanthiaceae | | scientific name -50362 | Melanthiaceae Batsch ex Borkh., 1797 | | authority -50362 | Trilliaceae | | synonym -50362 | trillium family | | common name -50435 | Hemerobiidae | | scientific name -50435 | brown lacewings | | genbank common name -50435 | trashbugs | | common name -50488 | Zygoptera | | scientific name -50488 | damselflies | damselflies | blast name -50488 | damselflies | damselflies | genbank common name -50489 | Calopterygidae | | scientific name -50489 | broad-winged damselflies | | genbank common name -50515 | Dytiscidae | | scientific name -50515 | predacious diving beetles | | genbank common name -50557 | Insecta | | scientific name -50557 | insects | insects | blast name -50557 | insects | insects | genbank common name -50557 | true insects | | common name -50713 | Cocal virus | | scientific name -51909 | Pyrrhura | | scientific name -52123 | Oceanodroma | | scientific name -52360 | Amblema perplicata | | scientific name -52360 | Amblema plicata | | synonym -52360 | Unio plicata | | synonym -52360 | Unio plicata Say, 1817 | | authority -52974 | Bartramiaceae | | scientific name -52974 | Bartramiaceae Schwaegr., 1830 | | authority -52975 | Bartramia | Bartramia | scientific name -52975 | Bartramia Hedw., 1801 | | authority -52976 | Bartramia pomiformis | | scientific name -52976 | Bartramia pomiformis Hedw., 1801 | | authority -53017 | Batken virus | | scientific name -53058 | Chiloschista | | scientific name -53058 | Chiloschista Lindl., 1832 | | authority -53124 | Phragmipedilum | | synonym -53124 | Phragmipedium | | scientific name -53124 | Phragmipedium Rolfe, 1896 | | authority -53300 | Macrophthalmus | | scientific name -53541 | Stegomyia | | scientific name -54049 | Stercorariidae | | scientific name -54057 | Catharacta | | synonym -54057 | Stercorarius | | scientific name -54057 | Stercorarius Brisson, 1760 | | authority -54059 | Larus parasiticus | | synonym -54059 | Larus parasiticus Linnaeus, 1758 | | authority -54059 | Stercorarius parasiticus | | scientific name -54354 | Aramidae | | scientific name -54354 | limpkins | | genbank common name -54355 | Aramus | | scientific name -54356 | Aramus guarauna | | scientific name -54356 | Aramus guarauna (Linnaeus, 1766) | | authority -54356 | Scolopax guarauna | | synonym -54356 | Scolopax guarauna Linnaeus, 1766 | | authority -54356 | limpkin | | genbank common name -54357 | Psophiidae | | scientific name -54357 | trumpeters | | genbank common name -54358 | Psophia | | scientific name -54359 | Psophia crepitans | | scientific name -54359 | Psophia crepitans Linnaeus, 1758 | | authority -54359 | common trumpeter | | genbank common name -54757 | Plasmodium vinckei subsp. vinckei | | synonym -54757 | Plasmodium vinckei vinckei | | scientific name -55136 | Myliobatinae | | scientific name -55136 | eagle rays | | genbank common name -55193 | Malassezia | | scientific name -55193 | Malassezia Baill., 1889 | | authority -55267 | Maricola | | scientific name -55867 | Scolytidae | | synonym -55867 | Scolytinae | | scientific name -55867 | ambrosia beetles | ambrosia beetles | common name -55867 | bark beetles | | genbank common name -56259 | Accipitridae | | scientific name -56301 | Musophagiformes | | scientific name -56301 | turacos | | genbank common name -56302 | Musophagidae | | scientific name -56308 | Trogoniformes | | scientific name -56308 | trogons and quetzals | | genbank common name -56309 | Trogonidae | | scientific name -56310 | Trogon | | scientific name -56311 | Trogon melanurus | | scientific name -56311 | Trogon melanurus Swainson, 1838 | | authority -56311 | black-tailed trogon | | genbank common name -56342 | Herpetotheres | | scientific name -56343 | Falco cachinnans | | synonym -56343 | Falco cachinnans Linnaeus, 1758 | | authority -56343 | Herpetotheres cachinnans | | scientific name -56646 | CBS 458.93 | CBS 458.93 | type material -56646 | Fusarium venenatum | | scientific name -56646 | Fusarium venenatum Nirenberg, 1995 | | authority -56646 | Fusarium venetum | | synonym -56646 | ICMP:20649 | ICMP:20649 | type material -56785 | Nucifraga | | scientific name -56866 | Cucumis acutangulus | | synonym -56866 | Cucumis acutangulus L., 1753 | | authority -56866 | Cucurbita acutangula | | synonym -56866 | Cucurbita acutangula (L.) Blume, 1826 | | authority -56866 | Luffa acutangula | | scientific name -56866 | Luffa acutangula (L.) Roxb., 1832 | | authority -56866 | angled luffa | | genbank common name -56866 | ribbed gourd | | common name -56866 | ribbed luffa | | common name -56866 | ridged gourd | | common name -56866 | silky gourd | | common name -56866 | singkwa towel gourd | | common name -57379 | Bucerotiformes | | scientific name -57379 | Upupiformes | | includes -57379 | hoopoes and others | | common name -57379 | hornbills | | genbank common name -57382 | Centropidae | | scientific name -57383 | Cerylidae | | scientific name -57401 | Centropus | | scientific name -57405 | Chloroceryle | | scientific name -58019 | Coniferophyta | | equivalent name -58019 | Coniferopsida | | synonym -58019 | Pinopsida | | scientific name -58019 | conifers | | common name -58023 | Tracheophyta | | scientific name -58023 | Tracheophyta Sinnott ex Cavalier-Smith, 1998 | | authority -58023 | vascular plants | vascular plants | blast name -58023 | vascular plants | vascular plants | common name -58024 | Spermatophyta | | scientific name -58024 | seed plants | seed plants | blast name -58024 | seed plants | seed plants | common name -58627 | ATCC 20278 | ATCC 20278 | type material -58627 | BCRC 21710 | BCRC 21710 | type material -58627 | CBS 789 | CBS 789 | type material -58627 | CECT 11370 | CECT 11370 | type material -58627 | CECT 11370T | CECT 11370T | type material -58627 | Debaryomyces fabryi | | scientific name -58627 | Debaryomyces fabryi M. Ota, 1924 | | authority -58627 | Debaryomyces fabryi M.Ota, 1924 | | authority -58627 | Debaryomyces hansenii var. fabryi | | synonym -58627 | Debaryomyces hansenii var. fabryi (M.Ota) Nakase & M. Suzuki 1985 | | authority -58627 | IFO 0015 | IFO 0015 | type material -58627 | JCM 2104 | JCM 2104 | type material -58627 | KCTC 7603 | KCTC 7603 | type material -58627 | NBRC 0015 | NBRC 0015 | type material -58627 | NRRL Y-17914 | NRRL Y-17914 | type material -58627 | Y-17914 | Y-17914 | type material -58627 | type strain: CBS 789 | type strain: CBS 789 | type material -59171 | Patrinia | | scientific name -59171 | Patrinia Juss., 1807 | | authority -59172 | Patrinia rupestris | | scientific name -59172 | Patrinia rupestris Dufr., 1811 | | authority -59500 | Rice necrosis mosaic virus | | scientific name -60456 | Iris yellow spot virus | | scientific name -60807 | Scaritini | | scientific name -60808 | Scarites | | scientific name -60809 | Scarites subterraneus | | scientific name -60809 | Scarites subterraneus Fabricius, 1775 | | authority -62020 | Mnais | | scientific name -62020 | Mnais Selys, 1853 | | authority -62110 | Dahlstedtia | | scientific name -62110 | Dahlstedtia Malme, 1905 | | authority -62784 | Tettigoniidae | | scientific name -62784 | bush-crickets | | common name -62784 | bushcrickets | | common name -62784 | katydids | | genbank common name -62784 | long-horned grasshoppers | | common name -63225 | Lepus townsendii | | scientific name -63225 | Lepus townsendii Bachman, 1839 | | authority -63225 | white-tailed jackrabbit | | genbank common name -63405 | Arthroderma otae | | synonym -63405 | Arthroderma otae (A. Haseg. & Usui) McGinnis, Weitzman, A.A. Padhye & Ajello, 1986 | | synonym -63405 | CBS 496.86 | CBS 496.86 | type material -63405 | Microsporum canis | | scientific name -63405 | Microsporum canis E. Bodin ex Gueg., 1902 | | authority -63405 | Nannizzia otae | | synonym -63405 | Nannizzia otae A. Haseg. & Usui 1974 | | authority -64021 | Cherry small circular viroid-like RNA | | scientific name -64579 | Vatica | | scientific name -64579 | Vatica L. | | authority -65009 | Dipterocarpoideae | | scientific name -65068 | PRMV | | acronym -65068 | Peach rosette mosaic virus | | scientific name -65068 | peach rosette mosaic Nepovirus | | equivalent name -65386 | Anomalodesmata | | scientific name -65386 | Pholadomyoida | | synonym -66236 | Philopteridae | | scientific name -66236 | bird lice | | genbank common name -67753 | Crinivirus | | scientific name -67762 | TbLCV | | acronym -67762 | Tobacco leaf curl virus | | scientific name -67762 | tobacco leaf curl geminivirus | | equivalent name -67762 | tobacco leafcurl virus | | equivalent name -68416 | Woolly monkey hepatitis B virus | | scientific name -69720 | Zantedeschia | | scientific name -69720 | Zantedeschia Spreng., 1826 | | authority -69721 | Calla aethiopica | | synonym -69721 | Calla aethiopica L., 1753 | | authority -69721 | Zantedeschia aethiopica | | scientific name -69721 | Zantedeschia aethiopica (L.) Spreng., 1826 | | authority -69721 | arum-lily | | common name -69721 | calla lily | | genbank common name -69721 | pig-lily | | common name -69973 | Closteroviridae | | scientific name -70085 | Sicyopterus | | scientific name -70170 | Green turtle herpesvirus | | scientific name -70439 | Chaenodraco | | scientific name -70440 | Chaenodraco wilsoni | | scientific name -70440 | Chaenodraco wilsoni Regan, 1914 | | authority -70440 | spiny icefish | | common name -70564 | Hawaiian green turtle herpesvirus | | scientific name -70778 | Acropora nasuta | | scientific name -70778 | Madrepora nasuta | | synonym -70778 | Madrepora nasuta Dana, 1846 | | authority -70893 | Calopterygoidea | | scientific name -70905 | Tettigonioidea | | scientific name -70987 | Apinae | | scientific name -70987 | honey bees | | genbank common name -71112 | Lontra | | scientific name -71112 | Lontra Gray, 1843 | | authority -71239 | Cucurbitales | | scientific name -71239 | Cucurbitales Juss. ex Bercht. & J.Presl, 1820 | | authority -71240 | Dicotyledoneae | | in-part -71240 | dicots | | in-part -71240 | dicotyledons | | in-part -71240 | eudicots | eudicots | blast name -71240 | eudicots | eudicots | common name -71240 | eudicotyledons | | scientific name -71274 | Asteridae | | equivalent name -71274 | asterids | | scientific name -71275 | Rosidae | | in-part -71275 | rosids | | scientific name -71528 | Chrysomeliformia | Chrysomeliformia | in-part -71528 | Chrysomeloidea | | scientific name -71528 | Phytophaga | | in-part -71529 | Chrysomeliformia | Chrysomeliformia | in-part -71529 | Curculionoidea | | scientific name -71529 | Phytophyaga | | in-part -71950 | Psilocybe | | scientific name -71950 | Psilocybe (Fr.) P. Kumm., 1871 | | authority -72018 | Sphaeroforma | | scientific name -72019 | Sphaeroforma arctica | | scientific name -72019 | Sphaerosoma arcticum | | synonym -72019 | Sphaerosoma arcticus | | synonym -72025 | Fabales | | scientific name -72041 | Eumalacostraca | | scientific name -72407 | ATCC 13883 | ATCC 13883 | type material -72407 | CCUG 225 | CCUG 225 | type material -72407 | CDC 298-53 | CDC 298-53 | type material -72407 | CIP 82.91 | CIP 82.91 | type material -72407 | Citrobacter sp. 43UCKPC_BLUE2PLATE | | includes -72407 | Citrobacter sp. 43UCKPC_BLUE4LB | | includes -72407 | DSM 30104 | DSM 30104 | type material -72407 | Enterobacteriaceae bacterium 291_EBAC | | includes -72407 | HAMBI 450 | HAMBI 450 | type material -72407 | IAM 14200 | IAM 14200 | type material -72407 | IFO 14940 | IFO 14940 | type material -72407 | JCM 1662 | JCM 1662 | type material -72407 | Klebsiella pneumoniae subsp. pneumoniae | | scientific name -72407 | Klebsiella pneumoniae subsp. pneumoniae (Schroeter 1886) Trevisan 1887 | | authority -72407 | Klebsiella sp. CCUG 225 | | includes -72407 | Klebsiella sp. NCTC 8172 | | includes -72407 | Klebsiella sp. VTT E-95647 | | includes -72407 | Klebsiella sp. VTT E-96687 | | includes -72407 | LMG 2095 | LMG 2095 | type material -72407 | LMG:2095 | LMG:2095 | type material -72407 | NBRC 14940 | NBRC 14940 | type material -72407 | NCTC 9633 | NCTC 9633 | type material -72876 | Varunidae | | scientific name -73275 | Helianthus argophyllus | | scientific name -73275 | Helianthus argophyllus Torr. & A.Gray, 1842 | | authority -73496 | Asparagales | | scientific name -73496 | Asparagales Link, 1829 | | authority -73496 | Liliales/Asparagales group | Liliales/Asparagales group | in-part -73496 | Liliiflorae | Liliiflorae | in-part -73501 | Clavaria militaris | | synonym -73501 | Clavaria militaris L., 1753 | | authority -73501 | Cordyceps militaris | | scientific name -73501 | Cordyceps militaris (L.) Fr., 1818 | | authority -74132 | Symphysodon | Symphysodon | scientific name -74133 | Symphysodon aequifasciata | | scientific name -74133 | Symphysodon aequifasciata Pellegrin, 1904 | | authority -74133 | Symphysodon aequifasciatus | | synonym -74133 | blue discus | | genbank common name -74133 | green discus | | common name -74320 | BusuNPV | | acronym -74320 | Buzura suppressaria NPV | | equivalent name -74320 | Buzura suppressaria nuclear polyhedrosis virus | | synonym -74320 | Buzura suppressaria nucleocapsid nuclear polyhedrosis virus | | equivalent name -74320 | Buzura suppressaria nucleopolyhedrosisvirus | | equivalent name -74320 | Buzura suppressaria nucleopolyhedrovirus | | scientific name -74320 | Buzura suppressaria single nucleocapsid nuclear polyhedrosis virus | | equivalent name -74649 | China rose | | common name -74649 | Rosa chinensis | | scientific name -74649 | Rosa chinensis Jacq., 1768 | | authority -74649 | Rosa indica auct., non L. | | synonym -74694 | Veronicastrum | | scientific name -74694 | Veronicastrum Heist. ex Fabr., 1759 | | authority -75725 | Enterobacteria phage NL95 | | scientific name -75725 | bacteriophage NL95 | | equivalent name -75739 | Eucoccidiida | | synonym -75739 | Eucoccidiorida | | scientific name -75747 | FUPO-1 | | acronym -75747 | Fusarium poae virus 1 | | scientific name -76717 | Lontra canadensis | | scientific name -76717 | Lontra canadensis Schreber, 1777 | | authority -76717 | Lutra canadensis | | synonym -76717 | Northern American river otter | | genbank common name -76717 | river otter | | common name -76775 | ATCC 96801 | ATCC 96801 | type material -76775 | CBS 7877 | CBS 7877 | type material -76775 | Malassezia restricta | | scientific name -76775 | Malassezia restricta E. Gueho, J. Guillot & Midgley, 1996 | | authority -76803 | Arteriviridae | | scientific name -76804 | Nidovirales | | scientific name -77519 | Plasmodium gonderi | | scientific name -78060 | Alectoriaceae | | synonym -78060 | Anziaceae | | synonym -78060 | Parmeliaceae | | scientific name -78536 | Euphyllophyta | | scientific name -78536 | euphyllophytes | | equivalent name -79078 | Stylosanthes scabra | | scientific name -79078 | Stylosanthes scabra Vogel, 1838 | | authority -79078 | shrubby stylo | | common name -79236 | Cotton yellow mosaic geminivirus | | equivalent name -79236 | Cotton yellow mosaic virus | | scientific name -79514 | Lamiinae | | scientific name -79514 | Laminae | | synonym -79633 | Hydrobates tethys | | synonym -79633 | Hydrobates tethys (Bonaparte, 1852) | | authority -79633 | Oceanodroma tethys | | scientific name -79633 | Oceanodroma tethys (Bonaparte, 1852) | | authority -79633 | Wedge-rumped storm-petrel | | genbank common name -79652 | Oceanites | | scientific name -79653 | Oceanites oceanicus | | scientific name -79653 | Oceanites oceanicus (Kuhl, 1820) | | authority -79653 | Procellaria oceanica | | synonym -79653 | Procellaria oceanica Kuhl, 1820 | | authority -79653 | Wilson's storm-petrel | | genbank common name -82582 | Apaturinae | | scientific name -82582 | emperor butterflies | | genbank common name -82582 | emperors | emperors | common name -82676 | Omikronpapillomavirus 1 | | scientific name -82676 | Phocoena spinipinnis papillomavirus | | equivalent name -83312 | Apis nigrocincta | | scientific name -83312 | Apis nigrocincta Smith, 1860 | | authority -83321 | Apini | | scientific name -83871 | Chrysanthemum stem necrosis virus | | scientific name -85103 | Burhinidae | | scientific name -85104 | Burhinus | | scientific name -85512 | Dicondylia | | scientific name -85545 | Hydrobatidae | | scientific name -85545 | Hydrobatinae | | synonym -85545 | Oceanitidae | | synonym -85545 | storm petrels | | common name -85604 | Amphiesmenoptera | | scientific name -85817 | Neuroptera group | | includes -85817 | Neuroptera-Megaloptera-Raphidoptera group | | includes -85817 | Neuropterida | | scientific name -85819 | Phthiraptera | | scientific name -85819 | Phthiraptera Haeckel, 1896 | | authority -85819 | lice | lice | blast name -85819 | lice | lice | genbank common name -85823 | Blattaria | | synonym -85823 | Blattodea | | scientific name -85823 | Blattoptera | | synonym -85823 | cockroaches & termites | cockroaches & termites | blast name -85823 | cockroaches & termites | cockroaches & termites | genbank common name -86721 | Kmeria duperreana | | synonym -86721 | Kmeria duperreana (Pierre) Dandy, 1927 | | authority -86721 | Magnolia duperreana | | scientific name -86721 | Magnolia duperreana Pierre, 1880 | | authority -86989 | Emmenopterys | | scientific name -86989 | Emmenopterys Oliv., 1889 | | authority -86990 | Emmenopterys henryi | | scientific name -86990 | Emmenopterys henryi Oliv., 1889 | | authority -87139 | Aetobatus | | scientific name -88159 | Alaria praelonga | | scientific name -88159 | Alaria praelonga Kjellman, 1889 | | authority -88770 | Panarthropoda | | scientific name -89593 | Craniata | Craniata | scientific name -90010 | unclassified Enterovirus | | scientific name -90010 | unclassified Enteroviruses | | equivalent name -91347 | Enterobacterales | | scientific name -91347 | Enterobacterales Adeolu et al. 2016 | | authority -91347 | Enterobacteriaceae and related endosymbionts | | synonym -91347 | Enterobacteriaceae group | | synonym -91347 | Enterobacteriales | | synonym -91347 | gamma-3 proteobacteria | gamma-3 proteobacteria | in-part -91561 | Artiodactyla | | scientific name -91561 | Cetartiodactyla | | synonym -91561 | even-toed ungulates & whales | even-toed ungulates & whales | blast name -91561 | even-toed ungulates & whales | even-toed ungulates & whales | genbank common name -91771 | Megalaimidae | | scientific name -91776 | Psilopogon | | scientific name -91827 | Gunneridae | | scientific name -91827 | Gunneridae D.E.Soltis, P.S.Soltis & W.S.Judd, 2007 | | authority -91827 | core eudicots | | equivalent name -91827 | core eudicotyledons | | equivalent name -91835 | eurosids I | | synonym -91835 | fabids | | scientific name -91836 | eurosids II | | includes -91836 | malvids | | scientific name -91882 | Asteranae | | includes -91882 | campanulids | | scientific name -91882 | euasterids II | | synonym -91888 | Gentiananae | | includes -91888 | euasterids I | | synonym -91888 | lamiids | | scientific name -92738 | Termitinae | | scientific name -92738 | snapping termites | | genbank common name -93386 | Columbid alphaherpesvirus 1 | | scientific name -93386 | Columbid herpesvirus 1 | | equivalent name -93386 | Columbid herpesvirus type 1 | | equivalent name -93386 | Pigeon herpesvirus | | equivalent name -94231 | Epinephelus | | scientific name -94231 | Promicrops | | synonym -94243 | Stromateidae | | scientific name -94243 | butterfishes | | genbank common name -94642 | Besnoitia | | scientific name -94643 | Besnoitia besnoiti | | scientific name -94844 | Ligula | | scientific name -94845 | Fasciola intestinalis | | synonym -94845 | Fasciola intestinalis Linnaeus, 1758 | | authority -94845 | Ligula intestinalis | | scientific name -95179 | Agrotinae | | synonym -95179 | Noctuinae | | scientific name -95337 | Vesivirus | | scientific name -95341 | Sapovirus | | scientific name -95341 | Sapporo-like viruses | | equivalent name -98220 | Alaria crassifolia | | scientific name -98220 | Alaria crassifolia Kjellman, 1885 | | authority -98221 | Alaria marginata | | scientific name -98221 | Alaria marginata Postels & Ruprecht, 1840 | | authority -99756 | Engaeus | | scientific name -100182 | Granada hare | | genbank common name -100182 | Lepus granatensis | | scientific name -100182 | Lepus granatensis Rosenhauer, 1856 | | authority -100750 | Limenitidinae | | scientific name -101203 | Saprolegnia parasitica | | scientific name -102804 | Asteroideae | | scientific name -102804 | Asteroideae Lindl., 1829 | | authority -102805 | Barnadesioideae | | scientific name -102805 | Barnadesioideae (D.Don) Bremer & Jansen, 1992 | | authority -102809 | Astereae | | scientific name -102809 | Astereae Cass., 1819 | | authority -102814 | Heliantheae | | scientific name -102814 | Heliantheae Cass., 1819 | | authority -102818 | Cardueae | | scientific name -102818 | Cardueae Cass., 1819 | | authority -103490 | Cyclobalanopsis gilva | | synonym -103490 | Cyclobalanopsis gilva (Blume) Oerst. | | authority -103490 | Quercus gilva | | scientific name -103490 | Quercus gilva Blume, 1851 | | authority -103723 | Grapevine Red Globe virus | | scientific name -103955 | Corythaixoides | | scientific name -103956 | Corythaix concolor | | synonym -103956 | Corythaix concolor Smith, 1833 | | authority -103956 | Corythaixoides concolor | | scientific name -103956 | Corythaixoides concolor (Smith, A, 1833) | | authority -103956 | Crinifer concolor | | synonym -103956 | Crinifer concolor (Smith, 1833) | | authority -103956 | grey go-away-bird | | genbank common name -104430 | Apoditrysia | | scientific name -104431 | Obtectomera | | scientific name -104435 | Zygaenoidea | | scientific name -104766 | Nanovirus | | scientific name -105711 | Dreissenoidea | | scientific name -106324 | Ascaris osculata | | synonym -106324 | Ascaris osculata Rudolphi, 1802 | | authority -106324 | Contracaecum osculatum | | scientific name -106324 | Contracaecum osculatum (Rudolphi, 1802) | | authority -106324 | Contracaecum osculatum C | | includes -106325 | Contracaecum osculatum baicalensis | | scientific name -106742 | Cyclograpsus | | scientific name -107843 | Hydroporinae | | scientific name -107924 | Porhydrus | | scientific name -110618 | Nectriaceae | | scientific name -110618 | Nectriaceae Tul. & C. Tul., 1865 | | authority -110618 | mitosporic Nectriaceae | | includes -111067 | Pagurus longicarpus | | scientific name -111067 | Pagurus longicarpus Say, 1817 | | authority -111067 | long-clawed hermit crab | | genbank common name -111670 | Cladonia rangiferina | | scientific name -111670 | Cladonia rangiferina (L.) Weber, 1780 | | authority -111670 | Lichen rangiferinus | | synonym -111670 | Lichen rangiferinus L., 1753 | | authority -112415 | Letharia | | scientific name -112415 | Letharia (Th. Fr.) Zahlbr., 1892 | | authority -113113 | Rhinopomastidae | | scientific name -113114 | Rhinopomastus | | scientific name -113115 | Falcinellus cyanomelas | | synonym -113115 | Falcinellus cyanomelas Vieillot, 1819 | | authority -113115 | Rhinopomastus cyanomelas | | scientific name -113115 | common scimitar-bill | | genbank common name -114658 | Bryidae | | scientific name -114658 | Bryidae Engl., 1892 | | authority -115354 | Zygaenidae | | scientific name -115354 | burnets | | genbank common name -115354 | smoky moths | | common name -116704 | Eubrachyura | | scientific name -116707 | Brachyrhyncha | Brachyrhyncha | in-part -116707 | Thoracotremata | | scientific name -117010 | Agaricus constrictus | | synonym -117010 | Agaricus constrictus Fr., 1821 | | authority -117010 | Calocybe constricta | | synonym -117010 | Calocybe constricta (Fr.) Kuhner ex Singer, 1962 | | authority -117010 | Tricholomella constricta | | scientific name -117010 | Tricholomella constricta (Fr.) Zerova ex Kalamees, 1992 | | authority -117570 | Teleostomi | | scientific name -117571 | Euteleostomi | | scientific name -117571 | bony vertebrates | | genbank common name -117574 | unclassified Microviridae | | scientific name -117677 | Phaneropteridae | | synonym -117677 | Phaneropterinae | | scientific name -117677 | broad-winged katydids | | common name -117677 | false katydids | | common name -117677 | leaf katydids | | genbank common name -117678 | Poecilimon | | scientific name -117776 | Acropora divaricata | | scientific name -117776 | Acropora divaricata (Dana, 1846) | | authority -117776 | Acropora stoddarti | | synonym -117776 | Madrepora divaricata | | synonym -117776 | Madrepora divaricata Dana, 1846 | | authority -117778 | Acropora yongei | | scientific name -117778 | Acropora yongei Veron & Wallace, 1984 | | authority -117851 | Myliobatiformes | | scientific name -117893 | Batoidea | | scientific name -117893 | rays | | genbank common name -119089 | Adenophorea | | synonym -119089 | Chromadorea | | scientific name -119164 | Betaluteovirus | | equivalent name -119164 | Polerovirus | | scientific name -119164 | Potleavirus | | equivalent name -119164 | luteovirus subgroup II | | equivalent name -119257 | Endromidae | | scientific name -119257 | Mirinidae | | synonym -119257 | Oberthueriinae | | synonym -119257 | Oberthuerinae | | synonym -119257 | Prismostictinae | | synonym -119257 | glory moths | | genbank common name -120864 | Zeleinae | | scientific name -120865 | Zele | | scientific name -121422 | Phoenicurus | | scientific name -121822 | Calophyidae | | scientific name -121823 | Calophya | | scientific name -121826 | Trioza urticae | | scientific name -122260 | Digramma | | scientific name -122261 | Digramma interrupta | | scientific name -123365 | Neoteleostei | | scientific name -123366 | Eurypterygia | | scientific name -123366 | Eurypterygii | | synonym -123367 | Ctenosquamata | | scientific name -123368 | Acanthomorpha | | synonym -123368 | Acanthomorphata | | scientific name -123369 | Euacanthomorpha | | synonym -123369 | Euacanthomorphacea | | scientific name -123757 | Astrocoeniina | | scientific name -124006 | Cyclorhipidion | | scientific name -124426 | Ustilaginoidea | | scientific name -124426 | Ustilaginoidea Bref., 1895 | | authority -124426 | Villosiclava | | synonym -124426 | Villosiclava E. Tanaka & C. Tanaka, 2009 | | authority -124960 | Iodes | | scientific name -124960 | Iodes Blume, 1825 | | authority -126287 | Didelphinae | | scientific name -127916 | DRIP clade | | synonym -127916 | Ichthyosporea | | scientific name -127916 | Ichthyosporea Cavalier-Smith, 1998 | | authority -127916 | Mesomycetozoa | | synonym -127916 | Mesomycetozoea | | synonym -127916 | Mesomycetozoea Mendoza et al., 2002 | | authority -128790 | BRMV | | acronym -128790 | Bean rugose mosaic virus | | scientific name -128818 | Chinese yam necrotic mosaic virus | | scientific name -129017 | Microhyla | | scientific name -129725 | Foveavirus | | scientific name -130990 | Entransia | | scientific name -130990 | Entransia E.O.Hughes, 1948 | | authority -130991 | Entransia fimbriata | | scientific name -130991 | Entransia fimbriata E.O.Hughes | | authority -131209 | Conjugatophyceae | | synonym -131209 | Gamophyceae | | synonym -131209 | Gamophyta | | synonym -131209 | Zygnematophyceae | | scientific name -131209 | Zygnematophyceae van den Hoek et al., 1995 | | authority -131209 | Zygnemophyceae | | synonym -131209 | conjugating green algae | | common name -131210 | Desmidiales | | scientific name -131210 | Desmidiales Bessey, 1907 | | authority -131210 | desmids | | common name -131211 | Closteriaceae | | scientific name -131211 | Closteriaceae Bessey, 1907 | | authority -131220 | Klebsormidiophyceae | | scientific name -131220 | Klebsormidiophyceae van den Hoek et al., 1995 | | authority -131220 | algae | algae | in-part -131221 | Charophyta/Embryophyta group | | synonym -131221 | Streptophytina | | scientific name -131221 | charophyte/embryophyte group | | equivalent name -131567 | biota | | synonym -131567 | cellular organisms | | scientific name -133550 | Crinozoa | | includes -133550 | Pelmatozoa | | scientific name -135166 | Bucconidae | | scientific name -135167 | Bucco | | scientific name -135168 | Bucco capensis | | scientific name -135168 | Bucco capensis Linnaeus, 1766 | | authority -135168 | collared puffbird | | genbank common name -135425 | Nectariniidae | | scientific name -135426 | Dicaeum | | scientific name -137443 | MHV-1 | | acronym -137443 | Macropodid alphaherpesvirus 1 | | scientific name -137443 | Macropodid herpesvirus 1 | | equivalent name -137443 | Macropodid herpesvirus type 1 | | equivalent name -137443 | Parma wallaby herpesvirus | | synonym -137443 | wallaby herpesvirus | | equivalent name -137757 | Ipomovirus | | scientific name -138977 | Myotis horsfieldii | | scientific name -138977 | Vespertilio horsfieldii | | synonym -138977 | Vespertilio horsfieldii Temminck, 1840 | | authority -140052 | Betaretrovirus | | scientific name -140052 | Type D Retrovirus group | | includes -144051 | Cricket paralysis-like viruses | | equivalent name -144051 | Cripavirus | | scientific name -145388 | Monoraphidium neglectum | | scientific name -145388 | Monoraphidium neglectum Heynig & Krienitz | | authority -145388 | SAG 48.87 | SAG 48.87 | type material -147100 | Rhabditophora | | scientific name -147271 | Paspalum | | scientific name -147271 | Paspalum L., 1759 | | authority -147271 | crowngrass | | common name -147366 | Bambusoideae | | scientific name -147366 | Bambusoideae Luerss., 1893 | | authority -147368 | Pooideae | | scientific name -147368 | Pooideae Benth., 1861 | | authority -147369 | Centothecoideae | | synonym -147369 | Panicoideae | | scientific name -147369 | Panicoideae Link, 1827 | | authority -147370 | PACC clade | | includes -147370 | PACCAD clade | | includes -147370 | PACMAD clade | | scientific name -147376 | Bambuseae | | scientific name -147376 | Bambuseae Kunth ex Dumort., 1829 | | authority -147376 | bamboo | | genbank common name -147377 | Olyreae | | scientific name -147377 | Olyreae Kunth ex Spenn., 1825 | | authority -147387 | Poeae | | scientific name -147387 | Poeae R. Br., 1814 | | authority -147428 | Paniceae | | scientific name -147428 | Paniceae R.Br., 1814 | | authority -147537 | Saccharomycotina | | scientific name -147537 | budding yeasts & allies | budding yeasts & allies | blast name -147537 | budding yeasts & allies | budding yeasts & allies | genbank common name -147537 | true yeasts | | common name -147538 | Euascomycota | | synonym -147538 | Pezizomycotina | | scientific name -147538 | Pezizomycotina O.E. Erikss. & Winka, 1997 | | authority -147538 | filamentous ascomycetes | | genbank common name -147545 | Chaetothyriomycetes | | includes -147545 | Eurotiomycetes | | scientific name -147545 | Eurotiomycetes O.E. Erikss. & Winka, 1997 | | authority -147545 | Loculoascomycetes | Loculoascomycetes | in-part -147545 | Plectomycetes | Plectomycetes | in-part -147545 | bitunicate ascomycetes | bitunicate ascomycetes | in-part -147547 | Lecanoromycetes | | scientific name -147547 | Lecanoromycetes O.E. Erikss. & Winka, 1997 | | authority -147547 | common lichens | | common name -147550 | Pyrenomycetes | Pyrenomycetes | in-part -147550 | Sordariomycetes | | scientific name -147550 | Sordariomycetes O.E. Erikss. & Winka, 1997 | | authority -150311 | Oligolepis | | scientific name -151340 | Papillomaviridae | | scientific name -151340 | Papillomavirus | | equivalent name -151341 | Polyomaviridae | | scientific name -153135 | Gammaretrovirus | | scientific name -153135 | MLV-related viruses | | equivalent name -153135 | Mammalian type C retrovirus group | | equivalent name -153135 | Mammalian type C retroviruses | | equivalent name -153135 | mammalian type C oncoviruses | | equivalent name -153135 | type C oncoviruses | | equivalent name -153286 | Myotis nigricans | | scientific name -153286 | Vespertilio nigricans | | synonym -153286 | Vespertilio nigricans Schinz, 1821 | | authority -153287 | Myotis thysanodes | | scientific name -153287 | Myotis thysanodes Miller, 1897 | | authority -155616 | Heterobasidiomycetes | | synonym -155616 | Tremellomycetes | | scientific name -155616 | Tremellomycetes Doweld, 2001 | | authority -155616 | Tremellomycetidae | | equivalent name -155619 | Agaricomycetes | | scientific name -155619 | Agaricomycetes Doweld, 2001 | | authority -155619 | Agaricomycetidae sensu Kirk et al. 2001 | | includes -155619 | Homobasidiomycetes | | includes -155619 | Hymenomycetidae | | includes -155768 | Pandoroidea | | scientific name -156152 | Antirrhinaceae | | includes -156152 | Callitrichaceae | | includes -156152 | Globulariaceae | | includes -156152 | Gratiolaceae | | includes -156152 | Hippuridaceae | | includes -156152 | Plantaginaceae | | scientific name -156152 | Plantaginaceae Juss., 1789 | | authority -156152 | Scrophulariaceae | Scrophulariaceae | in-part -156152 | Veronicaceae | | includes -156152 | speedwell family | | common name -156208 | Macluravirus | | scientific name -156505 | Cyclograpsus intermedius | | scientific name -156505 | Cyclograpsus intermedius Ortmann, 1894 | | authority -156511 | Macrophthalminae | | scientific name -156760 | Galapagos penguin | | genbank common name -156760 | Spheniscus mendiculus | | scientific name -156760 | Spheniscus mendiculus Sundevall, 1871 | | authority -157270 | Gooseberry vein banding associated virus | | scientific name -157270 | Gooseberry vein banding virus | | equivalent name -157317 | Anastrangalia | | scientific name -157777 | PeSV | | acronym -157777 | Pea streak virus | | scientific name -157822 | Lecanorineae | | scientific name -158330 | Cypripedioideae | | scientific name -158330 | Cypripedioideae Lindl. ex Endl., 1837 | | authority -158332 | Epidendroideae | | scientific name -158332 | Epidendroideae Lindl. ex Endl., 1837 | | authority -158391 | Cymbidieae | | scientific name -158391 | Cymbidieae Pfitzer, 1887 | | authority -158397 | Vandeae | | scientific name -158397 | Vandeae Lindl., 1826 | | authority -158424 | Aeridinae | | scientific name -158424 | Aeridinae Pfitzer, 1887 | | authority -158424 | Saccolabiinae | | includes -159141 | Sathuperi orthobunyavirus | | equivalent name -159141 | Sathuperi virus | | scientific name -159150 | Shamonda orthobunyavirus | | equivalent name -159150 | Shamonda virus | | scientific name -159322 | Myotis albescens | | scientific name -159322 | Vespertilio albescens | | synonym -159322 | Vespertilio albescens Geoffroy Saint-Hilaire, 1806 | | authority -159325 | Myotis dominicensis | | scientific name -159325 | Myotis dominicensis Miller, 1902 | | authority -159332 | Myotis oxyotus | | scientific name -159332 | Vespertilio oxyotus | | synonym -159332 | Vespertilio oxyotus Peters, 1867 | | authority -159333 | Myotis ruber | | scientific name -159333 | Vespertilio ruber | | synonym -159333 | Vespertilio ruber Geoffroy Saint-Hilaire, 1806 | | authority -159335 | Myotis volans | | scientific name -159335 | Vespertilio volans | | synonym -159335 | Vespertilio volans Allen, 1866 | | authority -159337 | Myotis yumanensis | | scientific name -159337 | Vespertilio yumanensis | | synonym -159337 | Vespertilio yumanensis Allen, 1864 | | authority -160079 | Anatoecus | | scientific name -160148 | Troctomorpha | | scientific name -160148 | Troctomorpha Roesler, 1940 | | authority -160394 | Barbatula | | scientific name -162474 | Malasseziales | | scientific name -162474 | Malasseziales R.T. Moore, 1980 | | authority -163125 | Pampus | | scientific name -163611 | Alticorpus | | scientific name -163725 | Dalbergieae | | scientific name -163725 | Dalbergieae Bronn ex DC., 1825 | | authority -163733 | Millettieae | | scientific name -163733 | Millettieae Miq., 1855 | | authority -163735 | Phaseoleae | | scientific name -163735 | Phaseoleae DC., 1925 | | authority -163739 | Euchresteae | | synonym -163739 | Euchresteae H.Ohashi, 1973 | | authority -163739 | Sophoreae | | scientific name -163739 | Sophoreae Spreng. ex DC., 1825 | | authority -163739 | Thermopsideae | | synonym -163739 | Thermopsideae Yakovlev, 1972 | | authority -165250 | Alfalfa latent carlavirus | | equivalent name -165250 | Alfalfa latent virus | | scientific name -165440 | Dioszegia | | scientific name -165440 | Dioszegia Zsolt, 1957 | | authority -165826 | Melon chlorotic leaf curl virus | | scientific name -166052 | Microhylinae | | scientific name -166126 | Seriata | | scientific name -166236 | Bdellouroidea | | scientific name -166243 | Uteriporidae | | scientific name -166244 | Ectoplaninae | | scientific name -166586 | Aedes flavopictus | | scientific name -166586 | Aedes flavopictus Yamada, 1921 | | authority -166784 | Odontobutidae | | scientific name -166784 | freshwater sleepers | | genbank common name -167449 | Gobius lagocephalus | | synonym -167449 | Gobius lagocephalus Pallas, 1770 | | authority -167449 | Sicydium taeniurum | | synonym -167449 | Sicydium taeniurum Guenther, 1877 | | authority -167449 | Sicyopterus lagocephalus | | scientific name -167449 | Sicyopterus lagocephalus (Pallas, 1770) | | authority -167449 | Sicyopterus taeniurus | | synonym -167449 | Sicyopterus taeniurus (Guenther, 1877) | | authority -168496 | Buddleja albiflora var. hemsleyana | | scientific name -168496 | Buddleja albiflora var. hemsleyana (Koehne) C.K.Schneid., 1912 | | authority -168496 | Buddleja hemsleyana | | synonym -168496 | Buddleja hemsleyana Koehne, 1903 | | authority -168834 | Jeffersonia dubia | | synonym -168834 | Jeffersonia dubia (Maxim.) Benth. & Hook. f. ex Baker & Moore | | authority -168834 | Plagiorhegma dubium | | scientific name -168834 | Plagiorhegma dubium Maxim., 1859 | | authority -169417 | Lutrinae | | scientific name -169618 | Ixoroideae | | scientific name -169626 | Condamineeae | | scientific name -170325 | CaHV-1 | | acronym -170325 | Canid alphaherpesvirus 1 | | scientific name -170325 | Canid alphaherpesvirus type 1 | | equivalent name -170325 | Canid herpesvirus 1 | | equivalent name -170325 | Canine herpesvirus | | equivalent name -170325 | Canine herpesvirus 1 | | equivalent name -170325 | canine herpesvirus CHV | | equivalent name -171627 | Fusarium fujikuroi species complex | | scientific name -171627 | Gibberella fujikuroi complex | | synonym -171638 | Rosoideae | | scientific name -171788 | Fulcaldea | | scientific name -171788 | Fulcaldea Poir. | | authority -171944 | Mangifera sylvatica | | scientific name -171944 | Mangifera sylvatica Roxb., 1824 | | authority -171944 | Nepal mango | | common name -172915 | Saurogobio | | scientific name -172976 | Ceramium longissimum | | synonym -172976 | Fucus longissimus | | synonym -172976 | Fucus longissimus S.G.Gmelin, 1768 | | authority -172976 | Gracilaria verrucosa | | synonym -172976 | Gracilaria verrucosa (Hudson) Papenfuss 1950 | | authority -172976 | Gracilariopsis longissima | | scientific name -172976 | Gracilariopsis longissima (S.G.Gmelin) M.Steentoft, L.M.Irvine & W.F.Farnham 1995 | | authority -173087 | Human papillomavirus types | | scientific name -175121 | Passeroidea | | scientific name -175529 | Amazona guildingii | | scientific name -175529 | Psittacus guildingii | | synonym -175529 | Psittacus guildingii Vigors, 1837 | | authority -176938 | Alcedo aenea | | synonym -176938 | Alcedo aenea Pallas, 1764 | | authority -176938 | American pygmy kingfisher | | genbank common name -176938 | Chloroceryle aenea | | scientific name -178830 | Bornaviridae | | scientific name -178941 | Arytainilla | | scientific name -178941 | Arytainilla Loginova, 1972 | | authority -178948 | Arytaina spartii | | synonym -178948 | Arytaina spartii Guerin-Meneville, 1842 | | authority -178948 | Arytainilla spartiophila | | scientific name -178948 | Arytainilla spartiophila (Foerster, 1848) | | authority -178948 | broom psyllid | | genbank common name -180252 | Mardivirus | | scientific name -180252 | Marek's disease-like viruses | | equivalent name -180950 | Tricholomella | | scientific name -180950 | Tricholomella Zerova ex Kalamees, 1992 | | authority -181089 | Aethopyga | | scientific name -181124 | Agaricus oreades | | synonym -181124 | Agaricus oreades Bolton, 1791 | | authority -181124 | Marasmius oreades | | scientific name -181124 | Marasmius oreades (Bolton) Fr., 1836 | | authority -181124 | Scotch bonnet mushroom | | common name -181124 | fairy-ring Marasmius | | genbank common name -181762 | Psilocybe cubensis | | scientific name -181762 | Psilocybe cubensis (Earle) Singer, 1948 | | authority -181762 | Stropharia cubensis | | synonym -181762 | Stropharia cubensis Earle, 1906 | | authority -181762 | magic mushroom | | common name -182093 | unclassified Vesivirus | | scientific name -182724 | Laternulidae | | scientific name -182725 | Laternula | | scientific name -183385 | Hydroporini | | scientific name -183963 | "Halomebacteria" Cavalier-Smith 1986 | "Halomebacteria" Cavalier-Smith 1986 | authority -183963 | Halobacteria | | scientific name -183963 | Halobacteria Grant et al. 2002 | | synonym -183963 | Halobacteria Grant et al. 2002 emend. Gupta et al. 2015 | | authority -183963 | Halomebacteria | Halomebacteria | in-part -183963 | Halomebacteria Cavalier-Smith, 2002 | Halomebacteria Cavalier-Smith, 2002 | authority -184751 | Vitivirus | | scientific name -185002 | Plantago ovata | | scientific name -185002 | Plantago ovata Forssk., 1775 | | authority -185002 | blond plantain | | genbank common name -185002 | blond psyllium | | common name -185002 | desert Indianwheat | | common name -185002 | desert plantain | | common name -185002 | ispaghul | | common name -185751 | Pospiviroidae | | scientific name -185751 | Viroids | Viroids | in-part -185752 | Avsunviroidae | | scientific name -185752 | Viroids | Viroids | in-part -185753 | Pospiviroid | | scientific name -185756 | Apscaviroid | | scientific name -185759 | Pelamoviroid | | scientific name -185786 | tentative aquareoviruses | | equivalent name -185786 | tentative species in the genus Aquareoviruses | | equivalent name -185786 | unclassified Aquareovirus | | scientific name -186121 | Micromus | | scientific name -186458 | Bornavirus | | equivalent name -186458 | Orthobornavirus | | scientific name -186534 | Caulimoviridae | | scientific name -186623 | Actinopteri | | scientific name -186625 | Clupeocephala | | scientific name -186626 | Otophysa | | synonym -186626 | Otophysi | | scientific name -186627 | Cypriniphysae | | scientific name -186627 | Cypriniphysi | | synonym -186634 | Ostarioclupeomorpha | | synonym -186634 | Otocephala | | synonym -186634 | Otomorpha | | scientific name -186766 | Narnaviridae | | scientific name -186767 | Narnavirus | | scientific name -186886 | Pomovirus | | scientific name -186938 | Respirovirus | | scientific name -187214 | Soybean chlorotic mottle-like viruses | | equivalent name -187214 | Soymovirus | | scientific name -190729 | Begomovirus-associated DNA beta-like sequences | | equivalent name -190729 | Betasatellite | | scientific name -190729 | Betasatellites | | equivalent name -190729 | beta satellites | | equivalent name -190729 | satellite DNA beta | | equivalent name -192204 | Corvoidea | | scientific name -192380 | Monochamini | | scientific name -192381 | Monochamus | | scientific name -192382 | Japanese pine sawyer | | genbank common name -192382 | Japanese pine sawyer beetle | | common name -192382 | Monochamus alternatus | | scientific name -192382 | Monochamus alternatus Hope, 1842 | | authority -193267 | Mnais tenuis | | scientific name -193267 | Mnais tenuis Oguma, 1913 | | authority -194960 | Kobuvirus | | scientific name -195059 | Datura yellow vein nucleorhabdovirus | | scientific name -195059 | Datura yellow vein virus | | equivalent name -195633 | Pleuronichthys | | scientific name -195798 | Cladonia rangiferina subsp. rangiferina | | scientific name -197056 | Cladonia rangiferina subsp. abbayesii | | scientific name -197056 | Cladonia rangiferina subsp. abbayesii (Ahti) Ahti & DePriest, 2001 | | authority -197112 | Pear latent virus | | scientific name -197112 | Pear redleaf-associated virus | | synonym -197562 | Pancrustacea | | scientific name -197563 | Mandibulata | | scientific name -197563 | mandibulates | | common name -197613 | Rosa chinensis f. spontanea | | synonym -197613 | Rosa chinensis f. spontanea Rehder & E.H.Wilson, 1815 | | authority -197613 | Rosa chinensis var. spontanea | | scientific name -197613 | Rosa chinensis var. spontanea (Rehder & E.H.Wilson) T.T.Yu & T.C.Ku, 1985 | | authority -197613 | Rosa odorata var. spontanea | | synonym -198607 | Double stranded RNA satellites | | scientific name -198607 | Double-stranded RNA satellites | | equivalent name -198607 | Double-stranded satellite RNAs | | equivalent name -198625 | Eccrinales | | includes -198625 | Ichthyophonida | | scientific name -201863 | Phocine distemper virus 1 | | scientific name -203261 | Epinephelus bleekeri | | scientific name -203261 | Epinephelus bleekeri (Vaillant, 1878) | | authority -203261 | Serranus bleekeri | | synonym -203261 | Serranus bleekeri Vaillant, 1878 | | authority -203261 | duskytail grouper | | genbank common name -205083 | Dreissena rostriformis | | scientific name -205083 | Mytilus rostriformis | | synonym -205083 | Mytilus rostriformis Deshayes, 1838 | | authority -211557 | Apachyidae | | scientific name -211558 | Apachyus | | scientific name -211567 | Apachyoidea | | scientific name -214437 | Spizaetus | | scientific name -215788 | Limenitidini | | scientific name -216794 | Plantagineae | | scientific name -216795 | Veroniceae | | scientific name -216806 | Buddlejeae | | scientific name -216806 | Buddlejeae Bartl., 1830 | | authority -216812 | Scrophularieae | | scientific name -217160 | Ampelovirus | | scientific name -219103 | Carduoideae | | scientific name -219103 | Carduoideae Cass. ex Sweet, 1826 | | authority -220121 | Macrophthaimus diiatatus | | synonym -220121 | Macrophthalmus (Macrophthalmus) abbreviatus | | synonym -220121 | Macrophthalmus abbreviatus | | scientific name -220121 | Macrophthalmus abbreviatus Manning & Holthuis, 1981 | | authority -220121 | Macrophthalmus dilatatus | | synonym -220121 | Ocypode (Macrophthalmus) dilatata | | synonym -220121 | Ocypode dilatata | | synonym -220121 | Ocypode dilatata De Haan, 1835 | | authority -222078 | Ageratum yellow vein China virus - [Hn2] | | scientific name -222078 | Ageratum yellow vein China virus-[Hn2] | | equivalent name -222543 | Hypocreomycetidae | | scientific name -222543 | mitosporic Hypocreomycetidae | | includes -222544 | Sordariomycetidae | | scientific name -222556 | unclassified Nodaviridae | | scientific name -223251 | Soybean crinkle leaf virus-[Japan] | | scientific name -223286 | Melon chlorotic leaf curl virus-[Guatemala] | | scientific name -223769 | Grapevine Anatolian ringspot virus | | scientific name -224510 | Iberoporus | | scientific name -225962 | Sweet potato virus Y | | scientific name -226102 | Aconitum contortum | | scientific name -226102 | Aconitum contortum Finet & Gagnep., 1904 | | authority -227307 | Gyrovirus | | scientific name -228457 | Anatina elliptica | | synonym -228457 | Anatina elliptica King, 1832 | | authority -228457 | Laternula elliptica | | scientific name -228657 | Echinosophora | | scientific name -228657 | Echinosophora Nakai, 1923 | | authority -228658 | Echinosophora koreensis | | scientific name -228658 | Echinosophora koreensis Nakai, 1923 | | authority -228658 | Sophora koreensis | | synonym -229219 | Blastomyces | | scientific name -229219 | Blastomyces Gilchrist & W.R. Stokes, 1898 | | authority -229219 | Emmonsia | | synonym -229219 | Emmonsia Cif. & Montemart., 1959 | | authority -231932 | Peniophora carnosa | | synonym -231932 | Peniophora carnosa Burt, 1926 | | authority -231932 | Phanerochaete carnosa | | scientific name -231932 | Phanerochaete carnosa (Burt) Parmasto, 1967 | | authority -232347 | Magnoliidae | | scientific name -232347 | Magnoliidae Novak ex Takht., 1967 | | authority -232347 | magnoliids | | equivalent name -232795 | Dicistroviridae | | scientific name -232799 | Iflavirus | | scientific name -232799 | Infectious flachery-like viruses | | equivalent name -233784 | Grapevine deformation virus | | scientific name -234792 | Chinese lizard gudgeon | | genbank common name -234792 | Saurogobio dabryi | | scientific name -234792 | Saurogobio dabryi Bleeker, 1871 | | authority -240201 | Burhinus bistriatus | | scientific name -240201 | Charadrius bistriatus | | synonym -240201 | Charadrius bistriatus Wagler, 1829 | | authority -240201 | Hesperoburhinus bistriatus | | synonym -240201 | Hesperoburhinus bistriatus (Wagler, 1829) | | authority -241749 | Arremon | | scientific name -241750 | Arremon aurantiirostris | | scientific name -241750 | Arremon aurantiirostris Lafresnaye, 1847 | | authority -241750 | orange-billed sparrow | | genbank common name -241751 | Arremon aurantiirostris rufidorsalis | | scientific name -241751 | Arremon rufidorsalis | | synonym -241751 | Arremon rufidorsalis Cassin, 1865 | | authority -241778 | Apioideae | | scientific name -241778 | Apioideae Seem., 1866 | | authority -241780 | apioid superclade | | scientific name -241785 | Bupleureae | | scientific name -241785 | Bupleureae Spreng., 1820 | | authority -241792 | Angelica + Arracacia clade | | equivalent name -241792 | Selineae | | scientific name -241792 | Selineae Spreng., 1820 | | authority -241932 | Trophis | | scientific name -241932 | Trophis P. Browne | | authority -246410 | Coccidioides immitis RS | | scientific name -249184 | Tymoviridae | | scientific name -249185 | Maculavirus | | scientific name -249310 | Chrysoviridae | | scientific name -249588 | Mamastrovirus | | scientific name -251095 | Nanoviridae | | scientific name -252798 | Falco tyrannus | | synonym -252798 | Falco tyrannus Wied-Neuwied, 1820 | | authority -252798 | Spizaetus tyrannus | | scientific name -252798 | black hawk-eagle | | genbank common name -255330 | Ipomoea vein mosaic virus | | scientific name -257883 | Myotis evotis | | scientific name -257883 | Vespertilio evotis | | synonym -257883 | Vespertilio evotis Allen, 1864 | | authority -257883 | long-eared Myotis | | genbank common name -260377 | Tomato yellow leaf curl Mali virus | | scientific name -263002 | Ageratum yellow vein virus-[Tomato] | | scientific name -265123 | Quarantine #1146 potyvirus | | scientific name -265963 | Viroids | Viroids | in-part -265963 | unclassified viroids | | scientific name -268499 | Crambidae | | scientific name -268499 | Crambiidae | | synonym -268499 | grass moths | | genbank common name -270256 | Eggplant mottled crinkle virus | | scientific name -272620 | Klebsiella pneumoniae MCG 78578 | | equivalent name -272620 | Klebsiella pneumoniae str. MCG 78578 | | equivalent name -272620 | Klebsiella pneumoniae subsp. pneumoniae ATCC 700721 | | synonym -272620 | Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | | scientific name -272620 | Klebsiella pneumoniae subsp. pneumoniae str. MGH 78578 | | equivalent name -272620 | Klebsiella pneumoniae subsp. pneumoniae strain MGH 78578 | | equivalent name -274794 | Epinephelinae | | scientific name -278169 | Cobitinae | | scientific name -278171 | Nemacheilidae | | scientific name -278171 | Nemacheilinae | | synonym -278205 | Myida | | scientific name -278205 | Myoida | | synonym -283494 | Begomovirus-associated DNA 1-like sequences | | equivalent name -283494 | Begomovirus-associated alphasatellites | | equivalent name -283494 | Geminialphasatellitinae | | scientific name -287184 | Chalcosiinae | | scientific name -287195 | Salvelinus leucomaenis japonicus | | scientific name -290090 | Sida yellow mosaic China virus - [Hainan 8] | | scientific name -290090 | Sida yellow mosaic virus-[China] | | equivalent name -290849 | Human astrovirus GGH-2004 | | scientific name -291027 | unclassified Begomovirus | | scientific name -291027 | unclassified begomoviruses | | equivalent name -291286 | Euphorbia ringspot virus | | scientific name -292474 | Ageratum yellow vein virus-[Tomato2] | | scientific name -292479 | Ageratum yellow vein virus-[Indonesia] | | scientific name -293500 | Zantedeschieae | | scientific name -294824 | Lepturini | | scientific name -299071 | Ajellomycetaceae | | scientific name -299071 | Ajellomycetaceae Unter., J.A. Scott & Sigler, 2004 | | authority -299368 | Evergestinae | | scientific name -301920 | Popenaias | | scientific name -301921 | Popenaias popeii | | scientific name -301921 | Texas hornshell mussel | | common name -301921 | Unio popeii | | synonym -301921 | Unio popeii Lea, 1857 | | authority -306901 | Chaetomium globosum CBS 148.51 | | scientific name -307635 | Spizaetus tyrannus serus | | scientific name -307635 | Spizaetus tyrannus serus Friedmann, 1950 | | authority -310684 | Cheravirus | | scientific name -311227 | Mycoreovirus | | scientific name -311900 | Conurus rupicola | | synonym -311900 | Conurus rupicola Tschudi, 1844 | | authority -311900 | Pyrrhura rupicola | | scientific name -311900 | Pyrrhura rupicola (Tschudi, 1844) | | authority -311900 | black-capped parakeet | | genbank common name -314145 | Laurasiatheria | | scientific name -314146 | Euarchontoglires | | scientific name -314147 | Glires | | scientific name -314147 | Rodents and rabbits | | genbank common name -315357 | Ageratum yellow vein virus-[Tomato3] | | scientific name -315838 | Aulacidae | | scientific name -315840 | Pristaulacus | | scientific name -318529 | Heroini | | scientific name -318546 | Pseudocrenilabrinae | | scientific name -318559 | Cichlasomatinae | | scientific name -319056 | New World cichlids | | scientific name -319058 | Haplochromini | | scientific name -319095 | African cichlids | | scientific name -320454 | Symphysodon aequifasciata aequifasciata | | scientific name -320454 | Symphysodon aequifasciata aequifasciata Pellegrin, 1904 | | authority -320454 | Symphysodon aequifasciatus aequifasciatus | | synonym -320455 | Symphysodon aequifasciata axelrodi | | scientific name -320455 | Symphysodon aequifasciata axelrodi Schultz, 1960 | | authority -320455 | Symphysodon aequifasciatus axelrodi | | synonym -321084 | Circaetus gallicus pectoralis | | synonym -321084 | Circaetus pectoralis | | scientific name -321084 | Circaetus pectoralis Smith, 1829 | | authority -321084 | Circaetus pectoralis Smith,A, 1829 | | authority -321084 | black-chested snake-eagle | | genbank common name -321263 | Myotis auriculus | | scientific name -321263 | Myotis auriculus Baker & Stains, 1955 | | authority -321263 | Myotis evotis auriculus | | synonym -321263 | Myotis evotis auriculus Baker & Stains, 1955 | | authority -321263 | Southwestern Myotis | | genbank common name -323096 | Bambusa ventricosa | | scientific name -323096 | Bambusa ventricosa McClure, 1938 | | authority -323096 | Buddha bamboo | | common name -323096 | Buddha belly bamboo | | genbank common name -323096 | tu tu chu | | common name -323895 | Chusquea culeou | | scientific name -323895 | Chusquea culeou E.Desv., 1854 | | authority -324901 | Marnaviridae | | scientific name -325454 | Deltapapillomavirus | | scientific name -325455 | Gammapapillomavirus | | scientific name -325456 | Iotapapillomavirus | | scientific name -325459 | Epsilonpapillomavirus | | scientific name -325461 | Omikronpapillomavirus | | scientific name -327045 | Orthoretrovirinae | | scientific name -327107 | unclassified Maculavirus | | scientific name -327375 | unclassified Carlavirus | | scientific name -327387 | Tropical soda apple mosaic virus | | scientific name -327770 | Epinephelus tukula | | scientific name -327770 | Epinephelus tukula Morgans, 1959 | | authority -327770 | potato grouper | | genbank common name -328429 | unclassified Polerovirus | | scientific name -328527 | Gnathopogon | | scientific name -329860 | Coliphage ID2 | | equivalent name -329860 | Enterobacteria phage ID2 | | scientific name -330383 | unassigned Tymoviridae | | equivalent name -330383 | unclassified Tymoviridae | | scientific name -333774 | unclassified Papillomaviridae | | scientific name -333921 | Xipapillomavirus | | scientific name -333938 | non-primate mammal papillomaviruses | | scientific name -334425 | Lisianthus necrosis virus | | scientific name -334873 | Chinese silver pomfret | | genbank common name -334873 | Pampus chinensis | | scientific name -334873 | Pampus chinensis (Euphrasen, 1788) | | authority -334873 | Stromateus chinensis | | synonym -334873 | Stromateus chinensis Euphrasen, 1788 | | authority -336476 | unclassified Iflavirus | | scientific name -336633 | unclassified Cripavirus | | scientific name -336635 | unassigned Dicistroviridae | | equivalent name -336635 | unclassified Dicistroviridae | | scientific name -336987 | Tobacco leaf curl Cuba virus | | scientific name -337052 | Deltapapillomavirus 4 | | scientific name -337687 | Muroidea | | scientific name -338153 | Pantherinae | | scientific name -339076 | Chiloschista parishii | | scientific name -339076 | Chiloschista parishii Seidenf., 1988 | | authority -341117 | Misgurnus bipartitus | | scientific name -341117 | Misgurnus bipartitus (Sauvage & Dabry de Thiersant, 1874) | | authority -341117 | Nemacheilus bipartitus | | synonym -341117 | Nemacheilus bipartitus Sauvage & Dabry de Thiersant, 1874 | | authority -341128 | Barbatula barbatula nuda | | synonym -341128 | Barbatula nuda | | scientific name -341128 | Barbatula nuda (Bleeker, 1864) | | authority -341128 | Nemacheilus nudus | | synonym -341128 | Nemacheilus nudus Bleeker, 1864 | | authority -341128 | Orthrias nudus | | synonym -344417 | unclassified Aquabirnavirus | | scientific name -345249 | unclassified Circovirus | | scientific name -346391 | Ageratum yellow vein virus-Pakistan | | scientific name -347957 | unclassified Betaretrovirus | | scientific name -351425 | unclassified Foveavirus | | scientific name -351426 | Asian prunus virus 2 | | scientific name -351428 | Asian prunus virus 3 | | scientific name -352235 | unclassified Thogotovirus | | scientific name -352926 | unclassified Astroviridae | | scientific name -352927 | unclassified Crinivirus | | scientific name -353154 | Theileria annulata Ankara clone C9 | | synonym -353154 | Theileria annulata strain Ankara | | scientific name -353769 | unclassified Gammaretrovirus | | scientific name -354837 | Celaenorrhinus | | scientific name -354837 | Celaenorrhinus Hubner, 1819 | | authority -355688 | Agaricomycetes incertae sedis | | scientific name -355688 | Homobasidiomycetes incertae sedis | | includes -357852 | Angelica likiangensis | | scientific name -357852 | Angelica likiangensis H.Wolff, 1930 | | authority -358814 | Daurian redstart | | genbank common name -358814 | Motacilla aurorea | | synonym -358814 | Motacilla aurorea Pallas, 1776 | | authority -358814 | Phoenicurus auroreus | | scientific name -358814 | Phoenicurus auroreus (Pallas, 1776) | | authority -359160 | BEP clade | | equivalent name -359160 | BOP clade | | scientific name -359505 | Bupleurum angustissimum | | scientific name -359505 | Bupleurum angustissimum (Franch.) Kitag., 1947 | | authority -359505 | Bupleurum falcatum var. angustissimum | | synonym -359505 | Bupleurum falcatum var. angustissimum Franch., 1884 | | authority -361688 | Single stranded DNA satellites | | scientific name -361688 | ssDNA satellites | | equivalent name -361688 | unclassified Single stranded DNA satellites | | equivalent name -361688 | unclassified ssDNA satellites | | equivalent name -364270 | Apiineae | | scientific name -364270 | Apiineae Plunkett & Lowry, 2004 | | authority -367188 | Haladaptatus | | scientific name -367188 | Haladaptatus Savage et al. 2007 | | authority -367188 | Haladaptatus Savage et al. 2007 emend. Cui et al. 2010 | | authority -367188 | Haladaptatus Savage et al. 2007 emend. Roh et al. 2010 | | authority -367682 | Narcissus symptomless virus | | scientific name -368620 | Cherry small circular viroid-like RNA 1 | | scientific name -368620 | cscRNA1 | | equivalent name -369752 | Catharanthus mosaic virus | | scientific name -371833 | unclassified Sapovirus | | scientific name -371917 | Corvus columbianus | | synonym -371917 | Corvus columbianus Wilson, 1811 | | authority -371917 | Nucifraga columbiana | | scientific name -375141 | Camallanidae | | scientific name -375142 | Camallanus | | scientific name -375143 | Camallanus cotti | | scientific name -375143 | Camallanus cotti Fujita, 1927 | | authority -376274 | Homotomidae | | synonym -376274 | Homotominae | | scientific name -376275 | Carsidaridae | | scientific name -377833 | Cubitermes group | | scientific name -377833 | Cubitermitinae | | synonym -379583 | Feliformia | | scientific name -379584 | Caniformia | | scientific name -384633 | Atacama myotis | | genbank common name -384633 | Myotis atacamensis | | scientific name -384633 | Vespertilio atacamensis | | synonym -384633 | Vespertilio atacamensis Lataste, 1892 | | authority -388435 | Lecanoromycetidae | | scientific name -391337 | Tomato yellow leaf curl Mali virus-[Ethiopia] | | scientific name -396331 | Bjerkanderaceae | | synonym -396331 | Hapalopilaceae | | synonym -396331 | Phanerochaetaceae | | scientific name -396331 | Phanerochaetaceae Julich, 1982 | | authority -397273 | Suaeda malacosperma | | scientific name -397273 | Suaeda malacosperma H.Hara, 1942 | | authority -398816 | Tobacco leaf curl Cuba virus - [Jamaica] | | scientific name -399178 | Panthera onca mesembrina | | scientific name -399178 | Patagonian panther | | genbank common name -399254 | Aacanthocnema | | scientific name -399254 | Aacanthocnema Tuthill & Taylor, 1955 | | authority -399255 | Aacanthocnema dobsoni | | scientific name -399255 | Trioza dobsoni | | synonym -399255 | Trioza dobsoni Froggatt, 1903 | | authority -404260 | Bryophytina | | scientific name -404260 | Moss Superclass V | | includes -404297 | Bryanae | | scientific name -404297 | Bryanae (Engl.) Goffinet & W.R.Buck | | authority -405558 | Arracacha mottle virus | | scientific name -410297 | Gerbilliscus | | scientific name -410302 | Bushveld gerbil | | genbank common name -410302 | Gerbilliscus leucogaster | | scientific name -410302 | Tatera leucogaster | | synonym -410302 | bushveld gerbil | | common name -410830 | Trichomonascaceae | | scientific name -410830 | Trichomonascaceae Kurtzman & Robnett, 2007 | | authority -413970 | Anulavirus | | scientific name -416867 | Notospermus | | scientific name -416868 | Lineus geniculatus | | synonym -416868 | Notospermus geniculatus | | scientific name -416868 | Notospermus geniculatus (Delle Chiaje, 1822) | | authority -416868 | Polia geniculata | | synonym -416868 | Polia geniculata Delle Chiaje, 1822 | | authority -418101 | Plasmodium (Vinckeia) | | scientific name -418101 | Vinckeia | | synonym -418103 | Plasmodium | Plasmodium | synonym -418103 | Plasmodium (Plasmodium) | | scientific name -420948 | Aetobatus flagellum | | scientific name -420948 | Aetobatus flagellum (Bloch & Schneider, 1801) | | authority -420948 | Raja flagellum | | synonym -420948 | Raja flagellum Bloch & Schneider, 1801 | | authority -420948 | longheaded eagle ray | | genbank common name -421010 | HiMV | | acronym -421010 | Hippeastrum mosaic virus | | scientific name -421921 | Philodendroideae | | scientific name -421921 | Philodendroideae Engl., 1876 | | authority -422676 | Aconoidasida | | scientific name -422676 | Aconoidasida Mehlhorn et al. 1980 | | authority -422676 | Hematozoa Vivier 1982 | | synonym -423054 | Eimeriorina | | scientific name -423369 | NHMW:91214 | NHMW:91214 | type material -423369 | NMW:91214 | NMW:91214 | type material -423369 | NMW:91214 | NMW:91214 | type material -423369 | Salmo leucomaenis leucomaenis | | synonym -423369 | Salmo leucomaenis leucomaenis Pallas, 1814 | | authority -423369 | Salvelinus leucomaenis leucomaenis | | scientific name -423369 | ZMB:23552 | ZMB:23552 | type material -423369 | ZMB:23563 | ZMB:23563 | type material -423370 | Salvelinus leucomaenis imbrius | | scientific name -423370 | Salvelinus leucomaenis imbrius Jordan & McGregor, 1925 | | authority -425264 | Malassezia restricta CBS 7877 | | scientific name -427924 | Dreissena bugensis | | synonym -427924 | Dreissena bugensis var. profunda | | synonym -427924 | Dreissena rostriformis bugensis | | scientific name -427924 | Dreissena rostriformis bugensis Andrusov, 1897 | | authority -427924 | Dreissena rostriformis bugensis var. profunda | | synonym -427924 | guagga mussel | | common name -427924 | quagga mussel | | genbank common name -431037 | unclassified Roseolovirus | | scientific name -433372 | Spizaetus tyrannus tyrannus | | scientific name -435738 | Camallanoidea | | scientific name -436486 | Dinosauria | | scientific name -436486 | dinosaurs | | common name -436489 | Saurischia | | scientific name -436491 | Theropoda | | scientific name -436492 | Coelurosauria | | scientific name -437064 | Ageratum yellow vein virus- [Taiwan:Taoyuan3:2000] | | equivalent name -437064 | Ageratum yellow vein virus-[Taiwan:Taoyuan3:2000] | | scientific name -437489 | Striacosta | | scientific name -437490 | Richia albicosta | | synonym -437490 | Striacosta albicosta | | scientific name -437490 | Striacosta albicosta (Smith, 1888) | | authority -437490 | western bean cutworm | western bean cutworm | genbank common name -439490 | unassigned ssRNA viruses | | equivalent name -439490 | unclassified ssRNA viruses | | scientific name -441227 | Isophya | | scientific name -441892 | Alaria crispa | | scientific name -441892 | Alaria crispa Kjellman, 1889 | | authority -442243 | Lelecella | | scientific name -442302 | Porcine picobirnavirus | | scientific name -442316 | Herona | | scientific name -445316 | Pseudohelice | | scientific name -446318 | Ageratum yellow vein virus-Ishigaki | | scientific name -447093 | Ajellomyces capsulatus G186AR | | synonym -447093 | Histoplasma capsulatum G186AR | | scientific name -450882 | Taxus fuana | | scientific name -450882 | Taxus fuana Nan Li & R.R.Mill, 1997 | | authority -451864 | Dikarya | | scientific name -451871 | Eurotiomycetidae | | scientific name -452284 | Ustilaginomycotina | | scientific name -452284 | Ustilaginomycotina Doweld, 2001 | | authority -452284 | smut fungi & allies | smut fungi & allies | blast name -452284 | smut fungi & allies | smut fungi & allies | common name -452333 | Agaricomycetidae | | scientific name -453050 | Sweet potato virus 2 | | scientific name -456398 | Chasmagnathus subquadratus | | synonym -456398 | Chasmagnathus subquadratus Dana, 1851 | | authority -456398 | Pseudohelice subquadrata | | scientific name -456398 | Pseudohelice subquadrata (Dana, 1851) | | authority -461132 | Lelecella limenitoides | | scientific name -461132 | Lelecella limenitoides (Oberthur, 1890) | | authority -461132 | Vanessa limenitoides | | synonym -461132 | Vanessa limenitoides Oberthur, 1890 | | authority -464095 | Picornavirales | | scientific name -464925 | environmental samples | environmental samples | scientific name -469369 | Ocinara | | scientific name -473626 | Barbitistini | | scientific name -473674 | Poecilimon birandi | | synonym -473674 | Poecilimon birandi Karabag, 1950 | | authority -473674 | Poecilimon luschani birandi | | scientific name -473674 | Poecilimon luschani birandi Karabag, 1950 | | authority -473713 | Poecilimon luschani | | scientific name -473713 | Poecilimon luschani Ramme, 1933 | | authority -473783 | unclassified Umbravirus | | scientific name -473784 | Opium poppies mosaic virus | | equivalent name -473784 | Opium poppy mosaic umbravirus | | equivalent name -473784 | Opium poppy mosaic virus | | scientific name -474943 | Cordycipitaceae | | scientific name -474943 | Cordycipitaceae Kreisel ex G.H. Sung, J.M. Sung, Hywel-Jones & Spatafora, 2007 | | authority -474943 | mitosporic Cordycipitaceae | | includes -475272 | Ernolatia | | scientific name -475273 | Ernolatia moorei | | scientific name -475273 | Ernolatia moorei (Hutton, 1865) | | authority -475273 | Ocinara moorei | | synonym -475273 | Ocinara moorei Hutton, 1865 | | authority -475327 | Bombycinae | | scientific name -475347 | Prismosticta | | scientific name -475348 | Prismosticta fenestrata | | scientific name -475348 | Prismosticta fenestrata Butler, 1880 | | authority -478825 | unclassified Picornaviridae | | scientific name -481315 | Leporid alphaherpesvirus 4 | | scientific name -481315 | Leporid herpesvirus 4 | | equivalent name -484021 | Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 | | scientific name -484021 | Klebsiella pneumoniae subsp. pneumoniae str. NTUH-K2044 | | equivalent name -484021 | Klebsiella pneumoniae subsp. pneumoniae strain NTUH-K2044 | | equivalent name -485724 | Melon severe mosaic tospovirus | | equivalent name -485724 | melon severe mosaic virus | | scientific name -490134 | Hepatitis B virus Woolly monkey/Louisville | | scientific name -490134 | Woolly monkey hepatitis B virus (isolate Louisville) | | equivalent name -493796 | Human astrovirus Hu/CMH053/01/2001/THA | | scientific name -493797 | Human astrovirus Hu/CMH074/01/2001/THA | | scientific name -493798 | Human astrovirus Hu/CMH259/01/2001/THA | | scientific name -493799 | Human astrovirus Hu/CMH265/00/2000/THA | | scientific name -493800 | Human astrovirus Hu/CMH350/02/2002/THA | | scientific name -493801 | Human astrovirus Hu/CMH352/02/2002/THA | | scientific name -493802 | Human astrovirus Hu/CMH362/01/2001/THA | | scientific name -494651 | Bovine hokovirus | | equivalent name -494651 | Bovine hokovirus 1 | | scientific name -497220 | Gobionellinae | | scientific name -497679 | Sicydiinae | | scientific name -498257 | Verticillium dahliae VdLs.17 | | scientific name -501251 | Ageratum yellow vein virus - [G129] | | scientific name -501252 | Ageratum yellow vein virus - [G130] | | scientific name -504568 | Salmoninae | | scientific name -504568 | trouts, salmons & chars | | genbank common name -516546 | Cirsium japonicum | | scientific name -516546 | Cirsium japonicum DC., 1838 | | authority -526119 | unclassified Mamastrovirus | | scientific name -535378 | Dytiscoidea | | scientific name -535382 | Caraboidea | | scientific name -535600 | unclassified Parvoviridae | | scientific name -538002 | Cordyceps militaris cf. var. sphaerocephala MRCIF64 | | scientific name -547124 | unclassified Mycoreovirus | | scientific name -547455 | Paspalum virgatum | | scientific name -547455 | Paspalum virgatum L., 1759 | | authority -548681 | Herpesvirales | | scientific name -548688 | Percavirus | | scientific name -552816 | Engaeus lengana | | scientific name -552816 | Engaeus lengana Horwitz, 1990 | | authority -554155 | Arthroderma otae CBS 113480 | | synonym -554155 | Microsporum canis CBS 113480 | | scientific name -554155 | Microsporum canis CBS113480 | | synonym -558016 | Alphabaculovirus | | scientific name -558016 | Nucleopolyhedrovirus | Nucleopolyhedrovirus | in-part -558017 | Betabaculovirus | | scientific name -558017 | GV | | acronym -558017 | Granulosis viruses | | equivalent name -558017 | Granulovirus | | equivalent name -558690 | Cucurbit chlorotic yellows virus | | scientific name -559297 | Ajellomyces dermatitidis ER-3 | | synonym -559297 | Blastomyces dermatitidis ER-3 | | scientific name -559298 | Ajellomyces dermatitidis SLH#14081 | | equivalent name -559298 | Ajellomyces dermatitidis SLH14081 | | equivalent name -559298 | Blastomyces dermatitidis SLH14081 | | equivalent name -559298 | Blastomyces gilchristii SLH14081 | | scientific name -559305 | Trichophyton rubrum CBS 118892 | | scientific name -560253 | Letharia lupina | | scientific name -560253 | Letharia lupina Altermann, Goward & Leavitt, 2016 | | authority -560253 | Letharia sp. Altermann EP3a | | includes -560253 | Letharia sp. SA-2008b | | includes -560253 | UC 2049992 | UC 2049992 | type material -564644 | Endornaviridae | | scientific name -569360 | Fusarium graminearum species complex | | includes -569360 | Fusarium sambucinum species complex | | scientific name -569578 | PX clade | | scientific name -569578 | algae | algae | in-part -570949 | Carrot mottle mimic virus satellite RNA | | scientific name -570950 | Carrot mottle virus satellite RNA | | scientific name -578617 | Porcine kobuvirus swine/2007/CHN | | scientific name -584378 | Aegosomatini | | scientific name -585893 | Picobirnaviridae | | scientific name -590647 | Nariva virus | | scientific name -590745 | Mus musculus mobilized endogenous polytropic provirus | | scientific name -626155 | Human astrovirus 1 Beijing/04/2006/CHN | | scientific name -626156 | Human astrovirus 1 Beijing/102/2005/CHN | | scientific name -626157 | Human astrovirus 1 Beijing/106/2005/CHN | | scientific name -626158 | Human astrovirus 1 Beijing/110/2007/CHN | | scientific name -626159 | Human astrovirus 1 Beijing/113/2005/CHN | | scientific name -626160 | Human astrovirus 1 Beijing/128/2005/CHN | | scientific name -626161 | Human astrovirus 1 Beijing/134/2005/CHN | | scientific name -626162 | Human astrovirus 1 Beijing/139/2005/CHN | | scientific name -626163 | Human astrovirus 1 Beijing/141/2005/CHN | | scientific name -626164 | Human astrovirus 1 Beijing/176/2006/CHN | | scientific name -626165 | Human astrovirus 1 Beijing/180/2005/CHN | | scientific name -626166 | Human astrovirus 1 Beijing/183/2006/CHN | | scientific name -626167 | Human astrovirus 1 Beijing/189/2005/CHN | | scientific name -626168 | Human astrovirus 1 Beijing/189/2007/CHN | | scientific name -626169 | Human astrovirus 1 Beijing/198/2005/CHN | | scientific name -626170 | Human astrovirus 1 Beijing/204/2005/CHN | | scientific name -626171 | Human astrovirus 1 Beijing/210/2006/CHN | | scientific name -626172 | Human astrovirus 1 Beijing/214/2005/CHN | | scientific name -626173 | Human astrovirus 1 Beijing/234/2005/CHN | | scientific name -626174 | Human astrovirus 1 Beijing/234/2006/CHN | | scientific name -626175 | Human astrovirus 1 Beijing/237/2005/CHN | | scientific name -626176 | Human astrovirus 1 Beijing/239/2005/CHN | | scientific name -626177 | Human astrovirus 1 Beijing/249/2005/CHN | | scientific name -626178 | Human astrovirus 1 Beijing/254/2007/CHN | | scientific name -626179 | Human astrovirus 1 Beijing/287/2005/CHN | | scientific name -626180 | Human astrovirus 1 Beijing/291/2007/CHN | | scientific name -626181 | Human astrovirus 1 Beijing/293/2007/CHN | | scientific name -626182 | Human astrovirus 1 Beijing/309/2007/CHN | | scientific name -626183 | Human astrovirus 1 Beijing/317/2007/CHN | | scientific name -626184 | Human astrovirus 1 Beijing/327/2007/CHN | | scientific name -626185 | Human astrovirus 1 Beijing/330/2007/CHN | | scientific name -626186 | Human astrovirus 1 Beijing/335/2007/CHN | | scientific name -626187 | Human astrovirus 1 Beijing/347/2007/CHN | | scientific name -626188 | Human astrovirus 1 Beijing/352/2007/CHN | | scientific name -626189 | Human astrovirus 1 Beijing/362/2007/CHN | | scientific name -626190 | Human astrovirus 1 Beijing/375/2007/CHN | | scientific name -626191 | Human astrovirus 1 Beijing/377/2007/CHN | | scientific name -626192 | Human astrovirus 1 Beijing/41/2005/CHN | | scientific name -626193 | Human astrovirus 1 Beijing/46/2005/CHN | | scientific name -626194 | Human astrovirus 1 Beijing/60/2007/CHN | | scientific name -626195 | Human astrovirus 1 Beijing/69/2007/CHN | | scientific name -626196 | Human astrovirus 1 Beijing/79/2006/CHN | | scientific name -626197 | Human astrovirus 1 Beijing/82/2007/CHN | | scientific name -626198 | Human astrovirus 6 Beijing/192/2007/CHN | | scientific name -632743 | Human astrovirus 1d | | scientific name -640623 | Aveninae | | scientific name -640623 | Aveninae J.Presl, 1830 | | authority -642248 | unclassified Circoviridae | | scientific name -642994 | Herona marathus | | scientific name -642994 | Herona marathus Doubleday, 1848 | | authority -644269 | Kumanoa | | scientific name -644269 | Kumanoa Entwisle, M.L.Vis, W.B.Chiasson, Necchi & A.R.Sherwood, 2009 | | authority -645133 | Colletotrichum graminicola M1.001 | | scientific name -645133 | Glomerella graminicola M1.001 | | equivalent name -649996 | Tomato yellow leaf distortion virus | | scientific name -650164 | Phanerochaete carnosa HHB-10118-sp | | scientific name -652723 | Porcine kobuvirus THA/2001-2003 | | scientific name -652811 | Human astrovirus 1 Beijing/01/2005/CHN | | scientific name -652812 | Human astrovirus 1 Beijing/06/2006/CHN | | scientific name -652813 | Human astrovirus 1 Beijing/129/2005/CHN | | scientific name -652814 | Human astrovirus 1 Beijing/131/2007/CHN | | scientific name -652815 | Human astrovirus 1 Beijing/228/2005/CHN | | scientific name -652816 | Human astrovirus 1 Beijing/265/2005/CHN | | scientific name -652817 | Human astrovirus 1 Beijing/33/2005/CHN | | scientific name -652818 | Human astrovirus 1 Beijing/333/2007/CHN | | scientific name -652819 | Human astrovirus 1 Beijing/75/2005/CHN | | scientific name -652820 | Human astrovirus 3 Beijing/124/2007/CHN | | scientific name -654128 | Marasmiaceae | | scientific name -654128 | Marasmiaceae Roze ex Kuhner, 1980 | | authority -654128 | mitosporic Marasmiaceae | | includes -667127 | Klebsiella pneumoniae subsp. rhinoscleromatis ATCC 13884 | | scientific name -667127 | Klebsiella pneumoniae subsp. rhinoscleromatis str. ATCC 13884 | | equivalent name -667127 | Klebsiella pneumoniae subsp. rhinoscleromatis strain ATCC 13884 | | equivalent name -667151 | Dicaeum concolor | | scientific name -667151 | Dicaeum concolor Jerdon, 1840 | | authority -667167 | Dicaeidae | | scientific name -667516 | Nakiwogo virus | | scientific name -667725 | Sphaeroforma arctica JP610 | | scientific name -674952 | Trichomonasvirus | | scientific name -674953 | Trichomonas vaginalis virus 1 | | scientific name -674981 | Victorivirus | | scientific name -674996 | Cotton leaf curl Shadadpur virus | | includes -674996 | Cotton leaf curl Shahdadpur virus | | scientific name -675063 | Tymovirales | | scientific name -675064 | Alphaflexiviridae | | scientific name -675064 | Flexiviridae | Flexiviridae | in-part -675068 | Betaflexiviridae | | scientific name -675068 | Flexiviridae | Flexiviridae | in-part -675071 | Virgaviridae | | scientific name -675072 | Comoviridae | | includes -675072 | Secoviridae | | scientific name -675072 | Sequiviridae | | includes -675073 | Torradovirus | | scientific name -675074 | unassigned Picornavirales | | equivalent name -675074 | unclassified Picornavirales | | scientific name -675075 | Comovirinae | | scientific name -675845 | Emaravirus | | scientific name -676044 | Malvastrum yellow vein Honghe virus | | scientific name -676058 | Acropora nobilis | | synonym -676058 | Acropora nobilis (Dana, 1846) | | authority -676058 | Acropora robusta | | scientific name -676058 | Acropora robusta (Dana, 1846) | | authority -676058 | Madrepora robusta | | synonym -676058 | Madrepora robusta Dana, 1846 | | authority -681501 | Olmedia caucana | | synonym -681501 | Olmedia caucana Pittier, 1912 | | authority -681501 | Trophis caucana | | scientific name -681501 | Trophis caucana (Pittier) C.C.Berg, 1988 | | authority -681950 | Glomerellaceae | | scientific name -681950 | Glomerellaceae Locq. ex Seifert & W. Gams, 2007 | | authority -681950 | mitosporic Glomerellaceae | | includes -685445 | Enterobacter aerogenes FGI35 | | synonym -685445 | Enterobacter aerogenes str. FGI35 | | equivalent name -685445 | Enterobacter aerogenes strain FGI35 | | equivalent name -685445 | Enterobacter sp. FGI 35 | | synonym -685445 | Klebsiella aerogenes FGI35 | | scientific name -685899 | Papaya lethal yellowing virus | | scientific name -686565 | Gokushovirinae | | scientific name -686982 | Sapelovirus | | scientific name -687091 | Evergestis | | scientific name -687329 | Anelloviridae | | scientific name -687329 | Anellovirus | | equivalent name -687332 | Betatorquevirus | | scientific name -687339 | Iotatorquevirus | | scientific name -687387 | TTSV1b | | acronym -687387 | Torque teno sus virus 1b | | scientific name -687387 | Torque teno sus virus 2 | | equivalent name -693996 | Alphacoronavirus | | scientific name -693996 | Coronavirus | Coronavirus | in-part -693996 | Coronavirus group 1 | | equivalent name -693996 | Coronavirus group 1b | | includes -693996 | Group 1 species | | equivalent name -693997 | Alphacoronavirus 1 | | scientific name -693997 | Alphacoronavirus-1 | | equivalent name -695850 | Saprolegnia parasitica CBS 223.65 | | scientific name -696855 | Nebovirus | | scientific name -699189 | Iflaviridae | | scientific name -702736 | Chelonid alphaherpesvirus 5 | | scientific name -702736 | Chelonid herpesvirus 5 | | equivalent name -703582 | Porcine kobuvirus swine/K-30-HUN/2008/HUN | | scientific name -706525 | Phocoena phocoena papillomavirus 1 | | scientific name -706526 | Phocoena phocoena papillomavirus 2 | | scientific name -706527 | Phocoena phocoena papillomavirus 4 | | scientific name -706622 | Scaritinae | | scientific name -706663 | Himerometridae | | scientific name -706663 | Zygometridae | | synonym -707741 | Zygometra | | scientific name -715989 | sordariomyceta | | scientific name -716545 | saccharomyceta | | scientific name -716546 | leotiomyceta | | scientific name -735337 | Euheterodonta | | scientific name -735504 | unclassified Gammapapillomavirus | | scientific name -742010 | Carduinae | | scientific name -742010 | Carduinae Dumort., 1827 | | authority -742845 | Malasseziaceae | | scientific name -742845 | Malasseziaceae Denchev & R.T. Moore, 2009 | | authority -742914 | Cyclovirus | | scientific name -742914 | suggested genus Cyclovirus | | equivalent name -748365 | Aspiorhynchus | | scientific name -748366 | Aspiorhynchus laticeps | | scientific name -748366 | Aspiorhynchus laticeps (Day, 1877) | | authority -748366 | Ptychobarbus laticeps | | synonym -748366 | Ptychobarbus laticeps Day, 1877 | | authority -748366 | big-head schizothoracin | | genbank common name -753343 | Histia | | scientific name -759124 | Bhendi yellow vein mosaic alphasatellite | | scientific name -759124 | Bhendi yellow vein mosaic virus alphasatellite | | equivalent name -759804 | Porcine kobuvirus Japan/2009 | | scientific name -763898 | Anastrangalia reyi sequensi | | synonym -763898 | Anastrangalia sequensi | | scientific name -763898 | Anastrangalia sequensi (Reitter, 1898) | | authority -763898 | Anoplodera sequensi | | synonym -763898 | Anoplodera sequensi Li, Chen & Lin, 1981 | | authority -766764 | Debaryomycetaceae | | scientific name -766764 | Debaryomycetaceae Kurtzman & M. Suzuki, 2010 | | authority -766764 | Debaryomycetaceae Kurtzman et M. Suzuki 2010 | | authority -796900 | Kobuvirus pig/Ch-kobu/2008/CHN | | scientific name -796901 | Kobuvirus pig/Ch1/2008/CHN | | scientific name -796902 | Kobuvirus pig/Ch13/2008/CHN | | scientific name -796903 | Kobuvirus pig/Ch14/2008/CHN | | scientific name -796904 | Kobuvirus pig/Ch16/2008/CHN | | scientific name -796905 | Kobuvirus pig/Ch39/2008/CHN | | scientific name -796906 | Kobuvirus pig/Ch4/2008/CHN | | scientific name -796907 | Kobuvirus pig/Ch40/2008/CHN | | scientific name -796908 | Kobuvirus pig/Ch41/2008/CHN | | scientific name -796909 | Kobuvirus pig/Ch5/2008/CHN | | scientific name -796910 | Kobuvirus pig/Ch6/2008/CHN | | scientific name -797075 | Nerine latent virus | | scientific name -861365 | Klebsiella pneumoniae subsp. rhinoscleromatis SB3432 | | scientific name -861365 | Klebsiella pneumoniae subsp. rhinoscleromatis str. SB3432 | | equivalent name -861365 | Klebsiella pneumoniae subsp. rhinoscleromatis strain SB3432 | | equivalent name -861561 | Cyrtanthus elatus virus A | | scientific name -861561 | Vallota speciosa virus - Narcissus/AUS/2008 | | equivalent name -871765 | Porcine TTV 2 | | equivalent name -871765 | Porcine torque teno virus 2 | | scientific name -885375 | Kobuvirus swine/MF8045/2009/KOR | | scientific name -885376 | Kobuvirus swine/MF8047/2009/KOR | | scientific name -886583 | Australasian lineages | | scientific name -906906 | Human astrovirus 1 Tianjin/114/2008/CHN | | scientific name -906907 | Human astrovirus 1 Tianjin/124/2008/CHN | | scientific name -906908 | Human astrovirus 1 Tianjin/133/2008/CHN | | scientific name -906909 | Human astrovirus 1 Tianjin/217/2008/CHN | | scientific name -906910 | Human astrovirus 1 Tianjin/242/2008/CHN | | scientific name -906911 | Human astrovirus 1 Tianjin/499/2008/CHN | | scientific name -906912 | Human astrovirus 1 Tianjin/508/2008/CHN | | scientific name -906913 | Human astrovirus 1 Tianjin/565/2008/CHN | | scientific name -908833 | unclassified Narnavirus | | scientific name -908834 | Grapevine associated narnavirus-1 | | scientific name -911341 | Heliantheae alliance | | scientific name -930979 | Lyophyllaceae | | scientific name -930979 | Lyophyllaceae Julich, 1982 | | authority -935296 | Enterobacter aerogenes EA1509E | | synonym -935296 | Enterobacter aerogenes str. EA1509E | | equivalent name -935296 | Enterobacter aerogenes strain EA1509E | | equivalent name -935296 | Klebsiella aerogenes EA1509E | | scientific name -935650 | Psipapillomavirus | | scientific name -936057 | Rhopapillomavirus | | scientific name -936058 | Upsilonpapillomavirus | | scientific name -938257 | Kobuvirus swine/South Korea/2010 | | scientific name -939922 | unclassified Victorivirus | | scientific name -940834 | Equine papillomavirus 3 | | equivalent name -940834 | Equus caballus papillomavirus 3 | | scientific name -941259 | Klebsiella pneumoniae U-0608239 | | scientific name -941259 | Klebsiella pneumoniae str. U-0608239 | | equivalent name -941259 | Klebsiella pneumoniae strain U-0608239 | | equivalent name -943329 | Angelica longicaudata | | scientific name -943329 | Angelica longicaudata C.Q.Yuan & R.H.Shan, 1985 | | authority -944994 | Hollyhock yellow vein mosaic virus | | scientific name -977912 | Orsay nodavirus | | equivalent name -977912 | Orsay virus | | scientific name -983644 | Cordyceps militaris CM01 | | scientific name -988644 | ssRNA negative-strand viruses | | equivalent name -988644 | unassigned ssRNA negative-strand viruses | | equivalent name -988644 | unclassified ssRNA negative-strand viruses | | scientific name -990925 | Klebsiella pneumoniae subsp. pneumoniae KPX | | scientific name -990925 | Klebsiella pneumoniae subsp. pneumoniae str. KPX | | equivalent name -990925 | Klebsiella pneumoniae subsp. pneumoniae strain KPX | | equivalent name -992212 | Phlebovirus HB29/China/2010 | | equivalent name -992212 | SFTS virus HB29 | | scientific name -992212 | SFTSV HB29 | | equivalent name -994805 | Andean white-eared opossum | | genbank common name -994805 | Didelphis pernigra | | scientific name -994805 | Didelphis pernigra (Allen, 1900) | | authority -994805 | Didelphis pernigra J. A. Allen, 1900 | | authority -997078 | Tomato leaf curl Comoros virus | | scientific name -1003875 | Sicyoeae | | scientific name -1003875 | Sicyoeae Schrad., 1838 | | authority -1005902 | Porcine kobuvirus THA/2006 | | scientific name -1005903 | Porcine kobuvirus THA/2007 | | scientific name -1005904 | Porcine kobuvirus THA/2008 | | scientific name -1006621 | Cymbidiinae | | scientific name -1006621 | Cymbidiinae Benth., 1881 | | authority -1028307 | Enterobacter aerogenes KCTC 2190 | | synonym -1028307 | Enterobacter aerogenes str. KCTC 2190 | | equivalent name -1028307 | Enterobacter aerogenes strain KCTC 2190 | | equivalent name -1028307 | Klebsiella aerogenes KCTC 2190 | | scientific name -1028384 | Glomerellales | | scientific name -1028384 | Glomerellales Chadef. ex Reblova, W. Gams & Seifert, 2011 | | authority -1032459 | Megalaima haemacephala cebuensis | | synonym -1032459 | Megalaima haemacephala cebuensis Dziadosz & Parkes, 1984 | | authority -1032459 | Psilopogon haemacephalus cebuensis | | scientific name -1032460 | Megalaema haemacephala celestinoi | | synonym -1032460 | Megalaema haemacephala celestinoi Gilliard, 1949 | | authority -1032460 | Megalaima haemacephala celestinoi | | synonym -1032460 | Megalaima haemacephala celestinoi Gilliard, 1949 | | authority -1032460 | Psilopogon haemacephalus celestinoi | | scientific name -1032461 | Megalaema haemacephala delica | | synonym -1032461 | Megalaema haemacephala delica Parrot, 1907 | | authority -1032461 | Megalaima haemacephala delica | | synonym -1032461 | Megalaima haemacephala delica Parrot, 1907 | | authority -1032461 | Psilopogon haemacephalus delicus | | scientific name -1032462 | Bucco haemacephalus haemacephalus | | synonym -1032462 | Bucco haemacephalus haemacephalus Muller, 1776 | | authority -1032462 | Megalaima haemacephala haemacephala | | synonym -1032462 | Megalaima haemacephala haemacephala (Statius Mller, 1776) | | authority -1032462 | Psilopogon haemacephalus haemacephalus | | scientific name -1032463 | Bucco indicus | | synonym -1032463 | Bucco indicus Latham, 1790 | | authority -1032463 | Megalaima haemacephala indica | | synonym -1032463 | Megalaima haemacephala indica (Latham, 1790) | | authority -1032463 | Psilopogon haemacephalus indicus | | scientific name -1032464 | Megalaima haemacephala intermedia | | synonym -1032464 | Megalaima haemacephala intermedia (Shelley, 1891) | | authority -1032464 | Psilopogon haemacephalus intermedius | | scientific name -1032464 | Xantholaema intermedia | | synonym -1032464 | Xantholaema intermedia Shelley, 1891 | | authority -1032465 | Megalaima haemacephala mindanensis | | synonym -1032465 | Megalaima haemacephala mindanensis Rand, 1948 | | authority -1032465 | Psilopogon haemacephalus mindanensis | | scientific name -1032466 | Bucco roseus | | synonym -1032466 | Bucco roseus Dumont, 1805 | | authority -1032466 | Megalaima haemacephala rosea | | synonym -1032466 | Megalaima haemacephala rosea (Dumont, 1816) | | authority -1032466 | Psilopogon haemacephalus roseus | | scientific name -1033976 | Bean necrotic mosaic virus | | scientific name -1033978 | Plectosphaerellaceae | | scientific name -1033978 | Plectosphaerellaceae W.Gams, Summerbell & Zare 2007 | | authority -1033978 | mitosporic Plectosphaerellaceae | | includes -1034061 | Bartramiales | | scientific name -1034061 | Bartramiales M.Menzel, 1992 | | authority -1035782 | Chinese rice frog | | common name -1035782 | Microhyla mixtura | | scientific name -1035782 | Microhyla mixtura Liu and Hu, 1966 | | authority -1036719 | Verticillium | | scientific name -1036719 | Verticillium Nees, 1816 | | authority -1037890 | Klebsiella pneumoniae JH1 | | scientific name -1037890 | Klebsiella pneumoniae str. JH1 | | equivalent name -1037890 | Klebsiella pneumoniae strain JH1 | | equivalent name -1037908 | Klebsiella pneumoniae 1162281 | | scientific name -1037908 | Klebsiella pneumoniae str. 1162281 | | equivalent name -1037908 | Klebsiella pneumoniae strain 1162281 | | equivalent name -1046402 | Potato virus H | | scientific name -1048227 | Porcine kobuvirus/BRA10/2009/Brazil | | scientific name -1048228 | Porcine kobuvirus/BRA24/2009/Brazil | | scientific name -1048229 | Porcine kobuvirus/BRA36/2009/Brazil | | scientific name -1048230 | Porcine kobuvirus/BRA74/2009/Brazil | | scientific name -1048231 | Porcine kobuvirus/BRA788-3/2009/Brazil | | scientific name -1048232 | Porcine kobuvirus/NLD45/2008/Netherlands | | scientific name -1048233 | Porcine kobuvirus/NLD47/2008/Netherlands | | scientific name -1048436 | Human astrovirus VA2 | | scientific name -1048668 | Cotton leaf curl Multan alphasatellite | | scientific name -1048668 | Cotton leaf curl Multan virus alphasatellite | | equivalent name -1048854 | Munguba virus | | scientific name -1049565 | Klebsiella pneumoniae KCTC 2242 | | scientific name -1049565 | Klebsiella pneumoniae str. KCTC 2242 | | equivalent name -1049565 | Klebsiella pneumoniae strain KCTC 2242 | | equivalent name -1049657 | Blattoidea | | scientific name -1050903 | Pepper cryptic virus 2 | | scientific name -1054649 | Beauveria bassiana RNA virus 1 | | scientific name -1054649 | Beauveria bassiana virus 1 | | equivalent name -1056880 | Neurachne muelleri | | scientific name -1056880 | Neurachne muelleri Hack., 1895 | | authority -1056880 | Paraneurachne muelleri | | synonym -1056880 | Paraneurachne muelleri (Hack.) S.T.Blake, 1972 | | authority -1056966 | Aedini | | scientific name -1070324 | Bos taurus papillomavirus 12 | | scientific name -1070324 | Bovine papillomavirus 12 | | equivalent name -1070324 | Bovine papillomavirus type 12 | | equivalent name -1070408 | Human papillomavirus 135 | | scientific name -1070408 | Human papillomavirus type 135 | | equivalent name -1070409 | Human papillomavirus 136 | | scientific name -1070409 | Human papillomavirus type 136 | | equivalent name -1070410 | human papillomavirus 137 | | scientific name -1070413 | Human papillomavirus 140 | | scientific name -1070413 | Human papillomavirus type 140 | | equivalent name -1070417 | Human papillomavirus 144 | | scientific name -1070417 | Human papillomavirus type 144 | | equivalent name -1071164 | Kobuvirus swine/China/2010 | | scientific name -1073966 | unclassified Sapelovirus | | scientific name -1074486 | Klebsiella pneumoniae 1191100241 | | scientific name -1074486 | Klebsiella pneumoniae str. 1191100241 | | equivalent name -1074486 | Klebsiella pneumoniae strain 1191100241 | | equivalent name -1075431 | Alticorpus geoffreyi | | scientific name -1075431 | Alticorpus geoffreyi Snoeks & Walapa, 2004 | | authority -1077831 | unclassified Narnaviridae | | scientific name -1077832 | Phytophthora infestans RNA virus 4 | | scientific name -1080004 | Fulcaldea stuessyi | | scientific name -1080004 | Fulcaldea stuessyi Roque & V.A.Funk, 2011 | | authority -1080924 | Bracon chlorophthalmus | | synonym -1080924 | Bracon chlorophthalmus Spinola, 1808 | | authority -1080924 | Zele chlorophthalmus | | scientific name -1080924 | Zele chlorophthalmus (Spinola, 1808) | | authority -1087440 | Klebsiella pneumoniae subsp. pneumoniae KPNIH1 | | scientific name -1087441 | Klebsiella pneumoniae subsp. pneumoniae KPNIH2 | | scientific name -1087442 | Klebsiella pneumoniae subsp. pneumoniae KPNIH3 | | scientific name -1087443 | Klebsiella pneumoniae subsp. pneumoniae KPNIH4 | | scientific name -1087444 | Klebsiella pneumoniae subsp. pneumoniae KPNIH5 | | scientific name -1087445 | Klebsiella pneumoniae subsp. pneumoniae KPNIH6 | | scientific name -1087446 | Klebsiella pneumoniae FCF1305 | | scientific name -1087447 | Klebsiella pneumoniae FCF3SP | | scientific name -1094167 | Klebsiella pneumoniae subsp. pneumoniae KPNIH7 | | scientific name -1094168 | Klebsiella pneumoniae subsp. pneumoniae KPNIH8 | | scientific name -1094169 | Klebsiella pneumoniae subsp. pneumoniae KPNIH9 | | scientific name -1094170 | Klebsiella pneumoniae subsp. pneumoniae KPNIH10 | | scientific name -1094171 | Klebsiella pneumoniae subsp. pneumoniae KPNIH11 | | scientific name -1096141 | Bovine hokovirus 2 | | scientific name -1111709 | unclassified Iflaviridae | | scientific name -1112098 | Oceanites oceanicus exasperatus | | scientific name -1112098 | Oceanites oceanicus exasperatus Mathews, 1912 | | authority -1114942 | Pig stool associated circular ssDNA virus GER2011 | | scientific name -1115383 | Cycas szechuanensis | | scientific name -1115383 | Cycas szechuanensis W.C.Cheng & L.K.Fu, 1975 | | authority -1115692 | Cannabis cryptic virus | | scientific name -1123862 | Klebsiella pneumoniae subsp. pneumoniae Kp13 | | scientific name -1123862 | Klebsiella pneumoniae subsp. pneumoniae str. Kp13 | | equivalent name -1123862 | Klebsiella pneumoniae subsp. pneumoniae strain Kp13 | | equivalent name -1124990 | Klebsiella pneumoniae cifa_HP1 | | scientific name -1124990 | Klebsiella pneumoniae str. cifa_HP1 | | equivalent name -1124990 | Klebsiella pneumoniae strain cifa_HP1 | | equivalent name -1125630 | Klebsiella pneumoniae subsp. pneumoniae HS11286 | | scientific name -1125630 | Klebsiella pneumoniae subsp. pneumoniae str. HS11286 | | equivalent name -1125630 | Klebsiella pneumoniae subsp. pneumoniae strain HS11286 | | equivalent name -1128946 | Klebsiella pneumoniae subsp. pneumoniae KPNIH12 | | scientific name -1128947 | Klebsiella pneumoniae subsp. pneumoniae KPNIH13 | | scientific name -1128948 | Klebsiella pneumoniae subsp. pneumoniae KPNIH14 | | scientific name -1128949 | Klebsiella pneumoniae subsp. pneumoniae KPNIH15 | | scientific name -1128950 | Klebsiella pneumoniae subsp. pneumoniae KPNIH16 | | scientific name -1128951 | Klebsiella pneumoniae subsp. pneumoniae KPNIH17 | | scientific name -1128952 | Klebsiella pneumoniae subsp. pneumoniae KPNIH18 | | scientific name -1128953 | Klebsiella pneumoniae subsp. pneumoniae KPNIH19 | | scientific name -1128954 | Klebsiella pneumoniae subsp. pneumoniae KPNIH20 | | scientific name -1132022 | Kobuvirus swine/South Korea/2011 | | scientific name -1133751 | Artemisia sobemovirus A | | equivalent name -1133751 | Artemisia virus A | | scientific name -1136133 | Porcine kobuvirus SH-W-CHN/2010/China | | scientific name -1136150 | Scrophularia cephalantha | | scientific name -1136150 | Scrophularia cephalantha Nakai, 1938 | | authority -1156497 | Pichiaceae | | scientific name -1156497 | Pichiaceae M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority -1156497 | Pichiaceae Zender, 1925 | | authority -1156769 | Pig Kobuvirus isolates | | equivalent name -1156769 | Porcine kobuvirus | | scientific name -1158979 | Myliobatidae | | scientific name -1159556 | Claviceps virens | | synonym -1159556 | Claviceps virens M. Sakurai ex Nakata 1934 | | authority -1159556 | MAFF 240994 | MAFF 240994 | type material -1159556 | MAFF 240995 | MAFF 240995 | type material -1159556 | TNS:F-18423 | TNS:F-18423 | type material -1159556 | Ustilaginoidea virens | | scientific name -1159556 | Ustilaginoidea virens (Cooke) Takah., 1896 | | authority -1159556 | Ustilago virens | | synonym -1159556 | Ustilago virens Cooke, 1878 | | authority -1159556 | Villosiclava virens | | synonym -1159556 | Villosiclava virens (Y. Sakurai ex Nakata) E. Tanaka & C. Tanaka 2009 | | authority -1159556 | rice false smut | | common name -1159795 | Dreissena rostriformis compressa | | scientific name -1159795 | Dreissena rostriformis compressa Logvinenko & Starobogatov, 1966 | | authority -1159796 | Dreissena rostriformis distincta | | scientific name -1159796 | Dreissena rostriformis distincta Andrusov, 1897 | | authority -1159796 | Dreissena rostriformis var. distincta | | synonym -1159798 | Dreissena grimmi | | synonym -1159798 | Dreissena rostriformis grimmi | | scientific name -1159798 | Dreissena rostriformis grimmi Andrusov, 1890 | | authority -1162296 | Klebsiella pneumoniae subsp. pneumoniae DSM 30104 | | includes -1162296 | Klebsiella pneumoniae subsp. pneumoniae DSM 30104 = JCM 1662 = NBRC 14940 | | scientific name -1162296 | Klebsiella pneumoniae subsp. pneumoniae JCM 1662 | | includes -1162296 | Klebsiella pneumoniae subsp. pneumoniae NBRC 14940 | | includes -1162296 | Klebsiella pneumoniae subsp. pneumoniae str. DSM 30104 | | equivalent name -1162296 | Klebsiella pneumoniae subsp. pneumoniae strain DSM 30104 | | equivalent name -1162297 | Klebsiella pneumoniae subsp. pneumoniae LCT-KP214 | | scientific name -1162297 | Klebsiella pneumoniae subsp. pneumoniae str. LCT-KP214 | | equivalent name -1162297 | Klebsiella pneumoniae subsp. pneumoniae strain LCT-KP214 | | equivalent name -1168062 | Klebsiella pneumoniae subsp. pneumoniae KPNIH21 | | scientific name -1168062 | Klebsiella pneumoniae subsp. pneumoniae str. KPNIH21 | | equivalent name -1168062 | Klebsiella pneumoniae subsp. pneumoniae strain KPNIH21 | | equivalent name -1168063 | Klebsiella pneumoniae subsp. pneumoniae KPNIH22 | | scientific name -1168063 | Klebsiella pneumoniae subsp. pneumoniae str. KPNIH22 | | equivalent name -1168063 | Klebsiella pneumoniae subsp. pneumoniae strain KPNIH22 | | equivalent name -1168064 | Klebsiella pneumoniae subsp. pneumoniae KPNIH23 | | scientific name -1168064 | Klebsiella pneumoniae subsp. pneumoniae str. KPNIH23 | | equivalent name -1168064 | Klebsiella pneumoniae subsp. pneumoniae strain KPNIH23 | | equivalent name -1170422 | Loreto virus | | scientific name -1170424 | Negev virus | | scientific name -1170425 | Piura virus | | scientific name -1170656 | Vinca leaf curl virus | | scientific name -1172985 | Jingmen tick virus | | scientific name -1172985 | Mogiana tick virus | | equivalent name -1173713 | CGMCC 5.2175 | CGMCC 5.2175 | type material -1173713 | Ganoderma sichuanense | | scientific name -1173713 | Ganoderma sichuanense J. D. Zhao & X. Q. Zhang, 1983 | | authority -1173713 | HMAS 252081 | HMAS 252081 | type material -1173763 | Klebsiella pneumoniae NES 14 | | scientific name -1173763 | Klebsiella pneumoniae str. NES 14 | | equivalent name -1173763 | Klebsiella pneumoniae strain NES 14 | | equivalent name -1176516 | Rosoideae incertae sedis | | scientific name -1177045 | Human astrovirus 1a | | scientific name -1177046 | Human astrovirus 2c | | scientific name -1177047 | Human astrovirus 4a | | scientific name -1177153 | Klebsiella pneumoniae subsp. pneumoniae LZ | | scientific name -1177153 | Klebsiella pneumoniae subsp. pneumoniae str. LZ | | equivalent name -1177153 | Klebsiella pneumoniae subsp. pneumoniae strain LZ | | equivalent name -1182518 | Maize streak Reunion virus | | scientific name -1183241 | Persimmon cryptic virus | | scientific name -1185359 | Bat sapovirus TLC58/HK | | scientific name -1185418 | Klebsiella pneumoniae subsp. pneumoniae ST512-K30BO | | scientific name -1185418 | Klebsiella pneumoniae subsp. pneumoniae str. ST512-K30BO | | equivalent name -1185418 | Klebsiella pneumoniae subsp. pneumoniae strain ST512-K30BO | | equivalent name -1185419 | Klebsiella pneumoniae subsp. pneumoniae ST258-K26BO | | scientific name -1185419 | Klebsiella pneumoniae subsp. pneumoniae str. ST258-K26BO | | equivalent name -1185419 | Klebsiella pneumoniae subsp. pneumoniae strain ST258-K26BO | | equivalent name -1185420 | Klebsiella pneumoniae subsp. pneumoniae ST258-K28BO | | scientific name -1185420 | Klebsiella pneumoniae subsp. pneumoniae str. ST258-K28BO | | equivalent name -1185420 | Klebsiella pneumoniae subsp. pneumoniae strain ST258-K28BO | | equivalent name -1187973 | California sea lion picobirnavirus | | equivalent name -1187973 | Otarine picobirnavirus | | scientific name -1188990 | Vallota speciosa virus | | scientific name -1193292 | Klebsiella pneumoniae subsp. pneumoniae 1084 | | scientific name -1193292 | Klebsiella pneumoniae subsp. pneumoniae str. 1084 | | equivalent name -1193292 | Klebsiella pneumoniae subsp. pneumoniae strain 1084 | | equivalent name -1195163 | Amazon lily mild mottle virus | | equivalent name -1195163 | Anulavirus ALMMV | | scientific name -1195641 | Sida yellow mosaic China virus | | scientific name -1195776 | Pleuronichthys japonicus | | scientific name -1195776 | Pleuronichthys japonicus Suzuki, Kawashima & Nakabo, 2009 | | authority -1196387 | Batrachospermum mahlacense | | synonym -1196387 | Batrachospermum mahlacense Kumano & W.A.Bowden-Kerby, 1986 | | authority -1196387 | Kumanoa mahlacensis | | scientific name -1196387 | Kumanoa mahlacensis (Kumano et W. A. Bowden-Kerby) M. L. Vis, Necchi, W. B. Chiasson et Entwisle 2012 | | authority -1196474 | Aster falcifolius | | scientific name -1196474 | Aster falcifolius Hand.-Mazz., 1937 | | authority -1196494 | Aster pycnophyllus | | scientific name -1196494 | Aster pycnophyllus Franch. ex Diels, 1912 | | authority -1199150 | Klebsiella pneumoniae subsp. pneumoniae KP5-1 | | scientific name -1200970 | French bean leaf curl virus - [India:Kanpur:2011] | | scientific name -1200970 | French bean leaf curl virus-Kanpur | | equivalent name -1200971 | French bean leaf curl betasatellite-Kanpur | | scientific name -1202142 | Citrus chlorotic dwarf associated virus | | scientific name -1202142 | Citrus chlorotic dwarf-associated virus | | equivalent name -1203539 | MW polyomavirus | | scientific name -1203539 | MWPyV strain MA095 | | equivalent name -1203544 | Klebsiella pneumoniae WGLW1 | | synonym -1203544 | Klebsiella pneumoniae subsp. pneumoniae WGLW1 | | scientific name -1203545 | Klebsiella pneumoniae WGLW2 | | synonym -1203545 | Klebsiella pneumoniae subsp. pneumoniae WGLW2 | | scientific name -1203546 | Klebsiella pneumoniae WGLW3 | | synonym -1203546 | Klebsiella pneumoniae subsp. pneumoniae WGLW3 | | scientific name -1203547 | Klebsiella pneumoniae WGLW5 | | synonym -1203547 | Klebsiella pneumoniae subsp. pneumoniae WGLW5 | | scientific name -1205678 | Klebsiella pneumoniae subsp. pneumoniae B5055 | | equivalent name -1205678 | Klebsiella pneumoniae subsp. pneumoniae CIP 52.145 | | equivalent name -1205678 | Klebsiella pneumoniae subsp. pneumoniae CIP 52.145 = B5055 | | scientific name -1206794 | Ecdysozoa | | scientific name -1206795 | Lophotrochozoa | | scientific name -1208309 | Deltapolyomavirus decihominis | | scientific name -1208309 | Human polyomavirus 10 | | equivalent name -1209932 | BBA 70349 | BBA 70349 | type material -1209932 | CBS 126529 | CBS 126529 | type material -1209932 | Colletotrichum scovillei | | scientific name -1209932 | Colletotrichum scovillei Damm, P.F. Cannon & Crous, 2012 | | authority -1209932 | Colletotrichum sp. UD-2012t | | includes -1212766 | Klebsiella pneumoniae subsp. pneumoniae ST258-490 | | scientific name -1212766 | Klebsiella pneumoniae subsp. pneumoniae str. ST258-490 | | equivalent name -1212766 | Klebsiella pneumoniae subsp. pneumoniae strain ST258-490 | | equivalent name -1213620 | Bhanja virus | | scientific name -1214274 | Aedes flavopictus downsi | | scientific name -1214274 | Aedes flavopictus downsi Bohart & Ingram, 1946 | | authority -1214275 | Aedes flavopictus miyarai | | scientific name -1214275 | Aedes flavopictus miyarai Tanaka, Mizusawa & Saugstad, 1979 | | authority -1214955 | GyV4 | GyV4 | acronym -1214955 | Gyrovirus 4 | | scientific name -1216472 | Bat hepatitis E virus | | scientific name -1216472 | Bat hepevirus | | equivalent name -1217821 | Sibine fusca densovirus | | scientific name -1218098 | Klebsiella pneumoniae subsp. ozaenae NBRC 105683 | | scientific name -1219210 | Cordyceps militaris CM-whu | | scientific name -1221206 | Soybean chlorotic spot virus | | scientific name -1221208 | Papilio polyxenes densovirus | | scientific name -1221437 | Grapevine virus F | | scientific name -1221521 | Klebsiella pneumoniae HCNHY1 | | scientific name -1223561 | CAS virus | | scientific name -1223562 | Golden Gate virus | | scientific name -1224679 | Diphyllobothriidea | | scientific name -1225181 | Klebsiella pneumoniae subsp. pneumoniae KPNIH24 | | scientific name -1225182 | Klebsiella pneumoniae subsp. pneumoniae KPNIH25 | | scientific name -1225183 | Klebsiella pneumoniae subsp. pneumoniae KPNIH26 | | scientific name -1226115 | Klebsiella pneumoniae subsp. pneumoniae KpQ3 | | scientific name -1226115 | Klebsiella pneumoniae subsp. pneumoniae str. KpQ3 | | equivalent name -1226115 | Klebsiella pneumoniae subsp. pneumoniae strain KpQ3 | | equivalent name -1226680 | Klebsiella pneumoniae subsp. pneumoniae Ecl8 | | scientific name -1228988 | Klebsiella pneumoniae subsp. pneumoniae KpMDU1 | | scientific name -1230847 | Micromus angulatus | | scientific name -1230847 | Micromus angulatus (Stephens, 1836) | | authority -1231296 | unclassified Begomovirus-associated alphasatellites | | scientific name -1231522 | CBS 7798 | CBS 7798 | type material -1231522 | Candida duobushaemuli Cend.-Bueno, Kolecka, Alastr.-Izq., Gomez-Lopez, Cuenc.-Estr. & Boekhout, 2012 | | synonym -1231522 | Candida duobushaemulonii | | synonym -1231522 | Candidozyma duobushaemuli | | scientific name -1231522 | Candidozyma duobushaemuli (Cend.-Bueno, Kolecka, Alastr.-Izq., Gomez-Lopez, Cuenc.-Estr. & Boekhout, 2012) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai, 2024 | | authority -1231522 | NRRL Y-17802 | NRRL Y-17802 | type material -1231522 | NRRL-Y-17802 | NRRL-Y-17802 | type material -1231522 | NRRL:Y-17802 | NRRL:Y-17802 | type material -1231522 | NRRLY-17802 | NRRLY-17802 | type material -1231523 | CNM CL-7239 | CNM CL-7239 | type material -1231523 | CNM-CL-7239 | CNM-CL-7239 | type material -1231523 | CNM:CL-7239 | CNM:CL-7239 | type material -1231523 | CNMCL-7239 | CNMCL-7239 | type material -1231523 | CNMCL7239 | CNMCL7239 | type material -1231523 | Candida haemuli var. vulneris Cend.-Bueno, Kolecka, Alastr.-Izq., Gomez-Lopez, Cuenc.-Estr. & Boekhout, 2012 | | synonym -1231523 | Candida haemuloni var. vulnera | | synonym -1231523 | Candidozyma haemuli var. vulneris | | scientific name -1231523 | Candidozyma haemuli var. vulneris (Cend.-Bueno, Kolecka, Alastr.-Izq., Gomez-Lopez, Cuenc.-Estr. & Boekhout) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai, 2024 | | authority -1232392 | Klebsiella pneumoniae subsp. pneumoniae KpO3210 | | scientific name -1232637 | Scutavirus | | scientific name -1233522 | unclassified Nebovirus | | scientific name -1236101 | Klebsiella pneumoniae JHCK1 | | scientific name -1236101 | Klebsiella pneumoniae str. JHCK1 | | synonym -1236102 | Klebsiella pneumoniae VA360 | | scientific name -1236102 | Klebsiella pneumoniae str. VA360 | | synonym -1236400 | Pan troglodytes troglodytes polyomavirus 1 | | scientific name -1236676 | Cubitermes ugandensis | | synonym -1236676 | Cubitermes ugandensis (Fuller, 1923) | | authority -1236676 | Cubitermes ugandensis Fuller, 1923 | | authority -1236676 | Isognathotermes ugandensis | | scientific name -1236676 | Isognathotermes ugandensis (Fuller, 1923) | | authority -1238886 | unclassified Torradovirus | | scientific name -1239565 | Mamastrovirus 1 | | scientific name -1239565 | Mamastrovirus-1 | | equivalent name -1241370 | Okra leaf curl Oman virus | | scientific name -1241918 | Le Blanc nodavirus | | scientific name -1244085 | Klebsiella pneumoniae CG43 | | scientific name -1248396 | Human papillomavirus 156 | | scientific name -1248396 | Human papillomavirus type 156 | | equivalent name -1249508 | unclassified Hepacivirus | | scientific name -1250315 | RNA satellites | | scientific name -1250520 | Klebsiella pneumoniae RYC492 | | scientific name -1263871 | Klebsiella pneumoniae ATCC BAA-2146 | | scientific name -1267897 | Klebsiella pneumoniae hvKP1 | | scientific name -1268974 | Klebsiella pneumoniae subsp. pneumoniae Kp001 | | scientific name -1269006 | Klebsiella pneumoniae 909957 | | scientific name -1272960 | Yata virus | | scientific name -1273128 | KLCuB | | acronym -1273128 | Kenaf leaf curl betasatellite | | scientific name -1274605 | Human astrovirus 1/ICMH642Astro/2006/BD | | scientific name -1274606 | Human astrovirus 1/ICMH666Astro/2006/BD | | scientific name -1274607 | Human astrovirus 6/ICMH108Astro/2005/BD | | scientific name -1274608 | Human astrovirus 6/ICMH433Astro/2006/BD | | scientific name -1274609 | Human astrovirus 1/ICMH590Astro/2006/BD | | scientific name -1274610 | Human astrovirus 1/ICMH573Astro/2006/BD | | scientific name -1274611 | Human astrovirus 1/ICMH469Astro/2006/BD | | scientific name -1274613 | Human astrovirus 1/GUP216Astro/2005/TR | | scientific name -1274614 | Human astrovirus 5/GUP125Astro/2005/TR | | scientific name -1274615 | Human astrovirus 1/GUP024Astro/2004/TR | | scientific name -1276652 | Klebsiella pneumoniae ATCC BAA-1705 | | scientific name -1276653 | Klebsiella pneumoniae 700603 | | scientific name -1278288 | Pethia | | scientific name -1279040 | Klebsiella pneumoniae PR04 | | scientific name -1279099 | Sclerotinia sclerotiorum mitovirus 3 | | scientific name -1280412 | Conoidasida | | scientific name -1280412 | Conoidasida Levine 1988 | | authority -1284787 | Klebsiella pneumoniae UHKPC40 | | scientific name -1284788 | Klebsiella pneumoniae UHKPC23 | | scientific name -1284789 | Klebsiella pneumoniae UHKPC28 | | scientific name -1284790 | Klebsiella pneumoniae UHKPC05 | | scientific name -1284791 | Klebsiella pneumoniae UHKPC47 | | scientific name -1284792 | Klebsiella pneumoniae UHKPC67 | | scientific name -1284793 | Klebsiella pneumoniae UHKPC69 | | scientific name -1284794 | Klebsiella pneumoniae UHKPC77 | | scientific name -1284795 | Klebsiella pneumoniae UHKPC96 | | scientific name -1284796 | Klebsiella pneumoniae DMC0526 | | scientific name -1284797 | Klebsiella pneumoniae DMC0799 | | scientific name -1284798 | Klebsiella pneumoniae DMC1097 | | scientific name -1284799 | Klebsiella pneumoniae DMC1316 | | scientific name -1284800 | Klebsiella pneumoniae UHKPC61 | | scientific name -1284801 | Klebsiella pneumoniae UHKPC48 | | scientific name -1284802 | Klebsiella pneumoniae UHKPC33 | | scientific name -1284803 | Klebsiella pneumoniae UHKPC59 | | scientific name -1284804 | Klebsiella pneumoniae UHKPC07 | | scientific name -1284805 | Klebsiella pneumoniae UHKPC17 | | scientific name -1284806 | Klebsiella pneumoniae UHKPC18 | | scientific name -1284807 | Klebsiella pneumoniae UHKPC31 | | scientific name -1284808 | Klebsiella pneumoniae UHKPC06 | | scientific name -1284809 | Klebsiella pneumoniae UHKPC02 | | scientific name -1284810 | Klebsiella pneumoniae UHKPC09 | | scientific name -1284811 | Klebsiella pneumoniae UHKPC01 | | scientific name -1284812 | Klebsiella pneumoniae UHKPC81 | | scientific name -1284813 | Klebsiella pneumoniae UHKPC27 | | scientific name -1284814 | Klebsiella pneumoniae UHKPC 52 | | scientific name -1284815 | Klebsiella pneumoniae UHKPC24 | | scientific name -1284816 | Klebsiella pneumoniae UHKPC26 | | scientific name -1284817 | Klebsiella pneumoniae UHKPC57 | | scientific name -1284818 | Klebsiella pneumoniae UHKPC179 | | scientific name -1284819 | Klebsiella pneumoniae UHKPC45 | | scientific name -1284820 | Klebsiella pneumoniae UHKPC22 | | scientific name -1284821 | Klebsiella pneumoniae UHKPC29 | | scientific name -1284822 | Klebsiella pneumoniae UHKPC32 | | scientific name -1284823 | Klebsiella pneumoniae UHKPC04 | | scientific name -1284824 | Klebsiella pneumoniae VAKPC252 | | scientific name -1284825 | Klebsiella pneumoniae VAKPC254 | | scientific name -1284826 | Klebsiella pneumoniae VAKPC269 | | scientific name -1284827 | Klebsiella pneumoniae VAKPC278 | | scientific name -1284828 | Klebsiella pneumoniae VAKPC280 | | scientific name -1284829 | Klebsiella pneumoniae VAKPC270 | | scientific name -1284830 | Klebsiella pneumoniae VAKPC276 | | scientific name -1284831 | Klebsiella pneumoniae VAKPC297 | | scientific name -1284832 | Klebsiella pneumoniae VAKPC309 | | scientific name -1284833 | Klebsiella pneumoniae KP-7 | | scientific name -1284834 | Klebsiella pneumoniae KP-11 | | scientific name -1285372 | Klebsiella pneumoniae KP_H5500 | | scientific name -1285373 | Klebsiella pneumoniae KPM_nasey | | scientific name -1285596 | Megabirnaviridae | | scientific name -1285597 | Megabirnavirus | | scientific name -1290996 | Klebsiella pneumoniae KP3-S | | scientific name -1292273 | Obrimoposthia | | scientific name -1293059 | Macrophthalmidae | | scientific name -1293356 | Paspaleae | | scientific name -1293356 | Paspaleae J.Presl, 1830 | | authority -1293359 | Paspalinae | | scientific name -1293359 | Paspalinae Griseb., 1846 | | authority -1293364 | Neurachninae | | scientific name -1293364 | Neurachninae Clayton & Renvoize, 1986 | | authority -1294138 | Klebsiella pneumoniae KP5-R | | scientific name -1294139 | Klebsiella pneumoniae KP4-R | | scientific name -1294140 | Klebsiella pneumoniae KP1-I | | scientific name -1294141 | Klebsiella pneumoniae KP2-R | | scientific name -1294269 | Klebsiella pneumoniae HSL4 | | scientific name -1298631 | Turncurtovirus | | scientific name -1298633 | Aichivirus C | | equivalent name -1298633 | Kobuvirus cebes | | scientific name -1299309 | Alphanecrovirus | | scientific name -1300166 | Klebsiella pneumoniae subsp. pneumoniae JCM 20051 | | scientific name -1300981 | Porcine kobuvirus H1/2010/USA | | scientific name -1300982 | Porcine kobuvirus H10/2012/USA | | scientific name -1300983 | Porcine kobuvirus H11/2012/USA | | scientific name -1300984 | Porcine kobuvirus H12/2012/USA | | scientific name -1300985 | Porcine kobuvirus H13/2012/USA | | scientific name -1300986 | Porcine kobuvirus H14/2012/USA | | scientific name -1300987 | Porcine kobuvirus H15/2012/USA | | scientific name -1300988 | Porcine kobuvirus H16/2012/USA | | scientific name -1300989 | Porcine kobuvirus H17/2012/USA | | scientific name -1300990 | Porcine kobuvirus H18/2012/USA | | scientific name -1300991 | Porcine kobuvirus H19/2012/USA | | scientific name -1300992 | Porcine kobuvirus H2/2010/USA | | scientific name -1300993 | Porcine kobuvirus H20/2012/USA | | scientific name -1300994 | Porcine kobuvirus H21/2012/USA | | scientific name -1300995 | Porcine kobuvirus H22/2012/USA | | scientific name -1300996 | Porcine kobuvirus H23/2012/USA | | scientific name -1300997 | Porcine kobuvirus H24/2012/USA | | scientific name -1300998 | Porcine kobuvirus H25/2012/USA | | scientific name -1300999 | Porcine kobuvirus H3/2010/USA | | scientific name -1301000 | Porcine kobuvirus H4/2010/USA | | scientific name -1301001 | Porcine kobuvirus H5/2012/USA | | scientific name -1301002 | Porcine kobuvirus H6/2012/USA | | scientific name -1301003 | Porcine kobuvirus H7/2012/USA | | scientific name -1301004 | Porcine kobuvirus H8/2012/USA | | scientific name -1301005 | Porcine kobuvirus H9/2012/USA | | scientific name -1301006 | Porcine kobuvirus M1/2012/USA | | scientific name -1301007 | Porcine kobuvirus M10/2012/USA | | scientific name -1301008 | Porcine kobuvirus M2/2012/USA | | scientific name -1301009 | Porcine kobuvirus M3/2012/USA | | scientific name -1301010 | Porcine kobuvirus M4/2012/USA | | scientific name -1301011 | Porcine kobuvirus M5/2012/USA | | scientific name -1301012 | Porcine kobuvirus M6/2012/USA | | scientific name -1301013 | Porcine kobuvirus M7/2012/USA | | scientific name -1301014 | Porcine kobuvirus M8/2012/USA | | scientific name -1301015 | Porcine kobuvirus M9/2012/USA | | scientific name -1302145 | Aethopyga gouldiae | | scientific name -1302145 | Aethopyga gouldiae (Vigors, 1831) | | authority -1302145 | Cinnyris gouldiae | | synonym -1302145 | Cinnyris gouldiae Vigors, 1831 | | authority -1302145 | Gould's sunbird | | genbank common name -1303385 | Tomato leaf curl Liwa virus | | scientific name -1304916 | Klebsiella pneumoniae 140_1040 | | scientific name -1304917 | Klebsiella pneumoniae 160_1080 | | scientific name -1304918 | Klebsiella pneumoniae 120_1020 | | scientific name -1304919 | Klebsiella pneumoniae 280_1220 | | scientific name -1304920 | Klebsiella pneumoniae 361_1301 | | scientific name -1304921 | Klebsiella pneumoniae 440_1540 | | scientific name -1304922 | Klebsiella pneumoniae 500_1420 | | scientific name -1304923 | Klebsiella pneumoniae 540_1460 | | scientific name -1304924 | Klebsiella pneumoniae 646_1568 | | scientific name -1306546 | ALCV | | acronym -1306546 | Alfalfa leaf curl virus | | equivalent name -1306546 | Capulavirus medicagonis | | scientific name -1306950 | Klebsiella pneumoniae 12-3578 | | synonym -1306950 | Klebsiella pneumoniae subsp. pneumoniae 12-3578 | | scientific name -1307798 | Negevirus | | scientific name -1307799 | Pegivirus | | scientific name -1307958 | Sweet potato C6 virus | | scientific name -1307958 | Sweet potato virus C-6 | | equivalent name -1308539 | Klebsiella pneumoniae subsp. pneumoniae ATCC 43816 | | scientific name -1308684 | Klebsiella pneumoniae ADL-122 | | scientific name -1308684 | Klebsiella pneumoniae ADL-22 | | equivalent name -1308685 | Klebsiella pneumoniae ADL-201 | | scientific name -1308685 | Klebsiella pneumoniae ADL-25 | | equivalent name -1308686 | Klebsiella pneumoniae ADL-202 | | scientific name -1308686 | Klebsiella pneumoniae ADL-26 | | equivalent name -1308687 | Klebsiella pneumoniae ADL-317 | | scientific name -1308687 | Klebsiella pneumoniae ADL-70 | | equivalent name -1308688 | Klebsiella pneumoniae ADL-322 | | scientific name -1308688 | Klebsiella pneumoniae ADL-75 | | equivalent name -1308731 | Enterobacter aerogenes ADL-323 | | synonym -1308731 | Enterobacter aerogenes ADL-76 | | equivalent name -1308731 | Klebsiella aerogenes ADL-323 | | scientific name -1308858 | Sigmavirus | | scientific name -1309536 | Hydroporus obliquesignatus | | synonym -1309536 | Hydroporus obliquesignatus Bielz, 1852 | | authority -1309536 | Porhydrus obliquesignatus | | scientific name -1309536 | Porhydrus obliquesignatus (Bielz, 1852) | | authority -1310158 | Klebsiella pneumoniae Kb140 | | scientific name -1310159 | Klebsiella pneumoniae Kb677 | | scientific name -1310424 | Verticillium dahliae partitivirus 1 | | scientific name -1315262 | Human papillomavirus type 163 | | equivalent name -1315262 | human papillomavirus 163 | | scientific name -1316582 | Klebsiella pneumoniae ATCC 43816 | | scientific name -1316938 | Klebsiella pneumoniae ATCC 25955 | | scientific name -1316939 | Klebsiella pneumoniae G5-2 | | scientific name -1328324 | Klebsiella pneumoniae subsp. pneumoniae KPNIH27 | | scientific name -1328325 | Klebsiella pneumoniae subsp. pneumoniae KPR0928 | | scientific name -1328337 | Klebsiella pneumoniae BIDMC 31 | | scientific name -1328362 | Klebsiella pneumoniae MGH 17 | | scientific name -1328363 | Klebsiella pneumoniae MGH 18 | | scientific name -1328364 | Klebsiella pneumoniae MGH 19 | | scientific name -1328366 | Klebsiella pneumoniae MGH 21 | | scientific name -1328367 | Klebsiella pneumoniae MGH 29 | | scientific name -1328368 | Klebsiella pneumoniae MGH 30 | | scientific name -1328369 | Klebsiella pneumoniae MGH 31 | | scientific name -1328370 | Klebsiella pneumoniae MGH 32 | | scientific name -1328371 | Klebsiella pneumoniae MGH 35 | | scientific name -1328372 | Klebsiella pneumoniae MGH 36 | | scientific name -1328373 | Klebsiella pneumoniae MGH 39 | | scientific name -1328375 | Klebsiella pneumoniae MGH 43 | | scientific name -1328377 | Klebsiella pneumoniae MGH 45 | | scientific name -1328378 | Klebsiella pneumoniae MGH 46 | | scientific name -1328379 | Klebsiella pneumoniae MGH 47 | | scientific name -1328380 | Klebsiella pneumoniae MGH 48 | | scientific name -1328381 | Klebsiella pneumoniae BWH 2 | | scientific name -1328382 | Klebsiella pneumoniae BWH 15 | | scientific name -1328383 | Klebsiella pneumoniae BWH 22 | | scientific name -1328384 | Klebsiella pneumoniae BWH 28 | | scientific name -1328385 | Klebsiella pneumoniae BWH 30 | | scientific name -1328386 | Klebsiella pneumoniae BWH 36 | | scientific name -1328387 | Klebsiella pneumoniae BWH 41 | | scientific name -1328388 | Klebsiella pneumoniae MGH 78578 | | scientific name -1328389 | Klebsiella pneumoniae UCICRE 1 | | scientific name -1328390 | Klebsiella pneumoniae UCICRE 2 | | scientific name -1328391 | Klebsiella pneumoniae UCICRE 4 | | scientific name -1328392 | Klebsiella pneumoniae UCICRE 6 | | scientific name -1328393 | Klebsiella pneumoniae UCICRE 7 | | scientific name -1328394 | Klebsiella pneumoniae UCICRE 8 | | scientific name -1328396 | Klebsiella pneumoniae UCICRE 13 | | scientific name -1328398 | Klebsiella pneumoniae BIDMC 1 | | scientific name -1328399 | Klebsiella pneumoniae BIDMC 2A | | scientific name -1328400 | Klebsiella pneumoniae BIDMC 4 | | scientific name -1328401 | Klebsiella pneumoniae BIDMC 5 | | scientific name -1328402 | Klebsiella pneumoniae BIDMC 7A | | scientific name -1328403 | Klebsiella pneumoniae BIDMC 7B | | scientific name -1328404 | Klebsiella pneumoniae BIDMC 10 | | scientific name -1328405 | Klebsiella pneumoniae BIDMC 11 | | scientific name -1328406 | Klebsiella pneumoniae BIDMC 12A | | scientific name -1328407 | Klebsiella pneumoniae BIDMC 12B | | scientific name -1328408 | Klebsiella pneumoniae BIDMC 12C | | scientific name -1328409 | Klebsiella pneumoniae BIDMC 13 | | scientific name -1328410 | Klebsiella pneumoniae BIDMC 14 | | scientific name -1328411 | Klebsiella pneumoniae BIDMC 16 | | scientific name -1328412 | Klebsiella pneumoniae BIDMC 18A | | scientific name -1328413 | Klebsiella pneumoniae BIDMC 18B | | scientific name -1328414 | Klebsiella pneumoniae BIDMC 18C | | scientific name -1328415 | Klebsiella pneumoniae BIDMC 18D | | scientific name -1328416 | Klebsiella pneumoniae BIDMC 21 | | scientific name -1328417 | Klebsiella pneumoniae BIDMC 22 | | scientific name -1328418 | Klebsiella pneumoniae BIDMC 23 | | scientific name -1328419 | Klebsiella pneumoniae BIDMC 24 | | scientific name -1328420 | Klebsiella pneumoniae BIDMC 25 | | scientific name -1328421 | Klebsiella pneumoniae BIDMC 32 | | scientific name -1328423 | Klebsiella pneumoniae BIDMC 34 | | scientific name -1328424 | Klebsiella pneumoniae BIDMC 35 | | scientific name -1328425 | Klebsiella pneumoniae BIDMC 36 | | scientific name -1328426 | Klebsiella pneumoniae BIDMC 40 | | scientific name -1328427 | Klebsiella pneumoniae BIDMC 41 | | scientific name -1329649 | Bat bocavirus | | scientific name -1329799 | Archelosauria | | scientific name -1329799 | Archelosauria Crawfort et al. 2014 | | authority -1329799 | Archosauria-Testudines | | synonym -1329799 | Testudines + Archosauria group | | synonym -1329801 | Klebsiella pneumoniae ST272 | | scientific name -1329843 | Klebsiella pneumoniae BIDMC 33B | | scientific name -1331744 | Actinidia virus X | | equivalent name -1331744 | Plantain virus X | | scientific name -1335476 | Eidolon helvum bat papillomavirus 2 | | equivalent name -1335476 | Eidolon helvum bat papillomavirus type 2 | | equivalent name -1335476 | Eidolon helvum papillomavirus 2 | | scientific name -1335476 | Eidolon helvum papillomavirus type 2 | | equivalent name -1335477 | Eidolon helvum bat papillomavirus 3 | | equivalent name -1335477 | Eidolon helvum bat papillomavirus type 3 | | equivalent name -1335477 | Eidolon helvum papillomavirus 3 | | scientific name -1338369 | Dipnotetrapodomorpha | | scientific name -1341693 | Klebsiella pneumoniae subsp. pneumoniae MP14 | | scientific name -1343063 | Klebsiella pneumoniae subsp. pneumoniae UKKV901664 | | scientific name -1343920 | Prunevirus armeniacae | | scientific name -1345628 | Klebsiella pneumoniae SB2390 | | scientific name -1345631 | Klebsiella pneumoniae SB3193 | | scientific name -1348659 | Klebsiella pneumoniae CGMCC 1.1736 | | scientific name -1352932 | Klebsiella pneumoniae LCT-KP182 | | scientific name -1352933 | Klebsiella pneumoniae LCT-KP289 | | scientific name -1357295 | Klebsiella pneumoniae EGD-HP19-C | | scientific name -1365186 | Klebsiella pneumoniae KP-1 | | scientific name -1379687 | Klebsiella pneumoniae BJ1-GA | | synonym -1379687 | Klebsiella pneumoniae subsp. pneumoniae BJ1-GA | | scientific name -1379688 | Klebsiella pneumoniae SA1 | | synonym -1379688 | Klebsiella pneumoniae subsp. pneumoniae SA1 | | scientific name -1379689 | Klebsiella pneumoniae T69 | | synonym -1379689 | Klebsiella pneumoniae subsp. pneumoniae T69 | | scientific name -1380111 | Poecilimon luschani luschani | | scientific name -1380456 | Poecilimon luschani chobanovi | | scientific name -1380456 | Poecilimon luschani chobanovi Boztepe, Kaya & Ciplak, 2013 | | authority -1380456 | Poecilimon luschani ssp. 1 SK-2013 | | includes -1380908 | Klebsiella pneumoniae JM45 | | scientific name -1381121 | Klebsiella pneumoniae 303K | | scientific name -1382995 | Chaetoceros sp. DNA virus 7 | | scientific name -1384549 | Klebsiella pneumoniae subsp. pneumoniae KKBO-1 | | scientific name -1384550 | Klebsiella pneumoniae subsp. pneumoniae KKBO-4 | | scientific name -1385657 | unclassified Gokushovirinae | | scientific name -1387562 | Ophidiomyces | | scientific name -1387562 | Ophidiomyces Sigler, Hambl. & Pare, 2013 | | authority -1387563 | CBS 122913 | CBS 122913 | type material -1387563 | Chrysosporium ophidiicola Guarro, Deanna A. Sutton, Wickes & Rajeev, 2009 | | synonym -1387563 | Chrysosporium sp. R-3923 | | includes -1387563 | Ophidiomyces ophidiicola | | scientific name -1387563 | Ophidiomyces ophidiicola (Guarro, Deanna A. Sutton, Wickes & Rajeev) Sigler, Hambleton & Pare, 2013 | | synonym -1389422 | Klebsiella pneumoniae LAU-KP1 | | scientific name -1392499 | Klebsiella pneumoniae 1158 | | synonym -1392499 | Klebsiella pneumoniae subsp. pneumoniae 1158 | | scientific name -1392500 | Klebsiella pneumoniae HK787 | | scientific name -1393935 | Myotis horsfieldii deignani | | scientific name -1393935 | Myotis horsfieldii deignani Shamel, 1942 | | authority -1393935 | Myotis horsfieldii subsp. deignani | | synonym -1393935 | Myotis horsfieldii subsp. deignani Shamel, 1942 | | authority -1393936 | Myotis horsfieldii horsfieldii | | scientific name -1393936 | Vespertilio horsfieldii horsfieldii | | synonym -1393936 | Vespertilio horsfieldii horsfieldii Temminck, 1840 | | authority -1395574 | Klebsiella pneumoniae subsp. pneumoniae KpQ24 | | scientific name -1395575 | Klebsiella pneumoniae subsp. pneumoniae KpQ15 | | scientific name -1400138 | Enterobacter aerogenes UCI 15 | | synonym -1400138 | Klebsiella aerogenes UCI 15 | | scientific name -1400139 | Enterobacter aerogenes UCI 16 | | synonym -1400139 | Klebsiella aerogenes UCI 16 | | scientific name -1400140 | Enterobacter aerogenes UCI 27 | | synonym -1400140 | Klebsiella aerogenes UCI 27 | | scientific name -1400141 | Enterobacter aerogenes UCI 28 | | synonym -1400141 | Klebsiella aerogenes UCI 28 | | scientific name -1400142 | Enterobacter aerogenes UCI 45 | | synonym -1400142 | Klebsiella aerogenes UCI 45 | | scientific name -1400143 | Enterobacter aerogenes UCI 46 | | synonym -1400143 | Klebsiella aerogenes UCI 46 | | scientific name -1400144 | Enterobacter aerogenes UCI 47 | | synonym -1400144 | Klebsiella aerogenes UCI 47 | | scientific name -1400145 | Enterobacter aerogenes UCI 48 | | synonym -1400145 | Klebsiella aerogenes UCI 48 | | scientific name -1400160 | Klebsiella pneumoniae BIDMC 42a | | scientific name -1400161 | Klebsiella pneumoniae BIDMC 42b | | scientific name -1400162 | Klebsiella pneumoniae BIDMC 45 | | scientific name -1400163 | Klebsiella pneumoniae BIDMC 46a | | scientific name -1400164 | Klebsiella pneumoniae BIDMC 46b | | scientific name -1400165 | Klebsiella pneumoniae BIDMC 47 | | scientific name -1400166 | Klebsiella pneumoniae BIDMC 48 | | scientific name -1400167 | Klebsiella pneumoniae BIDMC 51 | | scientific name -1400168 | Klebsiella pneumoniae BIDMC 52 | | scientific name -1400169 | Klebsiella pneumoniae BIDMC 53 | | scientific name -1400170 | Klebsiella pneumoniae UCI 17 | | scientific name -1400172 | Klebsiella pneumoniae UCI 19 | | scientific name -1400173 | Klebsiella pneumoniae UCI 20 | | scientific name -1400174 | Klebsiella pneumoniae UCI 21 | | scientific name -1400175 | Klebsiella pneumoniae UCI 22 | | scientific name -1400176 | Klebsiella pneumoniae UCI 25 | | scientific name -1400177 | Klebsiella pneumoniae UCI 26 | | scientific name -1400178 | Klebsiella pneumoniae UCI 33 | | scientific name -1400179 | Klebsiella pneumoniae UCI 34 | | scientific name -1400180 | Klebsiella pneumoniae UCI 37 | | scientific name -1400181 | Klebsiella pneumoniae UCI 38 | | scientific name -1400182 | Klebsiella pneumoniae UCI 41 | | scientific name -1400183 | Klebsiella pneumoniae UCI 42 | | scientific name -1400184 | Klebsiella pneumoniae UCI 43 | | scientific name -1400185 | Klebsiella pneumoniae UCI 44 | | scientific name -1401779 | Maiestas | | scientific name -1401779 | Maiestas Distant, 1917 | | authority -1406314 | Klebsiella pneumoniae subsp. pneumoniae PittNDM01 | | scientific name -1409961 | Klebsiella pneumoniae MRSN 1319 | | scientific name -1409962 | Klebsiella pneumoniae MRSN 2404 | | scientific name -1409963 | Klebsiella pneumoniae MRSN 3562 | | scientific name -1409964 | Klebsiella pneumoniae MRSN 3852 | | scientific name -1409965 | Klebsiella pneumoniae MRSN 6902 | | scientific name -1409966 | Klebsiella pneumoniae HE12 | | scientific name -1409966 | Klebsiella pneumoniae MRSN 12230 | | synonym -1411646 | Klebsiella pneumoniae A 860 | | synonym -1411646 | Klebsiella pneumoniae IS10 | | scientific name -1413252 | Klebsiella pneumoniae subsp. pneumoniae KPB-1 | | scientific name -1413253 | Klebsiella pneumoniae subsp. pneumoniae KPB-2 | | scientific name -1414655 | Pepper chlorotic spot virus | | scientific name -1414807 | Pristaulacus compressus | | scientific name -1414807 | Pristaulacus compressus (Spinola, 1808) | | authority -1415246 | Celaenorrhinus maculosa | | scientific name -1415246 | Celaenorrhinus maculosa (Felder & Felder, 1867) | | authority -1415246 | Pterygospidea maculosa | | synonym -1415246 | Pterygospidea maculosa Felder, 1867 | | authority -1416941 | Closterium baillyanum | | scientific name -1416941 | Closterium baillyanum (Brebisson ex Ralfs) Brebisson, 1856 | | authority -1416941 | Closterium didymotocum var. baillyanum | | synonym -1416941 | Closterium didymotocum var. baillyanum Brebisson ex Ralfs, 1848 | | authority -1417983 | Klebsiella pneumoniae subsp. pneumoniae A | | scientific name -1418810 | Mustilizans | | scientific name -1418811 | Mustilia hepatica | | synonym -1418811 | Mustilia hepatica Moore, 1879 | | authority -1418811 | Mustilizans hepatica | | scientific name -1418811 | Mustilizans hepatica Moore, 1879 | | authority -1420012 | Klebsiella pneumoniae 30660/NJST258_1 | | scientific name -1420013 | Klebsiella pneumoniae 30684/NJST258_2 | | scientific name -1424547 | Paspalum pubiflorum | | scientific name -1424547 | Paspalum pubiflorum Rupr. ex E.Fourn., 1886 | | authority -1427476 | Cimodo virus | | scientific name -1427522 | Klebsiella pneumoniae KPM_naseyCln3 | | scientific name -1428763 | TIBOV | | acronym -1428763 | Tibet orbivirus | | scientific name -1431455 | Klebsiella pneumoniae NB60 | | scientific name -1432547 | Klebsiella pneumoniae IS22 | | scientific name -1432550 | Klebsiella pneumoniae IS33 | | scientific name -1432552 | Klebsiella pneumoniae IS43 | | scientific name -1432553 | Klebsiella pneumoniae IS46 | | scientific name -1432554 | Klebsiella pneumoniae IS53 | | scientific name -1432558 | Klebsiella pneumoniae ISC21 | | scientific name -1432561 | Klebsiella pneumoniae IS39 | | scientific name -1432563 | Rottboellia yellow mottle virus | | scientific name -1434070 | Cervus papillomavirus 2 | | scientific name -1434070 | Cervus papillomavirus JSM-2013 | | equivalent name -1434070 | Cervus papillomavirus type 2 | | equivalent name -1435450 | Sclerotinia sclerotiorum umbra-like virus 1 | | scientific name -1436892 | Pea yellow stunt virus | | scientific name -1437010 | Boreoeutheria | | scientific name -1437010 | Boreotheria | | synonym -1437180 | Acrogymnospermae | | scientific name -1437180 | Acrogymnospermae P.D.Cantino & M.J.Donoghue, 2007 | | authority -1437183 | Mesangiospermae | | scientific name -1437183 | Mesangiospermae M.J.Donoghue, J.A.Doyle & P.D.Cantino, 2007 | | authority -1437197 | Petrosaviidae | | scientific name -1437197 | Petrosaviidae S.W.Graham & W.S.Judd, 2007 | | authority -1437201 | Pentapetalae | | scientific name -1437201 | Pentapetalae D.E.Soltis, P.S.Soltis & W.S.Judd, 2007 | | authority -1438697 | Klebsiella pneumoniae BIDMC 54 | | scientific name -1438698 | Klebsiella pneumoniae BIDMC 55 | | scientific name -1438699 | Klebsiella pneumoniae BIDMC 60 | | scientific name -1438701 | Klebsiella pneumoniae BIDMC 68 | | scientific name -1438702 | Klebsiella pneumoniae BIDMC 69 | | scientific name -1438703 | Klebsiella pneumoniae BWH 45 | | scientific name -1438704 | Klebsiella pneumoniae BWH 46 | | scientific name -1438705 | Klebsiella pneumoniae BWH 47 | | scientific name -1438706 | Klebsiella pneumoniae BWH 48 | | scientific name -1438707 | Klebsiella pneumoniae CHS 01 | | scientific name -1438708 | Klebsiella pneumoniae CHS 02 | | scientific name -1438709 | Klebsiella pneumoniae CHS 03 | | scientific name -1438710 | Klebsiella pneumoniae CHS 04 | | scientific name -1438711 | Klebsiella pneumoniae CHS 05 | | scientific name -1438712 | Klebsiella pneumoniae CHS 06 | | scientific name -1438713 | Klebsiella pneumoniae CHS 07 | | scientific name -1438714 | Klebsiella pneumoniae CHS 08 | | scientific name -1438715 | Klebsiella pneumoniae CHS 09 | | scientific name -1438716 | Klebsiella pneumoniae CHS 10 | | scientific name -1438717 | Klebsiella pneumoniae CHS 11 | | scientific name -1438718 | Klebsiella pneumoniae CHS 12 | | scientific name -1438719 | Klebsiella pneumoniae CHS 13 | | scientific name -1438720 | Klebsiella pneumoniae CHS 14 | | scientific name -1438721 | Klebsiella pneumoniae CHS 15 | | scientific name -1438722 | Klebsiella pneumoniae CHS 16 | | scientific name -1438723 | Klebsiella pneumoniae CHS 17 | | scientific name -1438724 | Klebsiella pneumoniae CHS 18 | | scientific name -1438725 | Klebsiella pneumoniae CHS 19 | | scientific name -1438726 | Klebsiella pneumoniae CHS 20 | | scientific name -1438727 | Klebsiella pneumoniae CHS 21 | | scientific name -1438728 | Klebsiella pneumoniae CHS 22 | | scientific name -1438729 | Klebsiella pneumoniae CHS 23 | | scientific name -1438730 | Klebsiella pneumoniae CHS 24 | | scientific name -1438731 | Klebsiella pneumoniae CHS 25 | | scientific name -1438732 | Klebsiella pneumoniae CHS 26 | | scientific name -1438733 | Klebsiella pneumoniae CHS 27 | | scientific name -1438734 | Klebsiella pneumoniae CHS 28 | | scientific name -1438735 | Klebsiella pneumoniae CHS 29 | | scientific name -1438736 | Klebsiella pneumoniae CHS 30 | | scientific name -1438737 | Klebsiella pneumoniae CHS 31 | | scientific name -1438738 | Klebsiella pneumoniae CHS 32 | | scientific name -1438739 | Klebsiella pneumoniae CHS 33 | | scientific name -1438740 | Klebsiella pneumoniae CHS 34 | | scientific name -1438741 | Klebsiella pneumoniae CHS 35 | | scientific name -1438742 | Klebsiella pneumoniae CHS 36 | | scientific name -1438743 | Klebsiella pneumoniae CHS 37 | | scientific name -1438744 | Klebsiella pneumoniae CHS 38 | | scientific name -1438745 | Klebsiella pneumoniae CHS 39 | | scientific name -1438746 | Klebsiella pneumoniae CHS 40 | | scientific name -1438747 | Klebsiella pneumoniae CHS 41 | | scientific name -1438748 | Klebsiella pneumoniae CHS 42 | | scientific name -1438749 | Klebsiella pneumoniae CHS 43 | | scientific name -1438750 | Klebsiella pneumoniae CHS 44 | | scientific name -1438751 | Klebsiella pneumoniae CHS 45 | | scientific name -1438752 | Klebsiella pneumoniae CHS 46 | | scientific name -1438753 | Klebsiella pneumoniae CHS 47 | | scientific name -1438754 | Klebsiella pneumoniae CHS 48 | | scientific name -1438755 | Klebsiella pneumoniae CHS 49 | | scientific name -1438756 | Klebsiella pneumoniae CHS 50 | | scientific name -1438757 | Klebsiella pneumoniae CHS 51 | | scientific name -1438758 | Klebsiella pneumoniae CHS 52 | | scientific name -1438759 | Klebsiella pneumoniae CHS 53 | | scientific name -1438760 | Klebsiella pneumoniae CHS 54 | | scientific name -1438761 | Klebsiella pneumoniae CHS 55 | | scientific name -1438762 | Klebsiella pneumoniae CHS 56 | | scientific name -1438763 | Klebsiella pneumoniae CHS 57 | | scientific name -1438764 | Klebsiella pneumoniae CHS 58 | | scientific name -1438765 | Klebsiella pneumoniae CHS 59 | | scientific name -1438766 | Klebsiella pneumoniae CHS 60 | | scientific name -1438767 | Klebsiella pneumoniae CHS 61 | | scientific name -1438768 | Klebsiella pneumoniae CHS 62 | | scientific name -1438769 | Klebsiella pneumoniae CHS 63 | | scientific name -1438770 | Klebsiella pneumoniae CHS 64 | | scientific name -1438771 | Klebsiella pneumoniae CHS 65 | | scientific name -1438772 | Klebsiella pneumoniae CHS 66 | | scientific name -1438773 | Klebsiella pneumoniae CHS 67 | | scientific name -1438774 | Klebsiella pneumoniae CHS 70 | | scientific name -1438775 | Klebsiella pneumoniae CHS 71 | | scientific name -1438776 | Klebsiella pneumoniae CHS 72 | | scientific name -1438777 | Klebsiella pneumoniae CHS 73 | | scientific name -1438778 | Klebsiella pneumoniae CHS 74 | | scientific name -1438779 | Klebsiella pneumoniae CHS 75 | | scientific name -1438780 | Klebsiella pneumoniae CHS 76 | | scientific name -1438781 | Klebsiella pneumoniae CHS 80 | | scientific name -1438782 | Klebsiella pneumoniae MGH 51 | | scientific name -1438783 | Klebsiella pneumoniae MGH 52 | | scientific name -1438784 | Klebsiella pneumoniae MGH 59 | | scientific name -1438785 | Klebsiella pneumoniae MGH 60 | | scientific name -1438786 | Klebsiella pneumoniae MGH 63 | | scientific name -1438787 | Klebsiella pneumoniae MGH 64 | | scientific name -1438788 | Klebsiella pneumoniae MGH 65 | | scientific name -1438789 | Klebsiella pneumoniae MGH 66 | | scientific name -1438790 | Klebsiella pneumoniae MGH 67 | | scientific name -1438792 | Klebsiella pneumoniae MGH 69 | | scientific name -1438793 | Klebsiella pneumoniae MGH 70 | | scientific name -1438794 | Klebsiella pneumoniae MGH 71 | | scientific name -1438795 | Klebsiella pneumoniae MGH 72 | | scientific name -1438796 | Klebsiella pneumoniae MGH 73 | | scientific name -1438797 | Klebsiella pneumoniae MGH 74 | | scientific name -1438798 | Klebsiella pneumoniae MGH 75 | | scientific name -1438800 | Klebsiella pneumoniae MGH 79 | | scientific name -1438802 | Klebsiella pneumoniae UCI 55 | | scientific name -1438803 | Klebsiella pneumoniae UCI 56 | | scientific name -1438804 | Klebsiella pneumoniae UCI 59 | | scientific name -1438805 | Klebsiella pneumoniae UCI 60 | | scientific name -1438806 | Klebsiella pneumoniae UCI 61 | | scientific name -1438807 | Klebsiella pneumoniae UCI 62 | | scientific name -1438808 | Klebsiella pneumoniae UCI 63 | | scientific name -1438809 | Klebsiella pneumoniae UCI 64 | | scientific name -1438810 | Klebsiella pneumoniae UCI 67 | | scientific name -1438811 | Klebsiella pneumoniae UCI 68 | | scientific name -1439320 | Enterobacter aerogenes MGH 61 | | synonym -1439320 | Klebsiella aerogenes MGH 61 | | scientific name -1439321 | Enterobacter aerogenes MGH 62 | | synonym -1439321 | Klebsiella aerogenes MGH 62 | | scientific name -1439322 | Enterobacter aerogenes MGH 77 | | synonym -1439322 | Klebsiella aerogenes MGH 77 | | scientific name -1439323 | Enterobacter aerogenes MGH 78 | | synonym -1439323 | Klebsiella aerogenes MGH 78 | | scientific name -1442610 | Myotis evotis milleri | | scientific name -1442610 | Myotis evotis milleri Elliot, 1903 | | authority -1442610 | Myotis evotis subsp. milleri | | synonym -1442610 | Myotis evotis subsp. milleri Elliot, 1903 | | authority -1442610 | Myotis milleri | | synonym -1445963 | Cycadidae | | scientific name -1445963 | Cycadidae Pax, 1894 | | authority -1446379 | Cupressales | | scientific name -1446379 | Cupressales Link, 1829 | | authority -1449984 | Klebsiella pneumoniae T2-1-1 | | scientific name -1449985 | Klebsiella pneumoniae T2-1-2 | | scientific name -1451263 | Klebsiella pneumoniae JT4 | | scientific name -1451298 | Anatoecus dentatus | | scientific name -1451298 | Anatoecus dentatus (Scopoli, 1763) | | authority -1451298 | Pediculus dentatus | | synonym -1451298 | Pediculus dentatus Scopoli, 1763 | | authority -1452516 | Caprine kobuvirus | | scientific name -1453155 | Histia flabellicorn | | synonym -1453155 | Histia flabellicornis ultima | | synonym -1453155 | Histia rhodope | | scientific name -1453155 | Histia rhodope (Cramer, 1775) | | authority -1453426 | Klebsiella pneumoniae ST514 | | scientific name -1454021 | Dragonfly larvae associated circular virus-1 | | scientific name -1454022 | Dragonfly larvae associated circular virus-10 | | scientific name -1454022 | Dragonfly larvae associated virus 10 | | equivalent name -1454023 | Dragonfly larvae associated circular virus-2 | | scientific name -1454024 | Dragonfly larvae associated circular virus-3 | | scientific name -1454024 | Dragonfly larvae associated virus 3 | | equivalent name -1454025 | Dragonfly larvae associated circular virus-4 | | scientific name -1454026 | Dragonfly larvae associated circular virus-5 | | scientific name -1454026 | Dragonfly larvae associated virus 5 | | equivalent name -1454027 | Dragonfly larvae associated circular virus-6 | | scientific name -1454027 | Dragonfly larvae associated virus 6 | | equivalent name -1454028 | Dragonfly larvae associated circular virus-7 | | scientific name -1454029 | Dragonfly larvae associated circular virus-8 | | scientific name -1454029 | Dragonfly larvae associated virus 8 | | equivalent name -1454030 | Dragonfly larvae associated circular virus-9 | | scientific name -1454227 | Ageratum yellow vein China alphasatellite | | scientific name -1455602 | Klebsiella pneumoniae 4006 | | scientific name -1455603 | Klebsiella pneumoniae 4541-2 | | scientific name -1455604 | Klebsiella pneumoniae 11227-1 | | scientific name -1455605 | Klebsiella pneumoniae 7699 | | scientific name -1457165 | Wallerfield virus | | scientific name -1457322 | Arrabida virus | | scientific name -1457503 | Dahlstedtia araripensis | | scientific name -1457503 | Dahlstedtia araripensis (Benth.) M.J.Silva & A.M.G.Azevedo, 2012 | | authority -1457503 | Lonchocarpus araripensis | | synonym -1457503 | Lonchocarpus araripensis Benth., 1860 | | authority -1458186 | Alphasatellites | | equivalent name -1458186 | Alphasatellitidae | | scientific name -1460422 | Klebsiella pneumoniae subsp. pneumoniae ST258 | | scientific name -1461176 | Podophylloideae | | scientific name -1461176 | Podophylloideae Eaton, 1836 | | authority -1462681 | Pepo aphid-borne yellows virus | | scientific name -1462682 | Luffa aphid-borne yellows virus | | scientific name -1462708 | Luffa acutangula var. amara | | scientific name -1462708 | Luffa acutangula var. amara (Roxb.) C.B.Clarke, 1879 | | authority -1462708 | Luffa amara | | synonym -1462708 | Luffa amara Roxb., 1832 | | authority -1462709 | Luffa acutangula var. forskalii | | scientific name -1462709 | Luffa acutangula var. forskalii (Schweinf. ex Harms) Heiser & E.E.Schill., 1990 | | authority -1462709 | Luffa forskaolii | | synonym -1462709 | Luffa forskaolii Schweinf. ex Harms, 1923 | | authority -1463138 | Ranunculoideae | | scientific name -1463138 | Ranunculoideae Arn., 1832 | | authority -1463140 | Delphinieae | | scientific name -1463140 | Delphinieae Schroed., 1909 | | authority -1463147 | Anemoneae | | scientific name -1463147 | Anemoneae DC., 1817 | | authority -1463675 | Centropus bengalensis | | scientific name -1463675 | Centropus bengalensis (Gmelin, 1788) | | authority -1463675 | Cuculus bengalensis | | synonym -1463675 | Cuculus bengalensis Gmelin, 1788 | | authority -1463675 | lesser coucal | | genbank common name -1471299 | Grapevine Roditis leaf discoloration-associated virus | | scientific name -1471299 | Grapevine roditis leaf discoloration virus | | equivalent name -1476584 | Currant latent virus | | scientific name -1481465 | Tomato necrotic dwarf virus | | scientific name -1484106 | Anemone japonica var. tomentosa | | synonym -1484106 | Anemone japonica var. tomentosa Maxim., 1889 | | authority -1484106 | Anemone tomentosa | | scientific name -1484106 | Anemone tomentosa (Maxim.) C.Pei, 1933 | | authority -1489341 | Osteoglossocephalai | | scientific name -1489388 | Euteleosteomorpha | | scientific name -1489872 | Percomorpha | | includes -1489872 | Percomorphaceae | | scientific name -1489875 | Gobiaria | | scientific name -1489875 | Gobiomorpharia | | synonym -1489878 | Gobiiformes | | scientific name -1489878 | gobies and sleepers | | genbank common name -1489885 | Pelagiaria | | scientific name -1489885 | Pelagimorpharia | | synonym -1489885 | Stromateoidei | | synonym -1489894 | Scombriformes | | scientific name -1489894 | Scombroidei | | synonym -1489894 | tunas and others | | genbank common name -1489904 | Carangaria | | scientific name -1489904 | Carangimorpha | | synonym -1489904 | Carangimorphariae | | synonym -1489908 | Ovalentaria | | scientific name -1489908 | Stiassnyiformes | | synonym -1489910 | Cichlomorphae | | scientific name -1489911 | Cichliformes | | scientific name -1489911 | Pholidichthyiformes | | in-part -1489911 | cichlids and convict blennies | | genbank common name -1489922 | Eupercaria | | scientific name -1489922 | Percomorpharia | | synonym -1489943 | Serranoidei | | scientific name -1497848 | Papaya meleira virus | | scientific name -1503289 | BtMr-AlphaCoV/SAX2011 | | scientific name -1503291 | BtNv-AlphaCoV/SC2013 | | scientific name -1503292 | BtRf-AlphaCoV/HuB2013 | | scientific name -1503293 | BtRf-AlphaCoV/YN2012 | | scientific name -1503305 | Buddleja albiflora | | scientific name -1503305 | Buddleja albiflora Hemsl., 1889 | | authority -1504569 | Fox fecal rhabdovirus | | scientific name -1504732 | Hollyhock yellow vein mosaic Islamabad virus | | scientific name -1505891 | Epinephelini | | scientific name -1506574 | Parvovirus | | equivalent name -1506574 | Parvoviruses | | equivalent name -1506574 | Protoparvovirus | | scientific name -1507401 | Bocaparvovirus | | scientific name -1507401 | Bocavirus | | equivalent name -1507402 | unclassified Bocaparvovirus | | scientific name -1507402 | unclassified Bocavirus | | equivalent name -1507725 | Chilli leaf curl India alphasatellite | | scientific name -1510155 | FaHV-1 | | acronym -1510155 | Falconid herpesvirus 1 | | scientific name -1511771 | Avisivirus | | scientific name -1511775 | Gallivirus | | scientific name -1511778 | Mischivirus | | scientific name -1511779 | Mischivirus A | | scientific name -1511782 | Pasivirus | | scientific name -1511783 | Pasivirus A | | scientific name -1511784 | Pasivirus A1 | | scientific name -1511784 | Swine parecho sister-clade virus 1 | | equivalent name -1511784 | Swine pasivirus 1 | | equivalent name -1511804 | Rosavirus | | scientific name -1511809 | Betacryptovirus | | equivalent name -1511809 | Betapartitivirus | | scientific name -1511809 | Cryptovirus | | equivalent name -1511809 | Partitivirus | Partitivirus | in-part -1511809 | White clover cryptic virus 2 group | | equivalent name -1511810 | Alphacryptovirus | Alphacryptovirus | in-part -1511810 | Deltapartitivirus | | scientific name -1511860 | Amalgaviridae | | scientific name -1511911 | Tetraparvovirus | | scientific name -1513238 | Dyokappapapillomavirus | | scientific name -1513243 | Dyopipapillomavirus | | scientific name -1513244 | Dyorhopapillomavirus | | scientific name -1513246 | Dyoxipapillomavirus | | scientific name -1513252 | Dyopipapillomavirus 1 | | scientific name -1513253 | Dyorhopapillomavirus 1 | | scientific name -1513256 | Gammapapillomavirus 11 | | scientific name -1513256 | Human papillomavirus 126-like viruses | | equivalent name -1513260 | Gammapapillomavirus 15 | | scientific name -1513261 | Gammapapillomavirus 16 | | scientific name -1513262 | Gammapapillomavirus 17 | | scientific name -1513263 | Gammapapillomavirus 18 | | scientific name -1513265 | Gammapapillomavirus 20 | | scientific name -1513273 | Xipapillomavirus 2 | | scientific name -1513275 | Upsilonpapillomavirus 3 | | scientific name -1513294 | Nyamiviridae | | scientific name -1513308 | Velarivirus | | scientific name -1520881 | OSLEUM clade | | scientific name -1529392 | Caprine parainfluenza virus 3 | | scientific name -1534549 | unclassified Gallivirus | | scientific name -1535266 | Sida yellow vein mosaic alphasatellite | | scientific name -1537102 | Babesia equi WA | | synonym -1537102 | Babesia equi strain WA | | synonym -1537102 | Theileria equi strain WA | | scientific name -1537975 | Kumasi rhabdovirus | | scientific name -1538075 | Malasseziomycetes | | scientific name -1538075 | Malasseziomycetes Denchev & T. Denchev, 2014 | | authority -1542665 | Mesta yellow vein mosaic virus alphasatellite | | scientific name -1542744 | Gemycircularvirus | | scientific name -1542744 | Gemycircularvirus group | | equivalent name -1548713 | Orthobornavirus alphapsittaciforme | | scientific name -1548713 | Psittaciform 1 bornavirus | | equivalent name -1548713 | Psittaciform 1 orthobornavirus | | equivalent name -1548718 | PaBV-4 | | acronym -1548718 | Parrot bornavirus 4 | | scientific name -1548720 | Orthobornavirus serini | | scientific name -1548720 | Passeriform 1 bornavirus | | equivalent name -1548720 | Passeriform 1 orthobornavirus | | equivalent name -1548722 | Orthobornavirus avisaquaticae | | scientific name -1548722 | Waterbird 1 bornavirus | | equivalent name -1548722 | Waterbird 1 orthobornavirus | | equivalent name -1549198 | Conurus rupicola rupicola | | synonym -1549198 | Conurus rupicola rupicola Tschudi, 1844 | | authority -1549198 | Pyrrhura rupicola rupicola | | scientific name -1549198 | Pyrrhura rupicola rupicola (Tschudi, 1844) | | authority -1549675 | Galloanserae | | scientific name -1549675 | Galloanseri | | synonym -1549675 | ducks, geese, chickens, fowl, quail, currasows and allies | | common name -1549864 | TiLV | | acronym -1549864 | Tilapia lake virus | | scientific name -1550518 | Koolpinyah virus | | scientific name -1554466 | Aegosoma | | scientific name -1562068 | Norway rat rosavirus | | scientific name -1563660 | Sucra jujuba nucleopolyhedrovirus | | scientific name -1563660 | Sucra jujube nucleopolyhedrovirus | | equivalent name -1565088 | Colletotrichum higginsianum non-segmented dsRNA virus 1 | | scientific name -1566705 | Aphalaridae | | scientific name -1566718 | Lanthanaphalara | | scientific name -1567544 | CBS 144400 | CBS 144400 | type material -1567544 | CBS-144400 | CBS-144400 | type material -1567544 | CBS144400 | CBS144400 | type material -1567544 | CBS:144400 | CBS:144400 | type material -1567544 | Fusarium sp. ML-2014i | | includes -1567544 | Fusarium tjaetaba | | scientific name -1567544 | Fusarium tjaetaba T.T.H. Vu, J.L. Walsh, M.H. Laurence, L.W. Burgess, E.C.Y. Liew & Summerell, 2016 | | authority -1567544 | NRRL 66243 | NRRL 66243 | type material -1567544 | NRRL-66243 | NRRL-66243 | type material -1567544 | NRRL66243 | NRRL66243 | type material -1567544 | NRRL:66243 | NRRL:66243 | type material -1567544 | RBG 5361 | RBG 5361 | type material -1567544 | RBG-5361 | RBG-5361 | type material -1567544 | RBG5361 | RBG5361 | type material -1567544 | RBG:5361 | RBG:5361 | type material -1569052 | Elderberry carlavirus A | | scientific name -1569053 | Elderberry carlavirus B | | scientific name -1569054 | Elderberry carlavirus C | | scientific name -1569055 | Elderberry carlavirus D | | scientific name -1569056 | Elderberry carlavirus E | | scientific name -1569258 | Walkabout Creek virus | | scientific name -1573459 | Rosellinia necatrix partitivirus 6 | | scientific name -1577137 | Suffolk virus | | scientific name -1585420 | Liviidae | | scientific name -1592764 | Cyclovirus TsCyV-1_JP-NUBS-2014 | | scientific name -1602124 | Cymbidium chlorotic mosaic virus | | scientific name -1603563 | Human astrovirus 3a | | scientific name -1603564 | Human astrovirus 1b | | scientific name -1604871 | Yak enterovirus | | scientific name -1604875 | OraPyV-Pi | | acronym -1604875 | Sumatran orang-utan polyomavirus | | scientific name -1606764 | unclassified Aphthovirus | | scientific name -1606765 | Bovine rhinovirus 1 | | scientific name -1608041 | Bole Tick Virus 2 | | scientific name -1608042 | Bole Tick Virus 3 | | scientific name -1608044 | Changping Tick Virus 2 | | scientific name -1608045 | Changping Tick Virus 3 | | scientific name -1608047 | Huangpi Tick Virus 1 | | scientific name -1608048 | Huangpi Tick Virus 2 | | scientific name -1608049 | Huangpi Tick Virus 3 | | scientific name -1608058 | Lishi Spider Virus 2 | | scientific name -1608060 | Sanxia Water Strider Virus 1 | | scientific name -1608063 | Sanxia water strider virus 4 | | scientific name -1608063 | SxWSV-4 | | acronym -1608064 | Sanxia Water Strider Virus 5 | | scientific name -1608065 | Shayang Fly Virus 1 | | scientific name -1608066 | Shayang Fly Virus 2 | | scientific name -1608067 | Shayang Fly Virus 3 | | scientific name -1608068 | Shayang Spider Virus 1 | | scientific name -1608072 | Shuangao Bedbug Virus 2 | | scientific name -1608075 | Shuangao Insect Virus 1 | | scientific name -1608083 | Tacheng Tick Virus 1 | | scientific name -1608085 | Tacheng Tick Virus 3 | | scientific name -1608086 | Tacheng Tick Virus 4 | | scientific name -1608087 | Tacheng Tick Virus 5 | | scientific name -1608088 | Tacheng Tick Virus 6 | | scientific name -1608088 | TcTV-6 | | acronym -1608089 | Tacheng Tick Virus 7 | | scientific name -1608090 | Taishun Tick Virus | | scientific name -1608091 | Wenzhou Crab Virus 1 | | scientific name -1608093 | Wenzhou Crab Virus 3 | | scientific name -1608094 | Wenzhou Tick Virus | | scientific name -1608095 | Wenzhou Shrimp Virus 1 | | scientific name -1608097 | Wuchang Cockroach Virus 1 | | scientific name -1608100 | Wuhan Ant Virus | | scientific name -1608101 | Wuhan Fly Virus 1 | | scientific name -1608102 | Wuhan Fly Virus 2 | | scientific name -1608104 | Wuhan House Fly Virus 1 | | scientific name -1608105 | Wuhan House Fly Virus 2 | | scientific name -1608107 | Wuhan Insect virus 2 | | scientific name -1608109 | Wuhan Insect virus 4 | | scientific name -1608110 | Wuhan Insect virus 5 | | scientific name -1608111 | Wuhan Insect virus 6 | | scientific name -1608112 | Wuhan Insect virus 7 | | scientific name -1608114 | Wuhan Louse Fly Virus 10 | | scientific name -1608119 | Wuhan Louse Fly Virus 5 | | scientific name -1608123 | Wuhan Louse Fly Virus 9 | | scientific name -1608126 | Wuhan mosquito virus 1 | | scientific name -1608127 | Wuhan Mosquito Virus 2 | | scientific name -1608133 | Wuhan Mosquito Virus 8 | | scientific name -1608134 | Wuhan Mosquito Virus 9 | | scientific name -1608137 | Wuhan Tick Virus 1 | | scientific name -1608138 | Wuhan tick virus 2 | | scientific name -1608139 | Wuhan horsefly Virus | | scientific name -1608141 | Xincheng Mosquito Virus | | scientific name -1608144 | Yichang Insect virus | | scientific name -1608146 | Yongjia Tick Virus 2 | | scientific name -1608533 | Camponotus yamaokai virus | | scientific name -1609290 | Tomato leaf curl Pakistan betasatellite | | scientific name -1609290 | Tomato leaf curl Pakistan virus betasatellite | | equivalent name -1609290 | Tomato leaf curl Pakistan virus satellite DNA beta | | equivalent name -1611877 | Adana virus | | scientific name -1615583 | Vesivirus ferret badger/JX12/China/2012 | | scientific name -1615758 | Tofla virus | | scientific name -1620892 | Inhangapi virus | | scientific name -1622024 | Desmodus rotundus endogenous retrovirus | | scientific name -1628834 | Porcine kobuvirus JS-01-CHN/2013/China | | scientific name -1628834 | Porcine kobuvirus/JS-01-CHN/2013/China | | equivalent name -1629665 | Botrytis cinerea mitovirus 2 | | scientific name -1629666 | Botrytis cinerea mitovirus 3 | | scientific name -1629667 | Botrytis cinerea mitovirus 4 | | scientific name -1629671 | Botrytis cinerea negative-stranded RNA virus 1 | | scientific name -1631554 | Bovine nidovirus TCH5 | | scientific name -1634381 | Sheep polyomavirus 1 | | scientific name -1639119 | Plasmodiidae | | scientific name -1639119 | Plasmodiidae Mesnil, 1903 | | authority -1640277 | Grapevine Cabernet Sauvignon reovirus | | scientific name -1640277 | Grapevine reovirus LV89-15 | | equivalent name -1642018 | Cherax quadricarinatus densovirus | | scientific name -1642515 | Zebra finch circovirus | | scientific name -1646350 | Trichomonas vaginalis virus dsRNA satellite S1 | | scientific name -1647924 | Human papillomavirus KC5 | | scientific name -1648004 | Bambusinae | | scientific name -1648004 | Bambusinae J.Presl, 1830 | | authority -1648008 | Chusqueinae | | scientific name -1648008 | Chusqueinae Soderstr. & R.P.Ellis, 1987 | | authority -1648023 | Parianinae | | scientific name -1648023 | Parianinae Hack., 1887 | | authority -1648033 | Andropogonodae | | scientific name -1648033 | Andropogonodae L.Liu, 1980 | | authority -1648035 | Bambusodae | | scientific name -1648035 | Bambusodae L.Liou, 1980 | | authority -1648036 | Panicodae | | scientific name -1648036 | Panicodae L.Liou, 1980 | | authority -1648037 | Poodae | | scientific name -1648037 | Poodae L.Liu, 1980 | | authority -1648481 | Antarctic picorna-like virus 1 | | scientific name -1648482 | Antarctic picorna-like virus 2 | | scientific name -1648483 | Antarctic picorna-like virus 3 | | scientific name -1648484 | Antarctic picorna-like virus 4 | | scientific name -1652080 | Poeae Chloroplast Group 1 (Aveneae type) | | scientific name -1653394 | Mammarenavirus | | scientific name -1653395 | Reptarenavirus | | scientific name -1654339 | Sclerotinia sclerotiorum botybirnavirus 1 | | scientific name -1654355 | Kilifi Virus | | scientific name -1654357 | La Jolla virus | | scientific name -1654603 | Areca palm velarivirus 1 | | scientific name -1655644 | Parabacteroides distasonis phage YZ-2015a | | equivalent name -1655644 | Parabacteroides phage YZ-2015a | | scientific name -1655645 | Parabacteroides merdae prophage YZ-2015b | | equivalent name -1655645 | Parabacteroides phage YZ-2015b | | scientific name -1655646 | Gokushovirinae Bog1183_53 | | scientific name -1655647 | Microviridae Bog1249_12 | | scientific name -1655648 | Microviridae Bog5275_51 | | scientific name -1655649 | Gokushovirinae Bog5712_52 | | scientific name -1655650 | Gokushovirinae Bog8989_22 | | scientific name -1655651 | Microviridae Bog9017_22 | | scientific name -1655652 | Microviridae Fen2266_11 | | scientific name -1655653 | Microviridae Fen418_41 | | scientific name -1655654 | Microviridae Fen4707_41 | | scientific name -1655655 | Microviridae Fen51_42 | | scientific name -1655656 | Gokushovirinae Fen672_31 | | scientific name -1655657 | Microviridae Fen685_11 | | scientific name -1655658 | Microviridae Fen7786_21 | | scientific name -1655659 | Gokushovirinae Fen7875_21 | | scientific name -1655660 | Microviridae Fen7895_21 | | scientific name -1655661 | Microviridae Fen7918_21 | | scientific name -1655662 | Microviridae Fen7940_21 | | scientific name -1658615 | PBJV | PBJV | acronym -1658615 | Pebjah virus | | scientific name -1659219 | Kobuvirus cattle/Kagoshima-2-24-KoV/2015/JPN | | scientific name -1659220 | Kagovirus 1 | | equivalent name -1659220 | Kobuvirus cattle/Kagoshima-1-22-KoV/2014/JPN | | scientific name -1661062 | Sclerotinia sclerotiorum fusarivirus 1 | | scientific name -1661062 | SsFV1 | | acronym -1661063 | Fusariviridae | | scientific name -1661392 | Victorian trout aquabirnavirus | | scientific name -1661395 | Ampivirus A1 | | scientific name -1661396 | Magnaporthe oryzae virus 3 | | scientific name -1662272 | Dromedary astrovirus | | scientific name -1662272 | Dromedary camel astrovirus | | equivalent name -1662286 | Marbled eel polyomavirus | | scientific name -1662286 | Marbled eel virus | | equivalent name -1662464 | unclassified Megabirnavirus | | scientific name -1663127 | Posavirus 3 | | scientific name -1663197 | Gnathopogon imberbis taeniellus | | synonym -1663197 | Gnathopogon taeniellus | | scientific name -1663197 | Gnathopogon taeniellus (Nichols, 1925) | | authority -1663197 | Leucogobio taeniellus | | synonym -1663197 | Leucogobio taeniellus Nichols, 1925 | | authority -1667384 | PoLVd | | acronym -1667384 | Portulaca latent viroid | | scientific name -1667587 | Papio ursinus cytomegalovirus | | scientific name -1670662 | Bearded dragon parvovirus | | scientific name -1670669 | Lutzomyia reovirus 1 | | scientific name -1670973 | Gyrovirus GyV8 | | scientific name -1670975 | Ustilaginoidea virens unassigned RNA virus HNND-1 | | scientific name -1671382 | Astrovirus Er/SZAL6/HUN/2011 | | scientific name -1675862 | Diatraea saccharalis granulovirus | | scientific name -1675864 | Opsiphanes invirae iflavirus 1 | | scientific name -1675865 | Perigonia lusca single nucleopolyhedrovirus | | scientific name -1675866 | Urbanus proteus nucleopolyhedrovirus | | scientific name -1676181 | Chimpanzee faeces associated microphage 1 | | scientific name -1676183 | Chimpanzee faeces associated microphage 3 | | scientific name -1676267 | Rosellinia necatrix megabirnavirus 2-W8 | | scientific name -1678003 | Chilli leaf curl Ahmedabad virus-India [India/Ahmedabad/2014] | | scientific name -1678042 | Isophya major | | scientific name -1678042 | Isophya major Brunner von Wattenwyl, 1878 | | authority -1678146 | Chirohepevirus eptesici | | scientific name -1678146 | Orthohepevirus D | | equivalent name -1679172 | Chobar Gorge virus | | scientific name -1679238 | Fusarium oxysporum f. sp. dianthi mycovirus 1 | | scientific name -1679933 | Rattus norvegicus polyomavirus 1 | | scientific name -1680130 | unclassified Endornaviridae | | scientific name -1680130 | unclassified Endornavirus | | equivalent name -1681229 | Blastomyces gilchristii | | scientific name -1681229 | Blastomyces gilchristii Eliz.M. Brown, L.R. McTaggart, Sean X. Zhang, D.E. Low, D.A. Stevens & S.E. Richardson, 2013 | | authority -1681229 | CBS 134223 | CBS 134223 | type material -1681229 | PHO TB00018 | PHO TB00018 | type material -1681229 | TB00018 2005 | TB00018 2005 | type material -1682186 | Bee Macula-like virus | | scientific name -1682187 | Varroa Tymo-like virus | | scientific name -1682340 | Human papillomavirus 201 | | scientific name -1682340 | Human papillomavirus type 201 | | equivalent name -1685502 | Pseudogymnoascus destructans partitivirus-pa | | scientific name -1685502 | Pseudogymnoascus destructans virus | | equivalent name -1685755 | Lake Sarah-associated circular virus-28 | | scientific name -1685953 | Macrosiphum euphorbiae virus 1 | | scientific name -1688637 | Lettuce Italian necrotic virus | | scientific name -1690666 | Bombyx mori iflavirus | | scientific name -1690672 | White sucker hepadnavirus | | equivalent name -1690672 | White sucker hepatitis B virus | | scientific name -1692045 | Tobacco virus 1 | | scientific name -1692107 | Fengkai orbivirus | | scientific name -1692242 | Aiptasia sp. sea anemone associated circular virus | | scientific name -1692243 | Artemia melana sponge associated circular genome | | scientific name -1692244 | Calanoida sp. copepod associated circular virus | | scientific name -1692245 | Callinectes ornatus blue crab associated circular virus | | scientific name -1692246 | Callinectes sapidus associated circular virus | | scientific name -1692247 | Didemnum sp. Sea Squirt associated virus | | scientific name -1692248 | Farfantepenaeus duorarum pink shrimp associated circular virus | | scientific name -1692249 | Fiddler Crab associated circular virus | | scientific name -1692250 | Gammarus sp. amphipod associated circular virus | | scientific name -1692251 | Hermit crab associated circular genome | | scientific name -1692252 | Hermit crab associated circular virus | | scientific name -1692253 | Littorina sp. associated circular virus | | scientific name -1692254 | Lytechinus variegatus variable sea urchin associated circular virus | | scientific name -1692255 | Marine snail associated circular virus | | scientific name -1692256 | Mytilus sp. clam associated circular virus | | scientific name -1692257 | Palaemonetes intermedius brackish grass shrimp associated circular virus | | scientific name -1692258 | Palaemonetes kadiakensis Mississippi grass shrimp associated circular virus | | scientific name -1692259 | Palaemonetes sp. common grass shrimp associated circular virus | | scientific name -1692260 | Paramuricea placomus associated circular virus | | scientific name -1692261 | Petrochirus diogenes giant hermit crab associated circular virus | | scientific name -1692262 | Primnoa pacifica coral associated circular virus | | scientific name -1692263 | Sicyonia brevirostris associated circular virus | | scientific name -1699094 | Poecile atricapillus GI tract-associated gemycircularvirus | | scientific name -1701404 | Gokushovirinae GAIR4 | | scientific name -1701405 | Gokushovirinae GNX3R | | scientific name -1705090 | Luffa begomovirus betasatellite | | scientific name -1705091 | Malachra yellow vein mosaic betasatellite | | scientific name -1705092 | Ageratum conyzoides symptomless alphasatellite | | scientific name -1705297 | Ageratum yellow vein virus-Malaysia [Malaysia-Tomato Leaf curl-2011] | | equivalent name -1705297 | Ageratum yellow vein virus-[Malaysia-Tomato Leaf curl-2011] | | scientific name -1705841 | Iodes cirrhosa | | scientific name -1705841 | Iodes cirrhosa Turcz., 1855 | | authority -1708248 | Aster procerus | | scientific name -1708248 | Aster procerus Hemsl., 1888 | | authority -1708572 | Phopivirus | | equivalent name -1708572 | hepatovirus B1 | | scientific name -1708653 | Gemycircularvirus gemy-ch-rat1 | | scientific name -1708712 | Rosellinia necatrix endornavirus 1 | | scientific name -1711684 | HPEV | | acronym -1711684 | Hot pepper alphaendornavirus | | scientific name -1711684 | Hot pepper endornavirus | | equivalent name -1711685 | Atractylodes mild mottle virus | | scientific name -1712570 | Kasokero virus | | scientific name -1712572 | Yogue virus | | scientific name -1714362 | Red clover powdery mildew-associated totivirus 1 | | scientific name -1714363 | Red clover powdery mildew-associated totivirus 2 | | scientific name -1714364 | Red clover powdery mildew-associated totivirus 3 | | scientific name -1714366 | Red clover powdery mildew-associated totivirus 5 | | scientific name -1714367 | Red clover powdery mildew-associated totivirus 6 | | scientific name -1714368 | Red clover powdery mildew-associated totivirus 7 | | scientific name -1714370 | Red clover powdery mildew-associated totivirus 9 | | scientific name -1714570 | Blueberry shoestring virus | | scientific name -1714618 | unclassified Hepatovirus | | scientific name -1715288 | Avian bornavirus C1 | | equivalent name -1715288 | Canary bornavirus 1 | | scientific name -1715288 | CnBV-1 | | acronym -1720595 | Bellflower vein chlorosis virus | | scientific name -1721090 | Tasmanian aquabirnavirus | | scientific name -1723728 | unassigned Polyomaviridae | | equivalent name -1723728 | unclassified Polyomaviridae | | scientific name -1725329 | Potato necrosis virus | | scientific name -1729112 | Passerellidae | | scientific name -1729112 | Passerellidae (Cabanis and Heine 1850) | | authority -1729141 | Human pegivirus 2 | | scientific name -1729670 | Maize associated totivirus 1 | | equivalent name -1729670 | Maize-associated totivirus 1 | | scientific name -1736759 | Chayote yellow mosaic Benin betasatellite | | scientific name -1737345 | Grapevine latent viroid | | scientific name -1737346 | Apple hammerhead viroid-like circular RNA | | scientific name -1737522 | Bank vole polyomavirus | | scientific name -1737523 | Common vole polyomavirus | | scientific name -1738045 | Andrographis yellow vein leaf curl virus | | equivalent name -1738045 | Begomovirus andrographis | | scientific name -1742594 | Melochia mosaic virus | | scientific name -1742595 | Melochia yellow mosaic virus | | scientific name -1742596 | PavYMV | | acronym -1742596 | Pavonia yellow mosaic virus | | scientific name -1743411 | Gorilla anellovirus | | scientific name -1746057 | Beihai barnacle viurs 1 | | scientific name -1746058 | Bole tick virus 4 | | scientific name -1746059 | Gamboa mosquito virus | | scientific name -1746060 | Sanxia water strider virus 6 | | scientific name -1746061 | Shayang fly virus 4 | | scientific name -1746062 | Shayang spider virus 4 | | scientific name -1746063 | Shuangao insect virus 7 | | scientific name -1746064 | Shuangao lacewing virus 2 | | scientific name -1746065 | Tacheng tick virus 8 | | scientific name -1746066 | Wenling shark virus | | scientific name -1746067 | Wuhan aphid virus 1 | | scientific name -1746068 | Wuhan aphid virus 2 | | scientific name -1746069 | Wuhan centipede virus | | scientific name -1746070 | Wuhan cricket virus | | scientific name -1746071 | Wuhan flea virus | | scientific name -1746072 | Xingshan cricket virus | | scientific name -1746073 | Xinzhou spider virus 2 | | scientific name -1746074 | Xinzhou spider virus 3 | | scientific name -1747648 | unclassified Betapartitivirus | | scientific name -1755198 | Parthenium leaf curl alphasatellite | | scientific name -1755467 | Penicillium aurantiogriseum totivirus 1 | | scientific name -1755752 | Penicillium aurantiogriseum fusarivirus 1 | | scientific name -1755785 | Pleospora typhicola fusarivirus 1 | | scientific name -1755792 | Penicillium janczewskii chrysovirus 1 | | scientific name -1756157 | Penicillium aurantiogriseum partitivirus 1 | | scientific name -1756191 | Megabat bufavirus 1 | | scientific name -1756445 | Rattus norvegicus papillomavirus 3 | | scientific name -1756615 | Ustilaginoidea virens RNA virus 5 | | scientific name -1757958 | Hydrobates tethys kelsalli | | synonym -1757958 | Hydrobates tethys kelsalli (Lowe, PR, 1925) | | authority -1757958 | Oceanodroma tethys kelsalli | | scientific name -1757958 | Oceanodroma tethys kelsalli (Lowe, 1925) | | authority -1757958 | Thalassidroma tethys kelsalli | | synonym -1757958 | Thalassidroma tethys kelsalli Lowe, 1925 | | authority -1758139 | CPSbV | | acronym -1758139 | Colombian potato soil-borne virus | | scientific name -1758883 | Imjin River virus 1 | | scientific name -1761477 | Tomato brown rugose fruit virus | | scientific name -1762023 | Pan troglodytes verus polyomavirus 8 | | scientific name -1763507 | Rat bufavirus SY-2015 | | scientific name -1764085 | Toros virus | | scientific name -1764086 | Zerdali virus | | scientific name -1765736 | Nigrospora oryzae victorivirus 1 | | scientific name -1765754 | Camponotus nipponicus virus | | scientific name -1766554 | Swine enteric coronavirus | | scientific name -1766557 | Gallivirus Pf-CHK1/GV | | scientific name -1766559 | Avisivirus Pf-CHK1/AsV | | scientific name -1766828 | Turnip leaf roll virus | | scientific name -1768064 | Tupaia hepatovirus A | | scientific name -1768874 | Sinapis alba cryptic virus 1 | | scientific name -1769780 | Anopheles C virus | | scientific name -1769949 | Rabbit bocaparvovirus | | scientific name -1770265 | Alfalfa dwarfism associated virus | | equivalent name -1770265 | Alfalfa enamovirus 1 | | equivalent name -1770265 | Alfalfa enamovirus-1 | | equivalent name -1770265 | Enamovirus AEV | | scientific name -1770613 | Thelephora terrestris virus 1 | | scientific name -1770617 | unclassified Capillovirus | | scientific name -1770618 | Currant virus A | | scientific name -1774200 | Pepper yellow leaf curl Thailand virus | | scientific name -1774200 | Pepper yellow leaf curl virus-Thailand | | equivalent name -1774276 | Hordeum vulgare alphaendornavirus | | scientific name -1774276 | Hordeum vulgare endornavirus | | equivalent name -1775963 | Jasmine potyvirus T | | equivalent name -1775963 | Jasmine ringspot virus | | equivalent name -1775963 | Jasmine virus T | | scientific name -1776109 | Goose dicistrovirus | | scientific name -1776153 | Diaphorina citri densovirus | | scientific name -1776177 | Cucumis melo alphaendornavirus | | scientific name -1776177 | Cucumis melo endornavirus | | equivalent name -1777015 | Erysiphe cichoracearum alphaendornavirus | | scientific name -1777015 | Erysiphe cichoracearum endornavirus | | equivalent name -1777016 | Panax notoginseng virus A | | scientific name -1778558 | Ctenophore-associated circular virus 1 | | scientific name -1778559 | Ctenophore-associated circular virus 2 | | scientific name -1778560 | Ctenophore-associated circular virus 3 | | scientific name -1778561 | Ctenophore-associated circular virus 4 | | scientific name -1778570 | Ctenophore-associated circular genome 1 | | scientific name -1778571 | Ctenophore-associated circular genome 2 | | scientific name -1778572 | Ctenophore-associated circular genome 3 | | scientific name -1778573 | Ctenophore-associated circular genome 4 | | scientific name -1778580 | Nectarine marafivirus M | | scientific name -1778580 | Nectarine virus M | | equivalent name -1779340 | Phomopsis longicolla RNA virus 1 | | scientific name -1780507 | Myotis gammaherpesvirus 8 | | scientific name -1781241 | Delisea pulchra RNA virus | | scientific name -1788315 | Rat bocavirus | | scientific name -1792583 | Tobacco mosqueado virus | | scientific name -1795648 | Picornavirales Tottori-HG1 | | scientific name -1798085 | Piscine myocarditis-like virus | | scientific name -1802790 | Icacinales | | scientific name -1802790 | Icacinales Tiegh. ex Tiegh., 1993 | | authority -1803898 | Pepper virus A | | scientific name -1804153 | Marine RNA virus PAL128 | | scientific name -1804154 | Marine RNA virus PAL156 | | scientific name -1804156 | Marine RNA virus PAL473 | | scientific name -1804622 | Suaedoideae | | scientific name -1804623 | Chenopodiaceae | | scientific name -1804623 | Chenopodiaceae Vent., 1799 | | authority -1804623 | goosefoot family | | common name -1805494 | Bamaga virus | | scientific name -1809242 | unclassified Flexiviridae | | equivalent name -1809242 | unclassified Tymovirales | | scientific name -1809767 | Ixeridium yellow mottle virus 1 | | scientific name -1811230 | Callinectes sapidus reovirus 1 | | scientific name -1811408 | Privet leaf blotch-associated virus | | scientific name -1812179 | Bovine calicivirus strain Kirklareli | | scientific name -1812308 | Deinbollia mosaic virus | | scientific name -1812308 | East African cassava mosaic-like virus | | equivalent name -1813613 | Picornavirales Bu-3 | | scientific name -1813615 | Picornavirales Bu-1 | | scientific name -1815581 | Grapevine leafroll-associated virus 13 | | scientific name -1816484 | Cronartium ribicola mitovirus 1 | | scientific name -1816485 | Cronartium ribicola mitovirus 2 | | scientific name -1816486 | Cronartium ribicola mitovirus 3 | | scientific name -1816487 | Cronartium ribicola mitovirus 4 | | scientific name -1816488 | Cronartium ribicola mitovirus 5 | | scientific name -1817526 | Ixeridium yellow mottle virus 2 | | scientific name -1819678 | Cucurbit yellow mosaic alphasatellite | | scientific name -1820326 | Avian paramyxovirus 13 goose/Kazakhstan/5751/2013 | | scientific name -1821222 | Culiseta flavivirus | | scientific name -1821227 | Xishuangbanna aedes flavivirus | | scientific name -1822365 | BoRV-CH15 | | acronym -1822365 | Bovine betaretrovirus CH15 | | equivalent name -1822365 | Bovine retrovirus CH15 | | scientific name -1823757 | Kafue kinda chacma baboon virus | | scientific name -1823757 | Kafue kinda x chacma baboon virus | | equivalent name -1825924 | Barley virus G | | scientific name -1825931 | Tomato yellow leaf curl Shuangbai virus - [Y4536] | | scientific name -1826059 | Enterovirus SEV-gx | | scientific name -1826822 | Alternaria arborescens mitovirus 1 | | scientific name -1833824 | Maize yellow dwarf virus-RMV2 | | scientific name -1833938 | Penicillium digitatum virus 1 | | scientific name -1837089 | Rhizoctonia oryzae-sativae mitovirus 1 | | scientific name -1840528 | Sclerotinia sclerotiorum mycoreovirus 4 | | scientific name -1841147 | Bhindi yellow vein alphasatellite | | scientific name -1843734 | Faeces associated gemycircularvirus 14 | | scientific name -1843734 | Faeces associated gemycircularvirus-14 | | equivalent name -1843735 | Faeces associated gemycircularvirus 15 | | scientific name -1843735 | Faeces associated gemycircularvirus-15 | | equivalent name -1843736 | Faeces associated gemycircularvirus 16 | | scientific name -1843736 | Faeces associated gemycircularvirus-16 | | equivalent name -1843737 | Faeces associated gemycircularvirus 17 | | scientific name -1843737 | Faeces associated gemycircularvirus-17 | | equivalent name -1843738 | Faeces associated gemycircularvirus 18 | | scientific name -1843738 | Faeces associated gemycircularvirus-18 | | equivalent name -1843739 | 49 Fec80061 pig | | acronym -1843739 | Faeces associated gemycircularvirus 19 | | scientific name -1843739 | Faeces associated gemycircularvirus-19 | | equivalent name -1843740 | Faeces associated gemycircularvirus 20 | | scientific name -1843740 | Faeces associated gemycircularvirus-20 | | equivalent name -1843742 | Faeces associated gemycircularvirus 22 | | scientific name -1843742 | Faeces associated gemycircularvirus-22 | | equivalent name -1843761 | Faecal-associated gemycircularvirus-23 | | equivalent name -1843761 | Sewage associated gemycircularvirus 3 | | scientific name -1843761 | Sewage associated gemycircularvirus-3 | | equivalent name -1843761 | Sewage-associated gemycircularvirus 3 | | equivalent name -1843761 | Sewage-associated gemycircularvirus-3 | | equivalent name -1843773 | Porcine associated stool circular virus | | equivalent name -1843773 | Porcine stool-associated circular virus | | scientific name -1844928 | Avian-like circovirus | | scientific name -1848040 | Water chestnut soymovirus 1 | | scientific name -1848042 | Fusarium poae dsRNA virus 2 | | scientific name -1848150 | Fusarium poae mitovirus 1 | | scientific name -1848151 | Fusarium poae mitovirus 2 | | scientific name -1848152 | Fusarium poae mitovirus 3 | | scientific name -1848153 | Fusarium poae mitovirus 4 | | scientific name -1848169 | Fusarium poae dsRNA virus 3 | | scientific name -1849328 | Enterovirus goat/JL14 | | scientific name -1849531 | Fusarium poae narnavirus 1 | | scientific name -1849532 | Fusarium poae narnavirus 2 | | scientific name -1849533 | Fusarium poae partitivirus 2 | | scientific name -1849534 | Fusarium poae virus 1-240374 | | scientific name -1849535 | Fusarium poae victorivirus 1 | | scientific name -1849537 | Fusarium poae fusarivirus 1 | | scientific name -1849542 | Fusarium poae mycovirus 1 | | scientific name -1849543 | Fusarium poae mycovirus 2 | | scientific name -1849544 | Fusarium poae negative-stranded virus 1 | | scientific name -1849545 | Fusarium poae negative-stranded virus 2 | | scientific name -1850906 | Catopsilia pomona nucleopolyhedrovirus | | scientific name -1853762 | Jasmine virus C | | scientific name -1853865 | EcmLV | | acronym -1853865 | Euphorbia caput-medusae latent virus | | scientific name -1856030 | Golden shiner totivirus | | scientific name -1856031 | Pecan mosaic-associated virus | | scientific name -1856627 | Phytomonas serpens narnavirus 1 | | scientific name -1856627 | PserNV1 | | acronym -1856642 | Maize yellow mosaic virus | | scientific name -1857323 | Tospovirus kiwifruit/YXW/2014 | | scientific name -1859149 | Torque teno mini virus 18 | | scientific name -1859161 | Sclerotinia nivalis victorivirus 1 | | scientific name -1862127 | Wild onion symptomless virus | | scientific name -1862824 | Gemycircularvirus HV-GcV1 | | scientific name -1862825 | Gemycircularvirus HV-GcV2 | | scientific name -1862978 | Etheostoma fonticola aquareovirus | | scientific name -1864484 | Ungulate bocaparvovirus 6 | | equivalent name -1864484 | bovine bocaparvovirus 2 | | scientific name -1868472 | Yacon virus A | | scientific name -1869931 | Evergestis extimalis | | scientific name -1869931 | Phalaena extimalis | | synonym -1869931 | Phalaena extimalis Scopoli, 1763 | | authority -1871153 | Nylanderia fulva virus 1 | | scientific name -1871631 | Rhizoctonia solani flexivirus 1 | | scientific name -1872710 | Fusarium graminearum deltaflexivirus 1 | | scientific name -1872719 | Botrytis ourmia like virus | | equivalent name -1872719 | Botrytis ourmia-like virus | | scientific name -1873455 | Atypical porcine pestivirus 1 | | scientific name -1874267 | Maize associated totivirus-2 | | equivalent name -1874267 | Maize-associated totivirus 2 | | scientific name -1874267 | Maize-associated totivirus-2 | | equivalent name -1874886 | Ramie mosaic Yunnan virus | | scientific name -1881013 | Senna mosaic virus | | scientific name -1882382 | Sea otter parvovirus 1 | | scientific name -1882732 | Corythaixoides concolor bechuanae | | scientific name -1882732 | Corythaixoides concolor bechuanae Roberts, 1932 | | authority -1884450 | Husa-like virus KS-2016a | | scientific name -1884455 | Anphevirus | | scientific name -1884456 | Arlivirus | | scientific name -1884458 | Crustavirus | | scientific name -1884460 | Anphevirus xinchengense | | scientific name -1884460 | Xincheng anphevirus | | equivalent name -1884461 | Arlivirus arachnae | | scientific name -1884461 | Lishi arlivirus | | equivalent name -1884640 | Bulleribasidiaceae | | scientific name -1884640 | Bulleribasidiaceae X.Z. Liu, F.Y. Bai, M. Groenew. & Boekhout, 2016 | | authority -1884640 | Bulleribasidiaceae Xin Zhan Liu, F.Y. Bai, M. Groenew. & Boekhout, 2015 | | authority -1884832 | Gompholobium virus A | | scientific name -1884917 | ABBV-2 | | acronym -1884917 | Aquatic bird bornavirus 2 | | scientific name -1884917 | Avian bornavirus MALL | | equivalent name -1884991 | Senna leaf curl virus | | scientific name -1885248 | VSBV-1 | | acronym -1885248 | Variegated squirrel bornavirus 1 | | scientific name -1885927 | Sparus aurata polyomavirus 1 | | scientific name -1885928 | Sparus aurata papillomavirus 1 | | scientific name -1886606 | Callistephus mottle virus | | scientific name -1887213 | Bos taurus papillomavirus 13 | | scientific name -1887213 | Bovine papillomavirus type 13 | | synonym -1887214 | Bos taurus papillomavirus 16 | | scientific name -1887215 | Bos taurus papillomavirus 17 | | scientific name -1887216 | Bos taurus papillomavirus 18 | | scientific name -1887217 | Bos taurus papillomavirus 19 | | scientific name -1887218 | Bos taurus papillomavirus 20 | | scientific name -1887219 | Bos taurus papillomavirus 21 | | scientific name -1888309 | Washington bat picornavirus | | scientific name -1888311 | Bat tymo-like virus | | scientific name -1890365 | Coccinia mottle virus | | scientific name -1890423 | Tomato yellow leaf distortion virus - Sidastrum | | scientific name -1891704 | Sophora japonica powdery mildew-associated partitivirus | | scientific name -1891713 | Alphapolyomavirus | | scientific name -1891714 | Betapolyomavirus | | scientific name -1891715 | Deltapolyomavirus | | scientific name -1891741 | Alphapolyomavirus ponabelii | | scientific name -1891741 | Pongo abelii polyomavirus 1 | | equivalent name -1895012 | Plagiorhegma | | scientific name -1895012 | Plagiorhegma Maxim., 1859 | | authority -1897087 | Mammalian 2 bornavirus | | equivalent name -1897087 | Mammalian 2 orthobornavirus | | equivalent name -1897087 | Orthobornavirus sciuri | | scientific name -1897538 | Common bean-associated gemycircularvirus | | scientific name -1897731 | Aichivirus D | | equivalent name -1897731 | Kobuvirus dekago | | scientific name -1899219 | Synedrella leaf curl virus | | scientific name -1899566 | Ligustrum virus A | | scientific name -1902501 | Rosavirus B | | scientific name -1902502 | Rosavirus C | | scientific name -1903340 | Anopheles flavivirus - variant 1 | | equivalent name -1903340 | Anopheles flavivirus variant 1 | | scientific name -1903412 | Hafniaceae | | scientific name -1903412 | Hafniaceae Adeolu et al. 2016 | | authority -1904408 | Miniopterus schreibersii polyomavirus 1 | | scientific name -1904409 | Miniopterus schreibersii polyomavirus 2 | | scientific name -1904410 | Rhinolophus hildebrandtii polyomavirus 1 | | scientific name -1904411 | Rousettus aegyptiacus polyomavirus 1 | | scientific name -1904439 | Simian retrovirus 8 | | scientific name -1904880 | Macroptilium bright mosaic virus | | scientific name -1904881 | Macroptilium common mosaic virus | | scientific name -1904882 | Sida angular mosaic virus | | scientific name -1904883 | Sida chlorotic vein virus | | scientific name -1904884 | Wissadula yellow mosaic virus | | scientific name -1906179 | Anopheles flavivirus Liberia/2013 | | scientific name -1906245 | Moku virus | | scientific name -1906317 | Grapevine geminivirus A | | scientific name -1906668 | Malvastrum bright yellow mosaic virus | | scientific name -1907771 | Parus major densovirus | | scientific name -1908665 | Myotis oxyotus gardneri | | scientific name -1908665 | Myotis oxyotus gardneri LaVal, 1973 | | authority -1908807 | Ceratobasidium endornavirus B | | scientific name -1908808 | Ceratobasidium endornavirus D | | scientific name -1908811 | Ceratobasidium endornavirus G | | scientific name -1908813 | Ceratobasidium endornavirus C | | scientific name -1910928 | Genomoviridae | | scientific name -1910929 | unclassified Gemycircularvirus | | scientific name -1910929 | unclassified Gemycircularvirus group | | equivalent name -1911602 | Pelarspovirus | | scientific name -1912919 | Isoptera | | synonym -1912919 | Termitoidae | | scientific name -1912919 | termites | termites | blast name -1912919 | termites | termites | genbank common name -1913124 | Cowpea polerovirus 1 | | scientific name -1913125 | Cowpea polerovirus 2 | | scientific name -1914295 | Prunevirus | | scientific name -1914297 | Quinvirinae | | scientific name -1914298 | Trivirinae | | scientific name -1914447 | atypical porcine pestivirus | | scientific name -1916095 | Hydrobates tethys tethys | | synonym -1916095 | Hydrobates tethys tethys (Bonaparte, 1852) | | authority -1916095 | Oceanodroma tethys tethys | | scientific name -1916095 | Oceanodroma tethys tethys (Bonaparte, 1852) | | authority -1916236 | Tobamovirus ToBRTm-2 | | equivalent name -1916236 | Tomato brown rugose fruit virus-israeli | | scientific name -1918013 | Botybirnavirus | | scientific name -1918014 | Botrytis porri RNA virus 1 | | equivalent name -1918014 | Botrytis porri botybirnavirus 1 | | scientific name -1922348 | unclassified RNA viruses ShiM-2016 | | scientific name -1922602 | Beihai picorna-like virus 57 | | scientific name -1922604 | Beihai picorna-like virus 59 | | scientific name -1922669 | Beihai shrimp virus 3 | | scientific name -1922934 | Hubei myriapoda virus 5 | | scientific name -1922938 | Hubei myriapoda virus 9 | | scientific name -1923351 | Jingmen tombus-like virus 1 | | scientific name -1923697 | Wuhan cricket virus 2 | | scientific name -1923716 | Wuhan insect virus 12 | | scientific name -1923726 | Wuhan insect virus 22 | | scientific name -1923736 | Wuhan insect virus 33 | | scientific name -1923737 | Wuhan insect virus 34 | | scientific name -1923738 | Wuhan insect virus 35 | | scientific name -1923739 | Wuhan insect virus 8 | | scientific name -1923740 | Wuhan insect virus 9 | | scientific name -1923742 | Wuhan millipede virus 3 | | scientific name -1923743 | Wuhan nido-like virus 1 | | scientific name -1923745 | Wuhan pillworm virus 2 | | scientific name -1923746 | Wuhan pillworm virus 3 | | scientific name -1923748 | Wuhan poty-like virus 1 | | scientific name -1923752 | Wuhan spider virus 3 | | scientific name -1923753 | Wuhan spider virus 4 | | scientific name -1923754 | Wuhan spider virus 5 | | scientific name -1923755 | Wuhan spider virus 6 | | scientific name -1923756 | Wuhan spider virus 7 | | scientific name -1923757 | Wuhan spider virus 8 | | scientific name -1923758 | Wuhan spider virus 9 | | scientific name -1923759 | Wuhan spirurian nematodes virus 1 | | scientific name -1923761 | Xingshan nematode virus 2 | | scientific name -1923763 | Xingshan nematode virus 4 | | scientific name -1923764 | Xingshan nematode virus 5 | | scientific name -1923765 | Xingshan nematode virus 6 | | scientific name -1923768 | Xinzhou dimarhabdovirus virus 1 | | scientific name -1923769 | Xinzhou nematode virus 1 | | scientific name -1923770 | Xinzhou nematode virus 2 | | scientific name -1923771 | Xinzhou nematode virus 3 | | scientific name -1923772 | Xinzhou nematode virus 4 | | scientific name -1923773 | Xinzhou nematode virus 5 | | scientific name -1923775 | Xinzhou nematode virus 7 | | scientific name -1923777 | Xinzhou toro-like virus | | scientific name -1923778 | Zhejiang mosquito virus 1 | | scientific name -1923781 | Ubei picorna-like virus 3 | | scientific name -1928073 | Maiestas dorsalis | | scientific name -1928073 | Maiestas dorsalis (Motschulsky, 1859) | | authority -1929150 | Enterovirus AN12 | | scientific name -1930602 | Psocodea | | scientific name -1930602 | Psocodea Hennig, 1966 | | authority -1930602 | Psocoptera | | synonym -1930602 | booklice, barklice & lice | booklice, barklice & lice | blast name -1930602 | booklice, barklice & lice | booklice, barklice & lice | genbank common name -1931113 | Pea leaf distortion betasatellite | | scientific name -1936269 | Helicoverpa armigera iflavirus | | scientific name -1938656 | Jingmen tombus-like virus 2 | | scientific name -1940252 | Cacao mild mosaic virus | | scientific name -1940555 | Murine roseolovirus | | scientific name -1941233 | Thrips-associated gemycircularvirus 1 | | equivalent name -1941233 | Thrips-associated genomovirus 1 | | scientific name -1941234 | Thrips-associated gemycircularvirus 2 | | equivalent name -1941234 | Thrips-associated genomovirus 2 | | scientific name -1941235 | unclassified Genomoviridae | | scientific name -1941236 | Gemykibivirus | | scientific name -1941237 | Thrips-associated gemykibivirus 1 | | equivalent name -1941237 | Thrips-associated genomovirus 3 | | scientific name -1941238 | Gemykolovirus | | scientific name -1941239 | Thrips-associated gemykolovirus 1 | | equivalent name -1941239 | Thrips-associated genomovirus 4 | | scientific name -1941435 | Amphibola crenata associated bacilladnavirus 1 | | scientific name -1941436 | Amphibola crenata associated bacilladnavirus 2 | | scientific name -1941437 | Avon-Heathcote estuary associated bacilladnavirus | | scientific name -1950126 | Clematis chlorotic mottle virus | | scientific name -1955054 | Tomato leaf curl Burkina Faso virus | | scientific name -1955247 | Auchenorrhyncha | | scientific name -1955493 | Orbivirus SX-2017a | | scientific name -1955730 | Peach virus D | | scientific name -1958777 | Bat sapelovirus | | scientific name -1958778 | Bat iflavirus | | scientific name -1958784 | Bat dicibavirus | | scientific name -1958957 | Cassava satellite virus | | scientific name -1959930 | Bat sapovirus | | scientific name -1961665 | Qinghai Himalayan marmot astrovirus 1 | | scientific name -1961665 | Qinghai Himalayana marmot AstV1 | | equivalent name -1961666 | Qinghai Himalayan marmot astrovirus 2 | | scientific name -1961666 | Qinghai Himalayana marmot AstV 2 | | equivalent name -1961785 | Rhopapillomavirus 2 | | scientific name -1961833 | Ceuthmochares | | scientific name -1961834 | Ceuthmochares aereus | | scientific name -1961834 | Ceuthmochares aereus (Vieillot, 1817) | | authority -1961834 | Cuculus aereus | | synonym -1961834 | Cuculus aereus Vieillot, 1817 | | authority -1963758 | Myomorpha | | scientific name -1963758 | Sciurognathi | Sciurognathi | in-part -1963758 | mice and others | | genbank common name -1964372 | Circovirus sp. | | scientific name -1965238 | Pityohyphantes rubrofasciatus iflavirus | | scientific name -1965306 | Lagenaria siceraria endornavirus-Hubei | | scientific name -1965344 | LI polyomavirus | | scientific name -1967841 | Tomato yellow mottle-associated virus | | scientific name -1970065 | Alpaca polyomavirus | | scientific name -1972572 | Cocal vesiculovirus | | equivalent name -1972572 | Vesiculovirus cocal | | scientific name -1972589 | Adelaide River ephemerovirus | | equivalent name -1972589 | Ephemerovirus adelaide | | scientific name -1972596 | Ephemerovirus koolpinyah | | scientific name -1972596 | Koolpinyah ephemerovirus | | equivalent name -1972597 | Ephemerovirus yata | | scientific name -1972597 | Yata ephemerovirus | | equivalent name -1972700 | Diamondback moth iflavirus | | scientific name -1972716 | Arracacha virus V | | scientific name -1972995 | Tobacco virus 2 | | scientific name -1973265 | WBV1 | | acronym -1973265 | Wisteria badnavirus 1 | | scientific name -1977105 | Crustavirus wenzhouense | | scientific name -1977105 | Wenzhou crustavirus | | equivalent name -1977392 | Cassava virus X | | scientific name -1978413 | Watermelon betaflexivirus 1 | | equivalent name -1978413 | Watermelon virus A | | scientific name -1978532 | Ledantevirus | | scientific name -1978539 | Ledantevirus yongjia | | scientific name -1978539 | Yongjia ledantevirus | | equivalent name -1978541 | Ledantevirus wuhan | | scientific name -1978541 | Wuhan ledantevirus | | equivalent name -1978543 | Kumasi ledantevirus | | equivalent name -1978543 | Ledantevirus kumasi | | scientific name -1978920 | Raccoon-associated polyomavirus 2 | | scientific name -1980412 | Fimoviridae | | scientific name -1980415 | Nairoviridae | | scientific name -1980416 | Bunyaviridae | | equivalent name -1980416 | Peribunyaviridae | | scientific name -1980417 | Feraviridae | | includes -1980417 | Jonviridae | | includes -1980417 | Phasmaviridae | | scientific name -1980418 | Phenuiviridae | | scientific name -1980419 | Tospoviridae | | scientific name -1980420 | Goukovirus | | scientific name -1980421 | Phasivirus | | scientific name -1980427 | Emaravirus fici | | scientific name -1980427 | Fig mosaic emaravirus | | equivalent name -1980427 | Fig mosaic virus | | equivalent name -1980428 | Emaravirus tritici | | scientific name -1980428 | High Plains wheat mosaic emaravirus | | equivalent name -1980428 | High Plains wheat mosaic virus | | equivalent name -1980429 | Emaravirus cajani | | scientific name -1980429 | Pigeonpea sterility mosaic emaravirus 1 | | equivalent name -1980429 | Pigeonpea sterility mosaic virus 1 | | equivalent name -1980429 | Pigeonpea sterility mosaic virus-I | | equivalent name -1980429 | Pigeonpea sterlity mosaic virus-I | | equivalent name -1980430 | Emaravirus toordali | | scientific name -1980430 | Pigeonpea sterility mosaic emaravirus 2 | | equivalent name -1980430 | Pigeonpea sterility mosaic virus 2 | | equivalent name -1980430 | Pigeonpea sterility mosaic virus II | | equivalent name -1980430 | Pigeonpea sterility mosaic virus-II | | equivalent name -1980430 | Pigeonpea sterlity mosaic virus-II | | equivalent name -1980431 | Emaravirus idaeobati | | scientific name -1980431 | Raspberry leaf blotch emaravirus | | equivalent name -1980431 | Raspberry leaf blotch virus | | equivalent name -1980517 | Nairovirus | | equivalent name -1980517 | Nairoviruses | | equivalent name -1980517 | Orthonairovirus | | scientific name -1980538 | Orthophasmavirus | | scientific name -1985366 | Gemygorvirus | | scientific name -1985372 | bovine associated gemycircularvirus 1 | | scientific name -1985375 | Chickadee associated gemycircularvirus 1 | | scientific name -1985376 | Chicken associated gemycircularvirus 1 | | scientific name -1985377 | Chicken associated gemycircularvirus 2 | | scientific name -1985379 | Equine associated gemycircularvirus 1 | | scientific name -1985392 | Poaceae associated gemycircularvirus 1 | | scientific name -1985392 | Poaceae-associated gemycircularvirus 1 | | equivalent name -1985392 | Poaceae-associated gemycircularvirus-1 | | equivalent name -1985393 | Porcine associated gemycircularvirus 1 | | scientific name -1985405 | Rat associated gemycircularvirus 1 | | scientific name -1985412 | sheep associated gemycircularvirus 1 | | scientific name -1985425 | Canine associated gemygorvirus 1 | | scientific name -1985426 | Mallard associated gemygorvirus 1 | | scientific name -1985699 | Barley yellow striate mosaic cytorhabdovirus | | equivalent name -1985699 | Barley yellow striate mosaic virus | | equivalent name -1985699 | Cytorhabdovirus hordei | | scientific name -1986112 | Bovine nidovirus 1 | | scientific name -1986190 | Alfalfa enamovirus 2 | | scientific name -1986960 | Ampivirus A | | equivalent name -1986960 | Ampivirus apilisi | | scientific name -1986961 | Ampivirus | | scientific name -1987123 | Hepatovirus B | | scientific name -1987125 | Hepatovirus D | | scientific name -1987129 | Hepatovirus H | | scientific name -1987130 | Hepatovirus I | | scientific name -1987140 | Rodent hepatovirus RMU101637Micarv2010 | | scientific name -1987140 | Rodent hepatovirus [RMU101637Micarv2010] | | equivalent name -1987144 | Hedgehog hepatovirus Igel8Erieur2014 | | scientific name -1987144 | Hedgehog hepatovirus [Igel8Erieur2014] | | equivalent name -1987145 | Shrew hepatovirus KS121232Sorara2012 | | scientific name -1987145 | Shrew hepatovirus [KS121232Sorara2012] | | equivalent name -1987744 | Squirrel associated cyclovirus 1 | | scientific name -1993640 | Tolecusatellitidae | | scientific name -2003309 | Bat associated circovirus 4 | | scientific name -2003309 | Tadarida brasiliensis circovirus 1 | | equivalent name -2003394 | Alphaendornavirus | | scientific name -2003394 | Endornavirus | | equivalent name -2003395 | Betaendornavirus | | scientific name -2004962 | Human associated gemykibivirus 5 | | scientific name -2005033 | Anoeconeossa | | scientific name -2006147 | Myodes glareolus polyomavirus 1 | | scientific name -2006148 | Microtus arvalis polyomavirus 1 | | scientific name -2006158 | Betapolyomavirus octipanos | | scientific name -2006158 | Pan troglodytes polyomavirus 8 | | equivalent name -2010320 | French bean leaf curl betasatellite | | scientific name -2010321 | Momordica yellow mosaic betasatellite | | scientific name -2018325 | Tettigoniidea | | scientific name -2020310 | Aegosoma sinicum | | scientific name -2020310 | Aegosoma sinicum White, 1853 | | authority -2021209 | Human astrovirus 4c | | scientific name -2022639 | Solinviviridae | | scientific name -2022641 | Nyfulvavirus | | scientific name -2022857 | Capulavirus | | scientific name -2022857 | Capulaviruses | | equivalent name -2029065 | Hemerobiiformia | | scientific name -2034996 | Tilapia tilapinevirus | | equivalent name -2034996 | Tilapinevirus tilapiae | | scientific name -2034997 | Tilapinevirus | | scientific name -2038729 | Black medic leaf roll virus | | scientific name -2038729 | Black medic leafroll virus | | equivalent name -2039307 | Cirsium japonicum var. spinossimum | | scientific name -2039307 | Cirsium japonicum var. spinossimum (Kitam.) Kitam., 1944 | | authority -2039307 | Cirsium maackii var. spinossimum | | synonym -2039307 | Cirsium maackii var. spinossimum Kitam., 1937 | | authority -2045258 | Nemaliophycidae | | scientific name -2045261 | Rhodymeniophycidae | | scientific name -2047826 | Calophya californica | | scientific name -2047826 | Calophya californica Schwarz, 1904 | | authority -2048238 | Tetraonchoididae | | scientific name -2048239 | Paratetraonchoides | | scientific name -2048240 | Paratetraonchoides inermis | | scientific name -2048240 | Paratetraonchoides inermis Bychowsky, Gussev & Nagibina, 1965 | | authority -2050584 | French bean leaf curl virus | | scientific name -2065824 | Sineleotris | | scientific name -2065826 | Sineleotris saccharae | | scientific name -2065826 | Sineleotris saccharae Herre, 1940 | | authority -2072024 | Mocis latipes granulovirus | | scientific name -2072716 | Spiruromorpha | | scientific name -2080833 | unclassified Avisivirus | | scientific name -2136291 | Obrimoposthia wandeli | | scientific name -2136291 | Obrimoposthia wandeli (Hallez, 1906) | | authority -2169561 | Ortervirales | | scientific name -2169567 | Bacilladnaviridae | | scientific name -2169568 | Deltaflexiviridae | | scientific name -2169569 | Deltaflexivirus | | scientific name -2169574 | Smacoviridae | | scientific name -2169577 | Solemoviridae | | scientific name -2169595 | Firstpapillomavirinae | | scientific name -2169596 | Secondpapillomavirinae | | scientific name -2169609 | Kieseladnavirus | | scientific name -2169610 | Protobacilladnavirus | | scientific name -2169619 | Colecusatellite | | scientific name -2169650 | Alefpapillomavirus | | scientific name -2169663 | Porprismacovirus | | scientific name -2169692 | Alefpapillomavirus 1 | | scientific name -2169693 | Winged bean alphaendornavirus 1 | | scientific name -2169726 | Cacao yellow vein banding virus | | scientific name -2169726 | Cacao yellow vein-banding virus | | equivalent name -2169738 | Tomato yellow leaf curl Shuangbai virus | | scientific name -2169757 | Betapolyomavirus vicugnae | | scientific name -2169757 | Vicugna pacos polyomavirus 1 | | equivalent name -2169801 | Sambucus virus C | | scientific name -2169802 | Sambucus virus D | | scientific name -2169803 | Sambucus virus E | | scientific name -2169864 | Fusarium deltaflexivirus 1 | | scientific name -2169878 | Dyokappapapillomavirus 3 | | scientific name -2169879 | Dyokappapapillomavirus 4 | | scientific name -2169881 | Dyoxipapillomavirus 2 | | scientific name -2169885 | Enterovirus L | | scientific name -2169886 | Epsilonpapillomavirus 2 | | scientific name -2169902 | Gammapapillomavirus 27 | | scientific name -2169960 | Privet ringspot virus | | scientific name -2170064 | Mahlapitsi orthoreovirus | | scientific name -2170064 | Mahlapitsi virus | | equivalent name -2170103 | Thetapolyomavirus trepennellii | | scientific name -2170103 | Trematomus pennellii polyomavirus 1 | | equivalent name -2170103 | Trematomus polyomavirus 1 | | equivalent name -2170117 | Porcine associated porprismacovirus 10 | | scientific name -2170126 | Rat associated porprismacovirus 1 | | scientific name -2170132 | Barbacena virus Y | | scientific name -2170135 | Impatiens flower break potyvirus | | equivalent name -2170135 | Impatiens flower break virus | | scientific name -2170170 | Psipapillomavirus 2 | | scientific name -2170171 | Psipapillomavirus 3 | | scientific name -2170255 | Xipapillomavirus 4 | | scientific name -2172821 | Multicrustacea | | scientific name -2204151 | DNA viruses | | synonym -2204151 | unclassified DNA viruses | | scientific name -2218011 | Anoeconeossa unicornuta | | scientific name -2218011 | Anoeconeossa unicornuta Taylor, 1987 | | authority -2218046 | Diclidophlebia paucipunctata | | synonym -2218046 | Diclidophlebia paucipunctata (Brown & Hodkinson, 1988) | | authority -2218046 | Haplaphalara paucipunctata | | synonym -2218046 | Haplaphalara paucipunctata Brown & Hodkinson, 1988 | | authority -2218046 | Melanastera paucipunctata | | scientific name -2218046 | Melanastera paucipunctata (Brown & Hodkinson, 1988) | | authority -2218050 | Lanthanaphalara mira | | scientific name -2218050 | Lanthanaphalara mira Tuthill, 1959 | | authority -2218081 | Allocarsidara | | scientific name -2218081 | Allocarsidara Hollis, 1987 | | authority -2218082 | Allocarsidara bakeri | | scientific name -2218082 | Allocarsidara bakeri Hollis, 1987 | | authority -2218119 | Homotoma | | scientific name -2218119 | Homotoma Guerin-Meneville, 1844 | | authority -2218120 | Chermes ficus | | synonym -2218120 | Chermes ficus Linnaeus, 1758 | | authority -2218120 | Homotoma ficus | | scientific name -2218120 | Homotoma ficus (Linnaeus, 1758) | | authority -2218135 | Paracarsidara | | scientific name -2218135 | Paracarsidara Heslop-Harrison, 1960 | | authority -2218136 | Carsidara gigantea | | synonym -2218136 | Carsidara gigantea Crawford, 1911 | | authority -2218136 | Paracarsidara gigantea | | scientific name -2218136 | Paracarsidara gigantea (Crawford, 1911) | | authority -2218198 | Psyllinae | | scientific name -2219049 | Husa-like viruses | | equivalent name -2219049 | Husavirus | | scientific name -2219049 | human stool-associated RNA viruses | | equivalent name -2219055 | Porcine stool-associated RNA virus | | equivalent name -2219055 | Porcine stool-associated RNA viruses | | equivalent name -2219055 | Posavirus | | scientific name -2219055 | Posaviruses | | equivalent name -2219250 | Naprepa albicollis | | synonym -2219250 | Ocinara albicollis | | scientific name -2219250 | Ocinara albicollis (Walker, 1862) | | authority -2231382 | NPAAA clade | | scientific name -2231382 | canavanine-accumulating clade | | synonym -2231382 | non-protein amino acid accumulating clade | | synonym -2231384 | genistoids sensu lato | | scientific name -2231385 | core genistoids | | scientific name -2231387 | dalbergioids sensu lato | | scientific name -2231390 | Pterocarpus clade | | scientific name -2231393 | 50 kb inversion clade | | scientific name -2233855 | indigoferoid/millettioid clade | | scientific name -2248770 | Panax notoginseng virus B | | scientific name -2259808 | Mink bocavirus 1 | | scientific name -2290931 | Stenosarchaea | | equivalent name -2290931 | Stenosarchaea Aouad et al. 2018 | | authority -2290931 | Stenosarchaea group | | scientific name -2315733 | Cymbidium banaense | | scientific name -2315733 | Cymbidium banaense Gagnep., 1951 | | authority -2485233 | Apple hammerhead viroid | | equivalent name -2485233 | Pelamoviroid malleusmali | | scientific name -2486284 | Dactylogyridea | | scientific name -2497569 | Negarnaviricota | | scientific name -2497569 | Negative-strand RNA viruses | | common name -2497570 | Haploviricotina | | scientific name -2497571 | Polyploviricotina | | scientific name -2497572 | Chunqiuviricetes | | scientific name -2497574 | Monjiviricetes | | scientific name -2497574 | Mono-Chu-like virus sp. | | equivalent name -2497577 | Insthoviricetes | | scientific name -2499398 | Arnidovirineae | | scientific name -2499399 | Cornidovirineae | | scientific name -2499403 | Tornidovirineae | | scientific name -2499405 | Muvirales | | scientific name -2499407 | Jingchuvirales | | scientific name -2499411 | Articulavirales | | scientific name -2499606 | Simarterivirinae | | scientific name -2499615 | Iotaarterivirus | | scientific name -2499616 | Thetaarterivirus | | scientific name -2501926 | Rhinolophus ferrumequinum alphacoronavirus HuB-2013 | | scientific name -2501927 | Myotis ricketti alphacoronavirus Sax-2011 | | scientific name -2501928 | Nyctalus velutinus alphacoronavirus SC-2013 | | scientific name -2501931 | Orthocoronavirinae | | scientific name -2501940 | Mypoviridae | | scientific name -2501942 | Gerrid arlivirus | | equivalent name -2501942 | Sanstrivirus gerridis | | scientific name -2501945 | Ganiavirus tachengense | | scientific name -2501945 | Tacheng arlivirus | | equivalent name -2501949 | Amnoonviridae | | scientific name -2501952 | Chuviridae | | scientific name -2501968 | Qinviridae | | scientific name -2501970 | Shaspivirus | | scientific name -2501971 | Striwavirus | | scientific name -2501976 | Horwuvirus | | scientific name -2501985 | Xinmoviridae | | scientific name -2501987 | Lispiviridae | | scientific name -2501994 | Shangavirus | | scientific name -2501998 | Wuhivirus | | scientific name -2501999 | Thetaarterivirus kafuba | | scientific name -2507291 | Mivirus | | scientific name -2507320 | Xinzhou mivirus | | scientific name -2507497 | Yingvirus | | scientific name -2507505 | Xinzhou yingvirus | | equivalent name -2507505 | Yingvirus xinzhouense | | scientific name -2508209 | Tobaniviridae | | scientific name -2508239 | Remotovirinae | | scientific name -2508240 | Serpentovirinae | | scientific name -2508241 | Bostovirus | | scientific name -2508242 | Bosnitovirus | | scientific name -2508243 | Infratovirus | | scientific name -2508247 | Xintolivirus | | scientific name -2508251 | Infratovirus 1 | | scientific name -2508258 | Hubavirus | | scientific name -2508259 | Hubavirus myriapedis | | scientific name -2508259 | Myriapod hubavirus | | equivalent name -2509479 | Decacovirus | | scientific name -2509489 | Kaftartevirus | | scientific name -2509500 | Myotacovirus | | scientific name -2509503 | Nyctacovirus | | scientific name -2509509 | Rhinacovirus | | scientific name -2509514 | Tegacovirus | | scientific name -2545470 | Maize sterile stunt virus | | scientific name -2547355 | Bukakata virus | | scientific name -2547356 | Fomede virus | | scientific name -2555566 | Noctuini | | scientific name -2558200 | Accipitriformes | | scientific name -2558200 | hawks & eagles | hawks & eagles | blast name -2558200 | hawks & eagles | hawks & eagles | genbank common name -2559587 | RNA viruses | | common name -2559587 | RNA viruses and retroviruses | | genbank common name -2559587 | RNA viruses and viroids | | common name -2559587 | Riboviria | | scientific name -2560063 | Botourmiaviridae | | scientific name -2560069 | Avulavirinae | | scientific name -2560072 | Calvusvirinae | | scientific name -2560076 | Orthoparamyxovirinae | | scientific name -2560077 | Procedovirinae | | scientific name -2560078 | Regressovirinae | | scientific name -2560088 | Alphanemrhavirus | | scientific name -2560100 | Betachrysovirus | | scientific name -2560105 | Botoulivirus | | scientific name -2560185 | Narmovirus | | scientific name -2560194 | Orthoavulavirus | | scientific name -2560196 | Orthotospovirus | | scientific name -2560196 | Tospovirus | | equivalent name -2560218 | Salisharnavirus | | scientific name -2560230 | Sogarnavirus | | scientific name -2560252 | Wamavirus | | scientific name -2560254 | Wenrivirus | | scientific name -2560289 | Aino orthobunyavirus | | equivalent name -2560289 | Orthobunyavirus ainoense | | scientific name -2560321 | Avian avulavirus 13 | | equivalent name -2560321 | Avian orthoavulavirus 13 | | equivalent name -2560321 | Avian paramyxovirus (APMV/goose/Shimane/67/2000) | | equivalent name -2560321 | Avian paramyxovirus goose/Shimane/67/2000 | | synonym -2560321 | avian paramyxovirus 13 | | scientific name -2560349 | Blackberry virus F | | scientific name -2560351 | Botrytis botoulivirus | | scientific name -2560371 | Canna yellow mottle associated virus | | scientific name -2560371 | Canna yellow mottle-associated virus | | synonym -2560468 | Felid gammaherpesvirus 1 | | scientific name -2560468 | Felis catus gammaherpesvirus 1 | | equivalent name -2560479 | Betachrysovirus foxyspori | | scientific name -2560479 | Fusarium oxysporum chrysovirus 2 | | equivalent name -2560568 | Macaca nemestrina herpesvirus 7 | | equivalent name -2560568 | macacine betaherpesvirus 9 | | scientific name -2560614 | Nectarine stem pitting associated virus | | scientific name -2560614 | Nectarine stem pitting-associated virus | | equivalent name -2560620 | Palmarnavirus 128 | | scientific name -2560621 | Palmarnavirus 156 | | scientific name -2560622 | Palmarnavirus 473 | | scientific name -2560642 | Perigonia lusca nucleopolyhedrovirus | | scientific name -2560648 | Idaeovirus ligustri | | scientific name -2560648 | Privet idaeovirus | | equivalent name -2560649 | Deltapolyomavirus secuprocyonis | | scientific name -2560649 | Procyon lotor polyomavirus 2 | | equivalent name -2560801 | Testudinid alphaherpesvirus 3 | | scientific name -2560801 | Testudinid herpesvirus 3 | | equivalent name -2560801 | tortoise herpesvirus 3 | | equivalent name -2560845 | Alphanemrhavirus xingshan | | scientific name -2560845 | Xingshan alphanemrhavirus | | equivalent name -2560846 | Alphanemrhavirus xinzhou | | scientific name -2560846 | Xinzhou alphanemrhavirus | | equivalent name -2566501 | Cyclorhipidion bodoanum | | scientific name -2566501 | Cyclorhipidion bodoanus (Reitter, 1913) | | authority -2572045 | Tomato brown rugose fruit virus - Palestinian isolate | | scientific name -2576578 | unclassified Salisharnavirus | | scientific name -2585030 | unclassified RNA viruses | | equivalent name -2585030 | unclassified Riboviria | | scientific name -2585815 | Bucco haemacephalus | | synonym -2585815 | Bucco haemacephalus Muller, 1776 | | authority -2585815 | Megalaima haemacephala | | synonym -2585815 | Megalaima haemacephala (Statius Mller, 1776) | | authority -2585815 | Psilopogon haemacephalus | | scientific name -2585815 | coppersmith barbet | | genbank common name -2599620 | unclassified Mivirus | | scientific name -2609695 | DNA satellites | | scientific name -2613861 | unclassified Tospoviridae | | scientific name -2613861 | unclassified Tospovirus | | equivalent name -2621980 | unclassified Hafnia | | scientific name -2622732 | unclassified Haladaptatus | | scientific name -2654645 | Tomato brown rugose fruit virus Tom1-Jo | | scientific name -2670808 | unclassified Begomovirus-associated DNA beta-like sequences | | equivalent name -2670808 | unclassified Betasatellite | | scientific name -2670808 | unclassified betasatellites | | equivalent name -2684882 | Zygnematophycidae | | scientific name -2684882 | Zygnematophycidae Melkonian, Gontcharov & Marin, 2019 | | authority -2691594 | unclassified Rhinacovirus | | scientific name -2692248 | core chlorophytes | | scientific name -2696291 | Ochrophyta | | scientific name -2696291 | Ochrophyta Cavalier-Smith 1986 | | authority -2697495 | Spiralia | | scientific name -2698737 | SAR supergroup | | synonym -2698737 | Sar | | scientific name -2698737 | Sar Burki et al. 2008 | | authority -2707335 | Colletotrichum acutatum species complex | | scientific name -2707348 | Colletotrichum caudatum species complex | | includes -2707348 | Colletotrichum graminicola species complex | | scientific name -2721536 | Schizothoracinae | | scientific name -2731341 | Duplodnaviria | | scientific name -2731341 | double-stranded DNA viruses | | genbank common name -2731342 | Monodnaviria | | scientific name -2731342 | single-stranded DNA viruses | | genbank common name -2731360 | Heunggongvirae | | scientific name -2731361 | Peploviricota | | scientific name -2731363 | Herviviricetes | | scientific name -2732091 | Sangervirae | | scientific name -2732092 | Shotokuvirae | | scientific name -2732396 | Orthornavirae | | scientific name -2732397 | Pararnavirae | | scientific name -2732405 | Duplornaviricota | | scientific name -2732406 | Kitrinoviricota | | scientific name -2732406 | Tombus-Noda-like virus sp. | | equivalent name -2732407 | Lenarviricota | | scientific name -2732408 | Pisuviricota | | scientific name -2732409 | Artverviricota | | scientific name -2732412 | Phixviricota | | scientific name -2732413 | Malgrandaviricetes | | scientific name -2732414 | Petitvirales | | scientific name -2732415 | Cossaviricota | | scientific name -2732416 | Cressdnaviricota | | scientific name -2732416 | eukaryotic Rep-encoding ssDNA viruses | | common name -2732421 | Papovaviricetes | | scientific name -2732422 | Quintoviricetes | | scientific name -2732423 | Arfiviricetes | | scientific name -2732424 | Repensiviricetes | | scientific name -2732458 | Chrymotiviricetes | | scientific name -2732459 | Resentoviricetes | | scientific name -2732461 | Alsuviricetes | | scientific name -2732462 | Flasuviricetes | | scientific name -2732463 | Tolucaviricetes | | scientific name -2732464 | Magsaviricetes | | scientific name -2732498 | Amabiliviricetes | | scientific name -2732499 | Howeltoviricetes | | scientific name -2732500 | Miaviricetes | | scientific name -2732502 | Wolframvirales | | scientific name -2732503 | Cryppavirales | | scientific name -2732504 | Ourlivirales | | scientific name -2732505 | Duplopiviricetes | | scientific name -2732506 | Pisoniviricetes | | scientific name -2732507 | Stelpaviricetes | | scientific name -2732514 | Revtraviricetes | | scientific name -2732515 | Blubervirales | | scientific name -2732532 | Sepolyvirales | | scientific name -2732533 | Zurhausenvirales | | scientific name -2732534 | Piccovirales | | scientific name -2732535 | Baphyvirales | | scientific name -2732536 | Cirlivirales | | scientific name -2732537 | Cremevirales | | scientific name -2732538 | Mulpavirales | | scientific name -2732539 | Geplafuvirales | | scientific name -2732540 | Ghabrivirales | | scientific name -2732541 | Reovirales | | scientific name -2732541 | Reoviridae | | synonym -2732543 | Hepelivirales | | scientific name -2732544 | Martellivirales | | scientific name -2732545 | Amarillovirales | | scientific name -2732546 | Nodamuvirales | | scientific name -2732548 | Luteoviridae | | includes -2732548 | Tolivirales | | scientific name -2732549 | Durnavirales | | scientific name -2732550 | Patatavirales | | scientific name -2732551 | Stellavirales | | scientific name -2732553 | Sobelivirales | | scientific name -2732890 | Mayoviridae | | scientific name -2732892 | Mitoviridae | | scientific name -2733223 | Aquambidensovirus | | scientific name -2733224 | Blattambidensovirus | | scientific name -2733246 | Arurhavirus | | scientific name -2733248 | Betanucleorhabdovirus | | scientific name -2733254 | Sunrhavirus | | scientific name -2733256 | Bandavirus | | scientific name -2733256 | Banyangvirus | | equivalent name -2733291 | Parahepadnavirus | | scientific name -2733293 | Vaccinivirus | | scientific name -2734294 | Alphapolyomavirus quardecihominis | | scientific name -2734294 | Human polyomavirus 14 | | equivalent name -2734349 | Rosellinia necatrix betaendornavirus 1 | | scientific name -2734371 | Arurhavirus inhangapi | | scientific name -2734371 | Inhangapi arurhavirus | | equivalent name -2734385 | Cytorhabdovirus lycopersici | | scientific name -2734385 | Tomato yellow mottle-associated cytorhabdovirus | | equivalent name -2734386 | Cytorhabdovirus alphawuhaninsectum | | scientific name -2734386 | Wuhan 4 insect cytorhabdovirus | | equivalent name -2734387 | Cytorhabdovirus betawuhaninsectum | | scientific name -2734387 | Wuhan 5 insect cytorhabdovirus | | equivalent name -2734388 | Cytorhabdovirus gammawuhaninsectum | | scientific name -2734388 | Wuhan 6 insect cytorhabdovirus | | equivalent name -2734409 | Sunrhavirus walkabout | | scientific name -2734409 | Walkabout sunrhavirus | | equivalent name -2734433 | Adana phlebovirus | | equivalent name -2734433 | Phlebovirus adanaense | | scientific name -2734594 | Kabutovirus | | synonym -2734594 | Uukuvirus | | scientific name -2741926 | Amblemini | | scientific name -2741929 | Popenaidini | | scientific name -2743705 | Smiliogastrinae | | scientific name -2743714 | Gobionidae | | scientific name -2743715 | Gobioninae | | scientific name -2743716 | Sarcocheilichthyinae | | scientific name -2748958 | Bandavirus dabieense | | scientific name -2748958 | Dabie bandavirus | | synonym -2748958 | Huaiyangshan banyangvirus | | synonym -2748958 | SFTSV | SFTSV | acronym -2748959 | Betanucleorhabdovirus daturae | | scientific name -2748959 | DYVV | | acronym -2748959 | Datura yellow vein betanucleorhabdovirus | | equivalent name -2748967 | Iotaarterivirus pejah | | scientific name -2748967 | PBJV | PBJV | acronym -2756270 | Monochamus alternatus alternatus | | scientific name -2768478 | Deltocephalini | | scientific name -2768478 | Deltocephalini Dallas, 1870 | | authority -2785011 | Autobranchia | | scientific name -2785015 | Imparidentia | | scientific name -2788829 | unclassified Resentoviricetes | | scientific name -2788833 | unclassified Tolucaviricetes | | scientific name -2788857 | unclassified Zurhausenvirales | | scientific name -2788865 | unclassified Reovirales | | scientific name -2788865 | unclassified Reoviridae | | synonym -2789204 | Enterobacteria allolevivirus II | | equivalent name -2789204 | Enterobacteria phage FI sensu lato | | equivalent name -2789204 | Escherichia phage FI | | scientific name -2797651 | Zygometra comata | | scientific name -2797651 | Zygometra comata Clark, 1911 | | authority -2810354 | Isognathotermes | | scientific name -2810354 | Isognathotermes Sjostedt, 1926 | | authority -2811596 | Iberoporus pluto | | scientific name -2811596 | Iberoporus pluto Ribera & Reboleira, 2019 | | authority -2812636 | CS clade | | scientific name -2812636 | SV clade | | includes -2821351 | Conifers II | | scientific name -2839668 | Tagiadinae | | scientific name -2840056 | Baculovirus-related double-stranded DNA viruses of arthropods | | common name -2840056 | Naldaviricetes | | scientific name -2840070 | Lefavirales | | scientific name -2841720 | Asterinae | | scientific name -2841720 | Asterinae Dumort., 1827 | | authority -2842243 | Allassoviricetes | | synonym -2842243 | Leviviricetes | | scientific name -2842243 | prokaryotic virus | prokaryotic virus | in-part -2842247 | Levivirales | | synonym -2842247 | Norzivirales | | scientific name -2842313 | Aliusviridae | | scientific name -2842319 | Fiersviridae | | scientific name -2842319 | Leviviridae | | synonym -2842319 | bacterial virus | bacterial virus | in-part -2842319 | bacterial viruses | bacterial viruses | in-part -2842319 | prokaryotic virus | prokaryotic virus | in-part -2842325 | Natareviridae | | scientific name -2842369 | Alphadrosrhavirus | | scientific name -2842407 | Alpharhabdovirinae | | scientific name -2842408 | Betarhabdovirinae | | scientific name -2842542 | Alpharicinrhavirus | | scientific name -2842594 | Charybdivirus | | scientific name -2842607 | Citlodavirus | | scientific name -2842620 | Culicidavirus | | scientific name -2842645 | Diciambidensovirus | | scientific name -2842680 | Felismacovirus | | scientific name -2842848 | Maldovirus | | scientific name -2842882 | Morsusvirus | | scientific name -2842921 | Ollusvirus | | scientific name -2842923 | Omegatorquevirus | | scientific name -2842950 | Penoulivirus | | scientific name -2842995 | Allolevivirus | | synonym -2842995 | Qubevirus | | scientific name -2843481 | Peiartevirus | | scientific name -2843859 | Alpharicinrhavirus bole | | scientific name -2843859 | BlTV-2 | | acronym -2843859 | Bole alpharicinrhavirus | | equivalent name -2843935 | Charybdivirus charybdis | | scientific name -2843935 | WzCV-3 | | acronym -2844037 | Culicidavirus culicidae | | scientific name -2844037 | WhMV-8 | | acronym -2844039 | Culicidavirus imjinense | | scientific name -2844039 | IjRV-1 | | acronym -2844095 | Domestica sigmavirus | | equivalent name -2844095 | Sigmavirus domestica | | scientific name -2844095 | WhFV-2 | | acronym -2844423 | BoGCV1 | | acronym -2844423 | Gemycircularvirus bovas1 | | scientific name -2844427 | ChiGCV1 | | acronym -2844427 | Gemycircularvirus chicas1 | | scientific name -2844428 | ChiGCV2 | | acronym -2844428 | Gemycircularvirus chicas2 | | scientific name -2844429 | ChGCV1 | | acronym -2844429 | Gemycircularvirus chickad1 | | scientific name -2844440 | Gemycircularvirus echiam1 | | scientific name -2844441 | EGCV1 | | acronym -2844441 | Gemycircularvirus equas1 | | scientific name -2844504 | Gemycircularvirus poass1 | | scientific name -2844504 | PGCV1 | | acronym -2844505 | Gemycircularvirus porci1 | | scientific name -2844505 | PoGCV1 | | acronym -2844518 | Gemycircularvirus ratas1 | | scientific name -2844518 | RGCV1 | | acronym -2844528 | Gemycircularvirus sheas1 | | scientific name -2844528 | ShGCV1 | | acronym -2844548 | CGGV1 | | acronym -2844548 | Gemygorvirus cania1 | | scientific name -2844550 | Gemygorvirus malas1 | | scientific name -2844550 | MGGV1 | | acronym -2844569 | Gemykibivirus echi1 | | scientific name -2844585 | Gemykibivirus humas5 | | scientific name -2844585 | HGKV5 | | acronym -2844603 | Gemykibivirus sewopo1 | | scientific name -2844603 | SeGKV1 | | acronym -2844612 | Gemykolovirus echia1 | | scientific name -2844799 | GyV8 | | acronym -2844799 | Gyrovirus fulgla1 | | scientific name -2844804 | GyV4 | GyV4 | acronym -2844804 | Gyrovirus homsa3 | | scientific name -2844833 | Hippoboscid sigmavirus | | equivalent name -2844833 | Sigmavirus hippoboscid | | scientific name -2844833 | WhLFV-9 | | acronym -2844861 | Alphadrosrhavirus hubei | | scientific name -2844861 | Hubei alphadrosrhavirus | | equivalent name -2844861 | WhHFV-2 | | acronym -2845539 | Lousefly sigmavirus | | equivalent name -2845539 | Sigmavirus lousefly | | scientific name -2845539 | WhLFV-10 | | acronym -2845619 | Mivirus boleense | | scientific name -2845620 | CpTV-2 | | acronym -2845620 | Mivirus changpingense | | scientific name -2845621 | CpTV-3 | | acronym -2845621 | Mivirus dermacentoris | | scientific name -2845625 | Mivirus suffolkense | | scientific name -2845625 | SFKV | | acronym -2845626 | Mivirus wuhanense | | scientific name -2845626 | WhTV-2 | | acronym -2845639 | Morsusvirus argatis | | scientific name -2845639 | TcTV-4 | | acronym -2845713 | Ollusvirus shayangense | | scientific name -2845713 | Olluvirus shayangense | | equivalent name -2845835 | Phomosis penoulivirus | | scientific name -2845835 | PlRV1 | | acronym -2845912 | Porprismacovirus porci10 | | scientific name -2845922 | Porprismacovirus porci1 | | scientific name -2845932 | Porprismacovirus ratas1 | | scientific name -2846193 | Alphadrosrhavirus shayang | | scientific name -2846193 | Shayang alphadrosrhavirus | | equivalent name -2846193 | SyFV-3 | | acronym -2846195 | Shayang sigmavirus | | equivalent name -2846195 | Sigmavirus shayang | | scientific name -2846195 | SyFV-1 | | equivalent name -2846667 | Alpharicinrhavirus wuhan | | scientific name -2846667 | WhTV-1 | | acronym -2846667 | Wuhan alpharicinrhavirus | | equivalent name -2846668 | Sigmavirus wuhan | | scientific name -2846668 | WhHFV-1 | | acronym -2846668 | Wuhan sigmavirus | | equivalent name -2847088 | GB virus D | | equivalent name -2847088 | GB virus-D | | scientific name -2847270 | Picornaviridae sp. rodent/RL/PicoV/FJ2015 | | equivalent name -2847270 | rosavirus C4 | | scientific name -2847522 | Herona marathus angustata | | scientific name -2847522 | Herona marathus angustata Moore, 1878 | | authority -2848317 | Trichechus manatus latirostris papillomavirus 4 | | scientific name -2848317 | Trichechus manatus papillomavirus 4 | | equivalent name -2866655 | Bos arnee | | synonym -2866655 | Bos arnee Kerr, 1792 | | authority -2866655 | Bubalus arnee | | scientific name -2866655 | Bubalus arnee (Kerr, 1792) | | authority -2866655 | wild water buffalo | | genbank common name -2867347 | Retinodendron rassak | | synonym -2867347 | Retinodendron rassak Korth., 1840 | | authority -2867347 | Vatica rassak | | scientific name -2867347 | Vatica rassak (Korth.) Blume, 1856 | | authority -2870378 | Miniopterus schreibersii picornavirus 1 | | equivalent name -2870378 | mischivirus A1 | | scientific name -2871195 | rosavirus B1 | | scientific name -2871196 | rosavirus B2 | | scientific name -2876817 | Vatica xishuangbannaensis | | scientific name -2876817 | Vatica xishuangbannaensis G.D.Tao & J.H.Zhang, 1983 | | authority -2890311 | Klebsiella/Raoultella group | | scientific name -2908833 | Neoheterodontei | | scientific name -2914707 | Apachyus feae | | scientific name -2914707 | Apachyus feae de Bormans, 1894 | | authority -2916678 | CTG clade | | common name -2916678 | CUG-Ser1 clade | | genbank common name -2916678 | Serinales | | scientific name -2916678 | Serinales M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority -2927998 | Arremon aurantiirostris erythrorhynchus | | scientific name -2927998 | Arremon aurantiirostris erythrorhynchus Sclater, 1855 | | authority -2927999 | Arremon aurantiirostris spectabilis | | scientific name -2927999 | Arremon aurantiirostris spectabilis Sclater, 1855 | | authority -2928000 | Arremon aurantiirostris occidentalis | | scientific name -2928000 | Arremon aurantiirostris occidentalis Hellmayr, 1911 | | authority -2928001 | Arremon aurantiirostris strictocollaris | | scientific name -2928001 | Arremon aurantiirostris strictocollaris Todd, 1922 | | authority -2928006 | Arremon aurantiirostris aurantiirostris | | scientific name -2928006 | Arremon aurantiirostris aurantiirostris Lafresnaye, 1847 | | authority -2928007 | Arremon aurantiirostris saturatus | | scientific name -2928007 | Arremon aurantiirostris saturatus Cherrie, 1891 | | authority -2928008 | Arremon aurantiirostris santarosae | | scientific name -2928008 | Arremon aurantiirostris santarosae Chapman, 1925 | | authority -2932129 | Phragmipedium hirtzii | | scientific name -2932129 | Phragmipedium hirtzii Dodson, 1988 | | authority -2942679 | Rohanvirales | | scientific name -2942681 | Yadokarivirales | | scientific name -2946186 | Sedoreoviridae | | scientific name -2946186 | Sedoreovirinae | | synonym -2946187 | Spinareoviridae | | scientific name -2946187 | Spinareovirinae | | synonym -2946194 | Yadokariviridae | | scientific name -2946627 | Caphthovirinae | | scientific name -2946630 | Ensavirinae | | scientific name -2946633 | Heptrevirinae | | scientific name -2946635 | Kodimesavirinae | | scientific name -2946639 | Orthohepevirinae | | scientific name -2946640 | Paavivirinae | | scientific name -2946790 | Alphafusarivirus | | scientific name -2946823 | Betafusarivirus | | scientific name -2946827 | Betayadokarivirus | | scientific name -2948661 | Chirohepevirus | | scientific name -2948686 | Duamitovirus | | scientific name -2948721 | Ganiavirus | | scientific name -2948851 | Orthopicobirnavirus | | scientific name -2948851 | Picobirnavirus | | equivalent name -2948893 | Sanstrivirus | | scientific name -2948924 | Thetapolyomavirus | | scientific name -2948930 | Tralespevirus | | scientific name -2948932 | Triamitovirus | | scientific name -2948940 | Unuamitovirus | | scientific name -2955264 | Alphafusarivirus ioaponiae | | scientific name -2955269 | Alphafusarivirus penicilli | | scientific name -2955271 | Alphafusarivirus pleosporae | | scientific name -2955296 | Alphapolyomavirus mischreibersii | | scientific name -2955300 | Alphapolyomavirus ranorvegicus | | scientific name -2955303 | Alphapolyomavirus secumischreibersii | | scientific name -2955369 | Apscaviroid glvd | | equivalent name -2955369 | Apscaviroid latensvitis | | scientific name -2955443 | Betachrysovirus pripenicillii | | scientific name -2955454 | Betafusarivirus sclerotiniae | | scientific name -2955468 | Betapolyomavirus marvalis | | scientific name -2955470 | Betapolyomavirus myoglareolus | | scientific name -2955472 | Betapolyomavirus raegyptiacus | | scientific name -2955492 | Betayadokarivirus ichibani | | scientific name -2955588 | Carlavirus PepVA | | scientific name -2955770 | Duamitovirus boci3 | | scientific name -2955781 | Duamitovirus fupo3 | | scientific name -2955782 | Duamitovirus fupo4 | | scientific name -2955836 | Duamitovirus scsc3 | | scientific name -2956328 | Pospiviroid plvd | | scientific name -2956522 | Thetapolyomavirus spari | | scientific name -2956541 | Tralespevirus gompholobii | | scientific name -2956547 | Triamitovirus rhor1 | | scientific name -2956583 | Unuamitovirus alar1 | | scientific name -2956585 | Unuamitovirus boci2 | | scientific name -2956586 | Unuamitovirus boci4 | | scientific name -2956587 | Unuamitovirus crri1 | | scientific name -2956588 | Unuamitovirus crri2 | | scientific name -2956589 | Unuamitovirus crri3 | | scientific name -2956590 | Unuamitovirus crri4 | | scientific name -2956591 | Unuamitovirus crri5 | | scientific name -2956607 | Unuamitovirus fupo1 | | scientific name -2956608 | Unuamitovirus fupo2 | | scientific name -2960224 | unclassified Ensavirinae | | scientific name -2960910 | unclassified Orthopicobirnavirus | | scientific name -2960910 | unclassified Picobirnavirus | | equivalent name -2965324 | Paris lancifolia | | scientific name -2965324 | Paris lancifolia Hayata, 1906 | | authority -2976112 | Jeffersonieae | | scientific name -2976112 | Jeffersonieae C.L.Hsieh, C.C.Yu & K.F.Chung, 2022 | | authority -2976338 | Myotis nigricans osculatii | | scientific name -2976338 | Myotis nigricans osculatii (Cornalia 1849) | | authority -2976338 | Myotis osculatii | | synonym -2976338 | Myotis osculatii (Cornalia, 1849) | | authority -2976338 | Vespertilio osculatii | | synonym -2976338 | Vespertilio osculatii Cornalia, 1849 | | authority -2980669 | Myotis yumanensis yumanensis | | scientific name -2980669 | Vespertilio yumanensis yumanensis | | synonym -2980669 | Vespertilio yumanensis yumanensis Allen, 1864 | | authority -2982303 | Tricholomatineae | | scientific name -2982303 | Tricholomatineae Aime, Dentinger & Gaya, 2015 | | authority -2982305 | Agaricineae | | scientific name -2982305 | Agaricineae Fr., emend. Aime, Dentinger & Gaya, 2015 | | authority -2982316 | Marasmiineae | | scientific name -2982316 | Marasmiineae Aime, Dentinger & Gaya, 2015 | | authority -2982806 | Jingmenvirus group | | scientific name -2982806 | unclassified Jingmenvirus group | | includes -3004043 | Calorhabdos latifolia | | synonym -3004043 | Calorhabdos latifolia Hemsl., 1890 | | authority -3004043 | Veronicastrum latifolium | | scientific name -3004043 | Veronicastrum latifolium (Hemsl.) T.Yamaz., 1957 | | authority -3039755 | Neodermaptera | | scientific name -3039756 | Epidermaptera | | scientific name -3042114 | Anthophila | Anthophila | scientific name -3042114 | bees | bees | blast name -3042114 | bees | bees | genbank common name -3044472 | Orthoherpesviridae | | scientific name -3047382 | Caulimovirus maculatractylodei | | scientific name -3047678 | Comovirus rugomusivum | | scientific name -3047681 | Waikavirus campanulae | | scientific name -3047686 | Badnavirus phirubi | | scientific name -3047704 | Alphabaculovirus busuppressariae | | scientific name -3047706 | Badnavirus tessellotheobromae | | scientific name -3047715 | Badnavirus venatheobromae | | scientific name -3047722 | Badnavirus alphamaculaflavicannae | | scientific name -3047737 | Alphabaculovirus capomonae | | scientific name -3047760 | Pelarspovirus clematis | | scientific name -3047783 | Cheravirus ribis | | scientific name -3047795 | Betabaculovirus disaccharalis | | scientific name -3047819 | Tombusvirus melongenae | | scientific name -3047843 | Badnavirus venaribis | | scientific name -3047845 | Nepovirus anatoliense | | scientific name -3047850 | Nepovirus deformationis | | scientific name -3047854 | Badnavirus decoloratiovitis | | scientific name -3048157 | Umbravirus ixeridii | | scientific name -3048204 | Betabaculovirus molatipedis | | scientific name -3048218 | Marafivirus nucipersicae | | scientific name -3048219 | Luteovirus nucipersicae | | scientific name -3048236 | Umbravirus papaveri | | scientific name -3048251 | Nepovirus persicae | | scientific name -3048283 | Alphanecrovirus solani | | scientific name -3048345 | Alphabaculovirus sujujubae | | scientific name -3048399 | Betatorquevirus homini32 | | scientific name -3048408 | Iotatorquevirus suida1a | | scientific name -3048442 | Alphabaculovirus urprotei | | scientific name -3048451 | Badnavirus wisteriae | | scientific name -3048458 | Circovirus zebrafinch | | scientific name -3050241 | Circovirus bastao | | scientific name -3050251 | Varicellovirus canidalpha1 | | scientific name -3050258 | Cytomegalovirus cercopithecinebeta5 | | scientific name -3050262 | Scutavirus chelonidalpha5 | | scientific name -3050267 | Mardivirus columbidalpha1 | | scientific name -3050285 | Percavirus felidgamma1 | | scientific name -3050304 | Simplexvirus leporidalpha4 | | scientific name -3050310 | Roseolovirus macacinebeta9 | | scientific name -3050317 | Simplexvirus macropodidalpha1 | | scientific name -3050360 | Scutavirus testudinidalpha3 | | scientific name -3050361 | Betatorquevirus homini18 | | scientific name -3050363 | Bocaparvovirus ungulate6 | | scientific name -3051377 | Orthoavulavirus japanense | | scientific name -3051421 | Alphabaculovirus peluscae | | scientific name -3051977 | Aquambidensovirus decapod1 | | scientific name -3051977 | CqDV | | acronym -3051977 | Decapod ambidensovirus 1 | | synonym -3051977 | Decapod aquambidensovirus 1 | | equivalent name -3051989 | Bandavirus bhanjanagarense | | scientific name -3051989 | Bhanja bandavirus | | equivalent name -3052031 | Bocaparvovirus carnivoran6 | | scientific name -3052031 | Carnivore bocaparvovirus 6 | | equivalent name -3052037 | Bocaparvovirus lagomorph1 | | scientific name -3052037 | Lagomorph bocaparvovirus 1 | | equivalent name -3052043 | Bocaparvovirus rodent1 | | scientific name -3052043 | Rodent bocaparvovirus 1 | | equivalent name -3052135 | Circovirus yaa | | scientific name -3052135 | Tick associated circovirus 1 | | equivalent name -3052163 | Cyclovirus risi | | scientific name -3052180 | Dependoparvovirus squamate2 | | scientific name -3052180 | Squamate dependoparvovirus 2 | | equivalent name -3052183 | DcDV | | acronym -3052183 | Diciambidensovirus hemipteran1 | | scientific name -3052183 | Hemipteran diciambidensovirus 1 | | equivalent name -3052212 | Goukovirus yichangense | | scientific name -3052212 | Yichang insect goukovirus | | equivalent name -3052248 | Horsefly horwuvirus | | equivalent name -3052248 | Horwuvirus wuhanense | | scientific name -3052256 | Iteradensovirus lepidopteran2 | | scientific name -3052256 | Lepidopteran iteradensovirus 2 | | equivalent name -3052258 | Iteradensovirus lepidopteran4 | | scientific name -3052258 | Lepidopteran iteradensovirus 4 | | equivalent name -3052270 | Avon-Heathcote Estuary associated kieseladnavirus | | equivalent name -3052270 | Kieseladnavirus ampcren | | scientific name -3052318 | Arenavirus N27 | | equivalent name -3052318 | MRTV | | acronym -3052318 | Mammarenavirus marientalense | | scientific name -3052318 | Mariental mammarenavirus | | equivalent name -3052318 | Mariental virus | | equivalent name -3052318 | Mariental virus N27 | | equivalent name -3052321 | Arenavirus N73 | | equivalent name -3052321 | Mammarenavirus okahandjaense | | scientific name -3052321 | OKAV | | acronym -3052321 | Okahandja mammarenavirus | | equivalent name -3052321 | Okahandja virus | | equivalent name -3052321 | Okahandja virus N73 | | equivalent name -3052333 | Marafivirus pruni | | scientific name -3052333 | Peach marafivirus D | | equivalent name -3052347 | Morbillivirus phocae | | scientific name -3052353 | Nariva narmovirus | | equivalent name -3052353 | Narmovirus narivaense | | scientific name -3052366 | Omegatorquevirus hominid1 | | scientific name -3052366 | Torque teno hominid virus 1 | | equivalent name -3052437 | Orthobunyavirus schmallenbergense | | scientific name -3052437 | Schmallenberg orthobunyavirus | | equivalent name -3052441 | Orthobunyavirus simbuense | | scientific name -3052441 | Simbu bunyavirus group | | equivalent name -3052441 | Simbu orthobunyavirus | | equivalent name -3052441 | Simbu serogroup | | equivalent name -3052441 | Simbu virus | | equivalent name -3052441 | Simbu virus Group | | equivalent name -3052520 | HpTV-1 | | acronym -3052520 | Huangpi orthonairovirus | | equivalent name -3052520 | Orthonairovirus huangpiense | | scientific name -3052522 | Orthonairovirus japonicum | | scientific name -3052522 | Tofla orthonairovirus | | equivalent name -3052523 | Kasokero orthonairovirus | | equivalent name -3052523 | Orthonairovirus kasokeroense | | scientific name -3052536 | Orthonairovirus tachengense | | scientific name -3052536 | Tacheng orthonairovirus | | equivalent name -3052536 | TcTV-1 | | acronym -3052540 | Orthonairovirus wenzhouense | | scientific name -3052540 | Wenzhou orthonairovirus | | equivalent name -3052540 | WzTV | | acronym -3052541 | Orthonairovirus yogueense | | scientific name -3052541 | YOGV | | acronym -3052541 | Yogue orthonairovirus | | equivalent name -3052543 | Orthophasmavirus aedis | | scientific name -3052543 | Wuhan mosquito orthophasmavirus 2 | | equivalent name -3052553 | Orthophasmavirus wuchangense | | scientific name -3052553 | Wuchang cockroach orthophasmavirus 1 | | equivalent name -3052554 | Orthophasmavirus wuhanense | | scientific name -3052554 | Wuhan mosquito orthophasmavirus 1 | | equivalent name -3052569 | Orthotospovirus capsicimaculaflavi | | scientific name -3052569 | Pepper chlorotic spot orthotospovirus | | equivalent name -3052570 | Chrysanthemum stem necrosis orthotospovirus | | equivalent name -3052570 | Orthotospovirus chrysanthinecrocaulis | | scientific name -3052577 | Iris yellow spot orthotospovirus | | equivalent name -3052577 | Iris yellow spot tospovirus | | equivalent name -3052577 | Orthotospovirus iridimaculaflavi | | scientific name -3052579 | Melon severe mosaic orthotospovirus | | equivalent name -3052579 | Orthotospovirus melotessellati | | scientific name -3052581 | Bean necrotic mosaic orthotospovirus | | equivalent name -3052581 | Orthotospovirus phaseolinecrotessellati | | scientific name -3052606 | Pegivirus H | | equivalent name -3052606 | Pegivirus columbiaense | | scientific name -3052611 | Pegivirus B | | equivalent name -3052611 | Pegivirus pteropi | | scientific name -3052624 | Pestivirus K | | equivalent name -3052624 | Pestivirus scrofae | | scientific name -3052632 | Fly phasivirus | | equivalent name -3052632 | Phasivirus wuhanense | | scientific name -3052632 | WhFV-1 | | acronym -3052633 | Phasivirus wutaiense | | scientific name -3052633 | Wutai Mosquito Virus | | equivalent name -3052633 | Wutai mosquito phasivirus | | equivalent name -3052665 | Munguba phlebovirus | | equivalent name -3052665 | Phlebovirus mungubaense | | scientific name -3052666 | Phlebovirus napoliense | | scientific name -3052685 | Phlebovirus torosense | | scientific name -3052685 | Toros phlebovirus | | equivalent name -3052690 | Phlebovirus zerdaliense | | scientific name -3052690 | Zerdali phlebovirus | | equivalent name -3052702 | Chaetoceros protobacilladnavirus 2 | | equivalent name -3052702 | Protobacilladnavirus chaetoc | | scientific name -3052704 | Protobacilladnavirus hasleos | | scientific name -3052704 | Snail associated protobacilladnavirus 2 | | equivalent name -3052705 | Protobacilladnavirus mudflat | | scientific name -3052705 | Snail associated protobacilladnavirus 1 | | equivalent name -3052711 | Chiropteran protoparvovirus 1 | | equivalent name -3052711 | Protoparvovirus chiropteran1 | | scientific name -3052719 | Protoparvovirus rodent3 | | scientific name -3052719 | Rodent protoparvovirus 3 | | equivalent name -3052723 | Golden reptarenavirus | | equivalent name -3052723 | Reptarenavirus aurei | | scientific name -3052724 | California reptarenavirus | | equivalent name -3052724 | Reptarenavirus californiae | | scientific name -3052730 | Caprine respirovirus 3 | | equivalent name -3052730 | Respirovirus caprae | | scientific name -3052748 | Insect shangavirus | | equivalent name -3052748 | Shangavirus shuangaoense | | scientific name -3052748 | Shuangao insect herbevirus 1 | | equivalent name -3052749 | Shaspivirus aranei | | scientific name -3052749 | Spider shaspivirus | | equivalent name -3052756 | Strider striwavirus | | equivalent name -3052756 | Striwavirus sanxiaense | | scientific name -3052771 | Tetraparvovirus ungulate 1 | | includes -3052771 | Tetraparvovirus ungulate1 | | scientific name -3052771 | Ungulate tetraparvovirus 1 | | equivalent name -3052800 | HpTV-2 | | acronym -3052800 | Huangpi uukuvirus | | equivalent name -3052800 | Uukuvirus huangpiense | | scientific name -3052813 | Blueberry fruit drop associated virus | | equivalent name -3052813 | Vaccinivirus cadovaccinii | | scientific name -3052826 | Shrimp wenrivirus | | equivalent name -3052826 | Wenrivirus penaei | | scientific name -3052827 | Insect wuhivirus | | equivalent name -3052827 | Wuhivirus insecti | | scientific name -3054905 | Moreae | | scientific name -3054905 | Moreae Dumort., 1829 | | authority -3058443 | SCWL tick virus | | scientific name -3058444 | Sichuan tick virus | | scientific name -3059782 | Blattambidensovirus incertum1 | | scientific name -3060718 | Soymovirus eleocharis | | scientific name -3064797 | Haladaptataceae | | scientific name -3064797 | Haladaptataceae Chuvochina et al. 2024 | | synonym -3064797 | Haladaptataceae Cui et al. 2023 | | authority -3072906 | Musteloidea | | scientific name -3073806 | Otidimorphae | | scientific name -3073806 | bustards, cuckoos & allies | | genbank common name -3073808 | Telluraves | | scientific name -3073808 | core landbirds | | genbank common name -3073809 | Australaves | | scientific name -3073809 | Australaves Ericson, 2011 | | authority -3073810 | Coraciimorphae | | scientific name -3073811 | Accipitrimorphae | | scientific name -3073812 | Aequornithes | | scientific name -3073812 | Aequornithes Mayr, 2011 | | authority -3073812 | core waterbirds | | genbank common name -3078114 | Neoaves | | scientific name -3079366 | Hepeviridae | | scientific name -3079366 | Hepeviridae_temp | | equivalent name -3101718 | Carsidarinae | | scientific name -3118152 | Hafnia sp. KE9867 | | scientific name -3137121 | Anemone | | scientific name -3137121 | Anemone L., 1753 | | authority -3143224 | Melanastera | | scientific name -3143224 | Melanastera Serbina, Malenovsky, Queiroz & Burckhardt, 2023 | | authority -3151693 | Bunyaviricetes | | scientific name -3151837 | Elliovirales | | scientific name -3151838 | Gredzevirales | | scientific name -3151839 | Hareavirales | | scientific name -3151840 | Jormunvirales | | scientific name -3151845 | Saturnivirales | | scientific name -3152106 | Adamaviridae | | scientific name -3152107 | Anicreviridae | | scientific name -3152110 | Botybirnaviridae | | scientific name -3152116 | Draupnirviridae | | scientific name -3152119 | Fusagraviridae | | scientific name -3152120 | Gandrviridae | | scientific name -3152124 | Inseviridae | | scientific name -3152126 | Kanorauviridae | | scientific name -3152141 | Orthototiviridae | | scientific name -3152142 | Ouroboviridae | | scientific name -3152144 | Phlegiviridae | | scientific name -3152146 | Pistolviridae | | scientific name -3152147 | Pseudototiviridae | | scientific name -3152207 | Deltarhabdovirinae | | scientific name -3152209 | Feraresvirinae | | scientific name -3152475 | Celebovirus | | scientific name -3152483 | Stoorivirus | | scientific name -3152501 | Manawavirus | | scientific name -3152639 | Gammaricinrhavirus | | scientific name -3152641 | Stangrhavirus | | scientific name -3152653 | Citiorivirus | | scientific name -3152867 | Fusagravirus | | scientific name -3152873 | Satyrivirus | | scientific name -3152905 | Insevirus | | scientific name -3152926 | Ninurtavirus | | scientific name -3153030 | Dorisivirus | | scientific name -3153055 | Tethyvirus | | scientific name -3153067 | Phlegivirus | | scientific name -3153072 | Pistolvirus | | scientific name -3239873 | Dipodascomycetes | | scientific name -3239873 | Dipodascomycetes M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority -3239874 | Pichiomycetes | | scientific name -3239874 | Pichiomycetes M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority -3240463 | Potyvirus alliumagrestis | | scientific name -3240468 | Potyvirus arracachae | | scientific name -3240474 | Potyvirus barbacenense | | scientific name -3240485 | Potyvirus calistephi | | scientific name -3240497 | Potyvirus caryae | | scientific name -3240498 | Potyvirus catharantessellati | | scientific name -3240517 | Potyvirus cyrtanthi | | scientific name -3240525 | Potyvirus duobatatae | | scientific name -3240527 | Potyvirus euphorbiae | | scientific name -3240530 | Potyvirus gebatatae | | scientific name -3240544 | Potyvirus hippeastri | | scientific name -3240546 | Potyvirus impatiensis | | scientific name -3240548 | Potyvirus iriseverum | | scientific name -3240550 | Potyvirus jasmini | | scientific name -3240554 | Potyvirus lactucaitalicense | | scientific name -3240568 | Potyvirus nicotianamaculae | | scientific name -3241188 | apricot vein clearing associated virus | | scientific name -3243772 | Dipodascales | | scientific name -3243772 | Dipodascales M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority -3243775 | Pichiales | | scientific name -3243775 | Pichiales M. Groenew., Hittinger, Opulente & A. Rokas, 2023 | | authority -3303203 | CAH clade | | common name -3303203 | Candidozyma | | scientific name -3303203 | Candidozyma Q.M. Wang, Yurkov, Boekhout & F.Y. Bai, 2024 | | authority -3342348 | Oceanites oceanicus chilensis | | scientific name -3342348 | Oceanites oceanicus chilensis Murphy, 1936 | | authority -3358290 | Formosan arrowfin goby | | genbank common name -3358290 | Oligolepis formosanus | | scientific name -3358290 | Oligolepis formosanus (Nichols, 1958) | | authority -3358290 | Oxyurichthys formosanus | | synonym -3358290 | Oxyurichthys formosanus Nichols, 1958 | | authority -3366610 | "Euryarchaeida" Luketa 2012 | | authority -3366610 | Euryarchaeida | | synonym -3366610 | Methanobacteriati | | scientific name -3366610 | Methanobacteriati (Garrity and Holt 2023) Oren and Goker 2024 | | authority -3368986 | Haladaptatus sp. CMAA 1909 | | scientific name -3368987 | Haladaptatus sp. CMAA 1911 | | scientific name -3379134 | Pseudomonadati | | scientific name -3379134 | Pseudomonadati (Gibbons and Murray 1978) Oren and Goker 2024 | | authority -3390273 | Klebsiella pneumoniae complex | | scientific name -3403061 | Viruses incertae sedis | | scientific name -3412625 | Commensaviricota | | scientific name -3412723 | Cardeaviricetes | | scientific name -3415267 | Alphatotivirineae | | scientific name -3417955 | Entransiales | | scientific name -3417957 | Entransiaceae | | scientific name -3420546 | Sanitavirales | | scientific name -3421323 | Betatotivirineae | | scientific name -3424890 | Alphacytorhabdovirus | | scientific name -3424891 | Betacytorhabdovirus | | scientific name -3424976 | Unirnavirus | | scientific name -3425084 | Crabreovirus | | scientific name -3425096 | Rhabdoviridae incertae sedis | | scientific name -3425105 | Alphaplatrhavirus | | scientific name -3425826 | Ritunrivirus | | scientific name -3426109 | Alphacytorhabdovirus alphawuhaninsectum | | scientific name -3426122 | Alphacytorhabdovirus betawuhaninsectum | | scientific name -3426137 | Alphacytorhabdovirus gammawuhaninsectus | | scientific name -3426146 | Alphacytorhabdovirus lycopersici | | scientific name -3426172 | Alphaendornavirus cucumis | | scientific name -3426174 | Alphaendornavirus erysiphes | | scientific name -3426175 | Alphaendornavirus fucapsici | | scientific name -3426179 | Alphaendornavirus hordei | | scientific name -3426186 | Alphaendornavirus psophocarpi | | scientific name -3426258 | Alphaplatrhavirus vulpes | | scientific name -3426277 | Alpharicinrhavirus huangpi | | scientific name -3426285 | Alpharicinrhavirus taishun | | scientific name -3426347 | Ampelovirus tredecimvitis | | scientific name -3426670 | Begomovirus abelsmoschusomanense | | scientific name -3426674 | Begomovirus ageravenae | | scientific name -3426677 | Begomovirus alceamuvisi | | scientific name -3426712 | Begomovirus capsicumthailandense | | scientific name -3426730 | Begomovirus chlorocucumis | | scientific name -3426765 | Begomovirus deinbolliae | | scientific name -3426792 | Begomovirus gossypiflavi | | scientific name -3426840 | Begomovirus macroptilicommunis | | scientific name -3426844 | Begomovirus macroptilimusivi | | scientific name -3426850 | Begomovirus malvastrumflavi | | scientific name -3426852 | Begomovirus malvastrumhonghense | | scientific name -3426866 | Begomovirus melochiae | | scientific name -3426867 | Begomovirus melochiaflavi | | scientific name -3426880 | Begomovirus nicotianacubaense | | scientific name -3426899 | Begomovirus pavoniaflavi | | scientific name -3426905 | Begomovirus phaseoligallici | | scientific name -3426918 | Begomovirus ramiis | | scientific name -3426929 | Begomovirus sennae | | scientific name -3426935 | Begomovirus sidaflavachinaense | | scientific name -3426951 | Begomovirus sidamusivi | | scientific name -3426968 | Begomovirus sidavenae | | scientific name -3426987 | Begomovirus solanumburkinafasoense | | scientific name -3426990 | Begomovirus solanumcomorosense | | scientific name -3427005 | Begomovirus solanumflavuscontorsionis | | scientific name -3427008 | Begomovirus solanumflavushuangbaiense | | scientific name -3427013 | Begomovirus solanumflavusmaliense | | scientific name -3427043 | Begomovirus solanumliwaense | | scientific name -3427106 | Begomovirus vincae | | scientific name -3427111 | Begomovirus wissadulaflavi | | scientific name -3427192 | Betacytorhabdovirus hordei | | scientific name -3427224 | Betaendornavirus roselliniae | | scientific name -3427248 | Betapartitivirus cannabis | | scientific name -3427251 | Betapartitivirus fusarii | | scientific name -3427352 | Betasatellite momordicae | | scientific name -3427357 | Betasatellite nicotianasheikhupuraense | | scientific name -3427360 | Betasatellite phaseoli | | scientific name -3427361 | Betasatellite pisi | | scientific name -3427400 | Betasatellite solanipakistanense | | scientific name -3427571 | Botoulivirus botrytidis | | scientific name -3427581 | Botybirnavirus ichi | | scientific name -3427583 | Botybirnavirus ni | | scientific name -3427666 | Bymovirus oryzae | | scientific name -3427713 | Capillovirus alpharibis | | scientific name -3427722 | Capulavirus euphorbiae | | scientific name -3427735 | Carlavirus alphacapsici | | scientific name -3427738 | Carlavirus alphaligustri | | scientific name -3427747 | Carlavirus chisolani | | scientific name -3427752 | Carlavirus deltasambuci | | scientific name -3427755 | Carlavirus epsilonsambuci | | scientific name -3427756 | Carlavirus gammasambuci | | scientific name -3427760 | Carlavirus ipomoeae | | scientific name -3427761 | Carlavirus jasmini | | scientific name -3427773 | Carlavirus latensnerinis | | scientific name -3427788 | Carlavirus pisi | | scientific name -3427841 | Celebovirus lorelli | | scientific name -3427963 | Citiorivirus crordgris | | scientific name -3427967 | Citlodavirus citri | | scientific name -3428012 | Closterovirus tabaci | | scientific name -3428035 | Colecusatellite ageravenachinaense | | scientific name -3428042 | Colecusatellite gossypimultanense | | scientific name -3428104 | Crabreovirus callinectes | | scientific name -3428201 | Deltaflexivirus fusarii | | scientific name -3428207 | Deltapartitivirus duocapsici | | scientific name -3428321 | Dorisivirus aiptaes | | scientific name -3428514 | Enterovirus lesimi | | scientific name -3428669 | Felismacovirus porci4 | | scientific name -3428775 | Fijivirus zeae | | scientific name -3428809 | Foveavirus duoasiaticum | | scientific name -3428880 | Fusagravirus hachi | | scientific name -3428898 | Fusagravirus shichi | | scientific name -3428964 | Gammaricinrhavirus tacheng | | scientific name -3429213 | Hepatovirus bephopi | | scientific name -3429215 | Hepatovirus devoli | | scientific name -3429219 | Hepatovirus hedgi | | scientific name -3429220 | Hepatovirus ishrewi | | scientific name -3429932 | Ilarvirus PrRSV | | scientific name -3429955 | Insevirus ichi | | scientific name -3429963 | Insevirus kyu | | scientific name -3429964 | Insevirus ni | | scientific name -3429978 | Ipomovirus cocciniae | | scientific name -3430566 | Macluravirus dioscoreachinense | | scientific name -3430613 | Maldovirus vitis | | scientific name -3430629 | Mamastrovirus hominis | | scientific name -3430652 | Manawavirus kapowais | | scientific name -3430695 | Mastrevirus bourbonense | | scientific name -3430893 | Mischivirus acombewi | | scientific name -3431044 | Nanovirus flavipisi | | scientific name -3431046 | Nanovirus medicagonis | | scientific name -3431121 | Ninurtavirus duliaris | | scientific name -3431136 | Ninurtavirus procoris | | scientific name -3431208 | Nyfulvavirus nylanderiae | | scientific name -3431242 | Orbivirus chenudaense | | scientific name -3431243 | Orbivirus chobarense | | scientific name -3431256 | Orbivirus wadmedaniense | | scientific name -3431303 | Orthohepadnavirus lagothricis | | scientific name -3431365 | Parahepadnavirus osdeorsi | | scientific name -3431402 | Pasivirus agallia | | scientific name -3431495 | Orthoreovirus mahlapitsiense | | scientific name -3431573 | Penoulivirus phomopsis | | scientific name -3431645 | Phlegivirus ni | | scientific name -3431697 | Pistolvirus ni | | scientific name -3431731 | Polerovirus BVG | | scientific name -3431741 | Polerovirus CPPV1 | | scientific name -3431742 | Polerovirus CPPV2 | | scientific name -3431754 | Polerovirus LABYV | | scientific name -3431756 | Polerovirus MAYMV | | scientific name -3431761 | Polerovirus PABYV | | scientific name -3431814 | Pomovirus colombiense | | scientific name -3431861 | Pospiviroid latensportulacae | | scientific name -3432190 | Rosavirus brorati | | scientific name -3432191 | Rosavirus chewhibe | | scientific name -3432238 | Salisharnavirus mirandaeae | | scientific name -3432239 | Salisharnavirus stewardii | | scientific name -3432269 | Satyrivirus cordulis | | scientific name -3432492 | Sobemovirus ARTVA | | scientific name -3432493 | Sobemovirus BSSV | | scientific name -3432496 | Sobemovirus CYCMV | | scientific name -3432503 | Sobemovirus PLYV | | scientific name -3432505 | Sobemovirus ROMOV | | scientific name -3432511 | Sobemovirus SNMOV | | scientific name -3432521 | Sogarnavirus palmerensis | | scientific name -3432584 | Stangrhavirus wuhan | | scientific name -3432597 | Stoorivirus tarnae | | scientific name -3432787 | Tethyvirus nemileis | | scientific name -3432872 | Tobamovirus fructirugosum | | scientific name -3432893 | Tobamovirus tropici | | scientific name -3432941 | Totivirus hachi | | scientific name -3432943 | Totivirus jyu | | scientific name -3432946 | Totivirus jyuichi | | scientific name -3432948 | Totivirus jyuni | | scientific name -3432950 | Totivirus jyusani | | scientific name -3432951 | Totivirus jyushi | | scientific name -3432953 | Totivirus kyu | | scientific name -3432971 | Totivirus shichi | | scientific name -3432979 | Trichomonasvirus vagiprimus | | scientific name -3433039 | Turncurtovirus rapae | | scientific name -3433064 | Unirnavirus beauveriae | | scientific name -3433066 | Unirnavirus cohigginsiani | | scientific name -3433152 | Velarivirus arecae | | scientific name -3433226 | Victorivirus nijyu | | scientific name -3433229 | Victorivirus nijyuichi | | scientific name -3433231 | Victorivirus nijyuni | | scientific name -3433233 | Victorivirus nijyusani | | scientific name -3433234 | Victorivirus nijyushi | | scientific name -3433265 | Vitivirus phivitis | | scientific name -3433267 | Vitivirus viarracaciae | | scientific name -3433335 | Wamavirus alphacitrulli | | scientific name -3433737 | Bostovirus bovis | | scientific name -3433752 | Alphacoronavirus ferrumequini | | scientific name -3433782 | Alphacoronavirus ricketti | | scientific name -3433784 | Alphacoronavirus nyctali | | scientific name -3433814 | Alphacoronavirus suis | | scientific name -3433816 | Infratovirus hubeiense | | scientific name -3433830 | Potexvirus ecsmanihotis | | scientific name -3433836 | Potexvirus ecsplantagonis | | scientific name -3433853 | Potexvirus marmorsennae | | scientific name -3456997 | Saprolegniomycetes | | scientific name -3456997 | Saprolegniomycetes Thines & Beakes, 2015 | | authority diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/nodes.dmp b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/nodes.dmp deleted file mode 100644 index 0dbeed2..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/taxdump/nodes.dmp +++ /dev/null @@ -1,3599 +0,0 @@ -1 | 1 | no rank | | 8 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | -2 | 131567 | domain | | 0 | 0 | 11 | 0 | 0 | 0 | 0 | 0 | -543 | 91347 | family | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -548 | 570 | species | KA | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified -568 | 1903412 | genus | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -570 | 2890311 | genus | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -573 | 3390273 | species | KP | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified -574 | 573 | subspecies | KP | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified -1224 | 3379134 | phylum | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1236 | 1224 | class | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -2157 | 131567 | domain | | 0 | 0 | 11 | 0 | 0 | 0 | 0 | 0 | -2235 | 183963 | order | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -2759 | 131567 | domain | | 1 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | -2763 | 2759 | phylum | | 4 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2781 | 31469 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -2806 | 2763 | class | | 4 | 1 | 1 | 1 | 4 | 0 | 0 | 0 | code compliant -2870 | 569578 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2886 | 2870 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2887 | 2886 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2888 | 2887 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3041 | 33090 | phylum | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3166 | 2692248 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3176 | 2684882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3178 | 3176 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3193 | 131221 | clade | | 4 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | -3208 | 3193 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -3214 | 404260 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3296 | 1437180 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant -3297 | 1445963 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3313 | 58019 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3394 | 3297 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3395 | 3394 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3398 | 58024 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3400 | 232347 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3401 | 3400 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3402 | 3401 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3440 | 41768 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3487 | 3744 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3502 | 91835 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3503 | 3502 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3511 | 3503 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3524 | 1437201 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3650 | 71239 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3669 | 1003875 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3744 | 91835 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3745 | 3744 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3764 | 1176516 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3803 | 72025 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3814 | 3803 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3841 | 163735 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4011 | 41937 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4036 | 91882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4037 | 364270 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4055 | 91888 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4143 | 91888 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4149 | 4143 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4199 | 91882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4200 | 4199 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4209 | 91882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4210 | 4209 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4231 | 102814 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4321 | 1802790 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4447 | 1437183 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -4454 | 16360 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4479 | 38820 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4496 | 640623 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4500 | 4496 | species | AL | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -4523 | 1293364 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4581 | 1648004 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4667 | 1437197 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4734 | 1437197 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | -4747 | 73496 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4751 | 33154 | kingdom | | 4 | 0 | 1 | 1 | 4 | 0 | 0 | 0 | code compliant -4762 | 33634 | phylum | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4763 | 3456997 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4764 | 4763 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4769 | 4764 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -4890 | 451864 | phylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -4958 | 766764 | genus | | 4 | 1 | 12 | 1 | 4 | 1 | 0 | 0 | code compliant -4972 | 165440 | species | DH | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5036 | 299071 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5037 | 5036 | species | HC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5039 | 229219 | species | BD | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5125 | 222543 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5139 | 222544 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5149 | 35718 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5197 | 388435 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5198 | 157822 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5199 | 5198 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5204 | 451864 | phylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5234 | 155616 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5302 | 5204 | subphylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5303 | 355688 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5305 | 396331 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5314 | 5317 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5317 | 5303 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5338 | 452333 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5455 | 681950 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5500 | 33184 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5501 | 5500 | species | CI | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5506 | 110618 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5550 | 34384 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5551 | 5550 | species | TR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5794 | 33630 | phylum | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5796 | 1280412 | subclass | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5809 | 423054 | family | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5819 | 422676 | order | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5820 | 1639119 | genus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5825 | 418101 | species | PC | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5857 | 418103 | species | PF | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5860 | 418101 | species | PV | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5863 | 422676 | order | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5872 | 5873 | species | TE | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -5873 | 27994 | genus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -5874 | 5873 | species | TA | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -6072 | 33208 | clade | | 1 | 1 | 1 | 1 | 5 | 0 | 1 | 0 | -6073 | 6072 | phylum | | 1 | 1 | 1 | 1 | 4 | 0 | 0 | 0 | code compliant -6101 | 6073 | class | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -6102 | 6101 | subclass | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -6125 | 6102 | order | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -6126 | 123757 | family | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -6127 | 6126 | genus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -6157 | 1206795 | phylum | | 1 | 1 | 1 | 1 | 9 | 0 | 0 | 0 | code compliant -6159 | 166126 | order | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -6199 | 6157 | class | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -6200 | 6199 | subclass | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -6217 | 1206795 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6218 | 6217 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6219 | 6218 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6222 | 6219 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6231 | 1206794 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6236 | 119089 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6249 | 6274 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6267 | 33256 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6274 | 6236 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6447 | 1206795 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6544 | 6447 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6599 | 2785011 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -6656 | 88770 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6657 | 197562 | subphylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6681 | 2172821 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6682 | 72041 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6683 | 6682 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6692 | 6683 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6712 | 6692 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6738 | 6692 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6744 | 6738 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6745 | 6744 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6746 | 6745 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6752 | 6692 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6960 | 197562 | subphylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6961 | 33339 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6970 | 33341 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6993 | 33341 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -6994 | 6993 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7041 | 33392 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7042 | 71529 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7088 | 85604 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7089 | 37569 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7100 | 37570 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7147 | 33392 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7148 | 7147 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7157 | 41827 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7158 | 1056966 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7399 | 33392 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7400 | 7399 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7401 | 7400 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7402 | 7401 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7434 | 7400 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7458 | 3042114 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7459 | 83321 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7496 | 85512 | subclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7516 | 85817 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7524 | 33342 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7581 | 35070 | order | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -7586 | 33511 | phylum | | 1 | 1 | 1 | 1 | 9 | 0 | 0 | 0 | code compliant -7711 | 33511 | phylum | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -7742 | 89593 | clade | | 10 | 0 | 1 | 1 | 2 | 1 | 0 | 0 | -7776 | 7742 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -7777 | 7776 | class | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -7778 | 7777 | subclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -7898 | 117571 | superclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -7952 | 186627 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -7953 | 30727 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -7982 | 30725 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -7983 | 278169 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8006 | 41705 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8015 | 8006 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8033 | 504568 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8034 | 8033 | species | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -8035 | 8034 | subspecies | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -8111 | 1489922 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8113 | 1489911 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8205 | 8111 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8219 | 1489878 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8220 | 8219 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8252 | 1489904 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8256 | 30942 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8287 | 117571 | superclass | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -8292 | 32523 | class | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8293 | 41666 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8294 | 30367 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8295 | 8294 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8306 | 8295 | species | AT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -8342 | 41666 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8416 | 8342 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8426 | 8416 | superfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8427 | 8426 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8457 | 32524 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -8492 | 1329799 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -8782 | 436492 | class | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8825 | 8782 | infraclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8826 | 1549675 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8827 | 8826 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8828 | 8827 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8906 | 3078114 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8936 | 3073810 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8940 | 3073806 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8941 | 8940 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8948 | 3073809 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8949 | 8948 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -8955 | 56259 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9108 | 3078114 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9126 | 3073809 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9219 | 3073810 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9223 | 3073809 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9224 | 9223 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9230 | 3073812 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9231 | 9230 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9239 | 9231 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9263 | 32525 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -9265 | 38605 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9266 | 126287 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9347 | 32525 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -9397 | 314145 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9431 | 30560 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9434 | 9431 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9655 | 3072906 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9671 | 169417 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9672 | 9671 | species | PB | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -9681 | 379583 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9688 | 338153 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9690 | 9688 | species | PO | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -9845 | 91561 | suborder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9895 | 35500 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9918 | 27592 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9975 | 314147 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9979 | 9975 | family | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9980 | 9979 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -9989 | 314147 | order | | 6 | 0 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -10045 | 10066 | subfamily | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -10066 | 337687 | family | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -10239 | 1 | acellular root | | 9 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | -10293 | 3044472 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10294 | 10293 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10319 | 10293 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10357 | 3044472 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10358 | 10357 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10374 | 3044472 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10404 | 2732515 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10405 | 10404 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10442 | 2840070 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10566 | 173087 | species | HP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10567 | 325456 | species | IX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10639 | 186534 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10652 | 186534 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10780 | 2732534 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10803 | 40119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10811 | 2732539 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10812 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10814 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -10841 | 2732414 | family | | 3 | 0 | 11 | 0 | 0 | 1 | 0 | 0 | code compliant -10882 | 2946187 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10892 | 2946186 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10979 | 2946187 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10988 | 2946187 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10989 | 3428775 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -10993 | 2732396 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11006 | 2732540 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11007 | 3152141 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11012 | 2732549 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11050 | 2732545 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11095 | 11050 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11102 | 11050 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11118 | 2499399 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11157 | 2497574 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11158 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11229 | 2560076 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11240 | 3052347 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -11270 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11271 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11308 | 2499411 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11318 | 352235 | species | TD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -11319 | 11318 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -11572 | 1980416 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11582 | 2560289 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -11584 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11617 | 3151839 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11632 | 2169561 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -11974 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12027 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -12030 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -12031 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -12036 | 2560078 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -12050 | 675072 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12051 | 249184 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12058 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12059 | 2960224 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -12091 | 2946633 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12109 | 2946627 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12137 | 2169577 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12141 | 2560077 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -12160 | 69973 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12163 | 1914297 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12174 | 1914298 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12176 | 675064 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12195 | 39729 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12234 | 675071 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12258 | 675075 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12270 | 675075 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12283 | 2732546 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12289 | 2169577 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12316 | 39740 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -12429 | 10239 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -12456 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -12471 | 3432511 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -12701 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -12877 | 12429 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -12929 | 9224 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -13366 | 1156497 | genus | | 4 | 1 | 1 | 1 | 4 | 0 | 0 | 0 | code compliant -13502 | 13366 | species | BN | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -14366 | 1006621 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -16360 | 4447 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant -23461 | 4011 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -24966 | 4055 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -25623 | 1446379 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -25628 | 25623 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -26473 | 216806 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -26867 | 216794 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -27319 | 2916678 | family | | 4 | 1 | 12 | 1 | 4 | 1 | 0 | 0 | code compliant -27337 | 1036719 | species | VD | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -27434 | 33341 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -27483 | 7400 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -27592 | 9895 | subfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -27668 | 9434 | species | ML | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -27708 | 1278288 | species | PC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -27994 | 5863 | family | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -28267 | 11240 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -28725 | 192204 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -28843 | 1224679 | family | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -28890 | 3366610 | phylum | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -29961 | 6712 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -29962 | 116707 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -30092 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -30093 | 38124 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -30102 | 33368 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -30367 | 8293 | superfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -30388 | 8828 | species | CT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -30449 | 3073812 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -30560 | 9397 | suborder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -30725 | 7952 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -30727 | 7952 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -30806 | 8205 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -30871 | 1489943 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -30942 | 8252 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -31271 | 5825 | subspecies | PC | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -31370 | 2045258 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -31371 | 31370 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -31468 | 2045261 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -31469 | 31468 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -31612 | 1972589 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -31870 | 2707348 | species | CG | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -32443 | 41665 | infraclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -32519 | 186634 | subcohort | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -32523 | 1338369 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -32524 | 32523 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -32525 | 40674 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -32561 | 8457 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -32613 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -32620 | 3240548 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -33090 | 2759 | kingdom | | 4 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -33154 | 2759 | clade | | 4 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | -33183 | 451871 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -33184 | 33183 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -33208 | 33154 | kingdom | | 1 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -33213 | 6072 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -33256 | 6249 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33317 | 33213 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -33339 | 7496 | infraclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33340 | 7496 | infraclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33341 | 33340 | cohort | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33342 | 33340 | cohort | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33365 | 1955247 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -33368 | 33365 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33372 | 30102 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33373 | 7524 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33375 | 33373 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33392 | 33340 | cohort | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33415 | 37572 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -33511 | 33213 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -33554 | 314145 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -33599 | 8940 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -33600 | 33599 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -33601 | 33600 | species | PC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -33630 | 2698737 | clade | | 1 | 0 | 1 | 1 | 4 | 0 | 0 | 0 | -33634 | 2698737 | clade | | 4 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | -34111 | 35466 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -34145 | 131211 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -34384 | 33183 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -34392 | 34384 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -34397 | 5125 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -34448 | 654128 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -34667 | 71528 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -34735 | 7434 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -35069 | 133550 | class | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -35070 | 35069 | subclass | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -35249 | 10374 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35278 | 439490 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35300 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35303 | 11270 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35323 | 11308 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -35325 | 2559587 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -35342 | 2204151 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35466 | 35491 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -35491 | 2812636 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -35493 | 33090 | phylum | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -35500 | 9845 | infraorder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -35627 | 2231390 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -35634 | 85819 | parvorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -35709 | 1648008 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -35718 | 5139 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -35740 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35741 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -35869 | 43951 | species | ZC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -36050 | 569360 | species | FP | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -36291 | 9126 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -37130 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37567 | 41197 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -37569 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -37570 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -37572 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -37573 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -37660 | 35627 | species | SH | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -37754 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37755 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37756 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37757 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37758 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37759 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37760 | 10566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -37844 | 37945 | subclass | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -37850 | 29961 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -37945 | 6157 | class | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -37960 | 11012 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -38033 | 5149 | species | CG | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -38124 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -38144 | 11050 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -38605 | 9263 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -38820 | 4734 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -38950 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -39249 | 216812 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -39724 | 2732536 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39725 | 39724 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39729 | 2732550 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39731 | 39729 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39733 | 2732551 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39734 | 2560072 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -39738 | 2732548 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -39740 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39750 | 10993 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39756 | 11006 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -39760 | 2732890 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -39780 | 35325 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -39804 | 2842995 | species | QF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -39829 | 116707 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -39831 | 573 | subspecies | KP | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified -40065 | 3431242 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -40067 | 3431256 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -40068 | 10892 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -40092 | 104431 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -40093 | 40092 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -40119 | 10780 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -40120 | 10780 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -40122 | 40120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -40272 | 10357 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -40562 | 2982305 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -40588 | 41938 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -40674 | 32524 | class | | 2 | 0 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -40948 | 241792 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -41071 | 7041 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41073 | 535382 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41084 | 7041 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41088 | 41084 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41154 | 34667 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41155 | 34667 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41191 | 7088 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41196 | 41191 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -41197 | 41196 | parvorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -41479 | 2841720 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -41549 | 742010 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -41665 | 186623 | subclass | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -41666 | 8292 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -41705 | 1489388 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -41768 | 1437183 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -41773 | 41768 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -41827 | 43786 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -41937 | 91836 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -41938 | 91836 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -43358 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -43464 | 8955 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -43786 | 7148 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -43817 | 7157 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -43951 | 3178 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -44560 | 3426674 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -45234 | 474943 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -45357 | 3303203 | species | CH | 4 | 1 | 12 | 0 | 4 | 1 | 1 | 0 | code compliant; specified -45607 | 45787 | species | WS | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -45787 | 410830 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -45950 | 105711 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -45951 | 45950 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -46108 | 1804622 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -46366 | 241785 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -46569 | 1912919 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -46619 | 3240530 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -47455 | 1648023 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -47456 | 47455 | species | PR | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -47520 | 6599 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -47521 | 47520 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -47522 | 47521 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -47523 | 47526 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -47524 | 2741926 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -47526 | 47522 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -47567 | 6267 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -49188 | 1463140 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -49669 | 50362 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -49817 | 3841 | species | EC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -50292 | 3050258 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -50362 | 4667 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -50435 | 2029065 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -50488 | 6961 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -50489 | 70893 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -50515 | 535378 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -50557 | 6960 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -50713 | 1972572 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -51909 | 9224 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -52123 | 85545 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -52360 | 47524 | species | AP | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -52974 | 1034061 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -52975 | 52974 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -52976 | 52975 | species | BP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -53017 | 11318 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -53058 | 158424 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -53124 | 158330 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -53300 | 156511 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -53541 | 7158 | subgenus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -54049 | 8906 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -54057 | 54049 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -54059 | 54057 | species | SP | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -54354 | 9108 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -54355 | 54354 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -54356 | 54355 | species | AG | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -54357 | 9108 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -54358 | 54357 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -54359 | 54358 | species | PC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -54757 | 5860 | subspecies | PV | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -55136 | 1158979 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -55193 | 742845 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -55267 | 6159 | suborder | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -55867 | 7042 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -56259 | 2558200 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56301 | 3073806 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56302 | 56301 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56308 | 3073810 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56309 | 56308 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56310 | 56309 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56311 | 56310 | species | TM | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -56342 | 8949 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56343 | 56342 | species | HC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -56646 | 569360 | species | FV | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -56785 | 28725 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -56866 | 3669 | species | LA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -57379 | 3073810 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -57382 | 8940 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -57383 | 8936 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -57401 | 57382 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -57405 | 57383 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -58019 | 1437180 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -58023 | 3193 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -58024 | 78536 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -58627 | 4958 | species | DF | 4 | 1 | 12 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -59171 | 4200 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -59172 | 59171 | species | PR | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -59500 | 3427666 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -60456 | 3052577 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -60807 | 706622 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -60808 | 60807 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -60809 | 60808 | species | SS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -62020 | 50489 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -62110 | 163733 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -62784 | 70905 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -63225 | 9980 | species | LT | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -63405 | 34392 | species | MC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -64021 | 265963 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -64579 | 65009 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -65009 | 40588 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant -65068 | 3048251 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -65386 | 735337 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -66236 | 35634 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -67753 | 69973 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -67762 | 291027 | species | TL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -68416 | 3431303 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -69720 | 293500 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -69721 | 69720 | species | ZA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -69973 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -70085 | 497679 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -70170 | 702736 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -70439 | 30806 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -70440 | 70439 | species | CW | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -70564 | 70170 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -70778 | 6127 | species | AN | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -70893 | 50488 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -70905 | 2018325 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -70987 | 7458 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -71112 | 169417 | genus | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -71239 | 91835 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -71240 | 1437183 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -71274 | 1437201 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -71275 | 1437201 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -71528 | 41088 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -71529 | 41088 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -71950 | 40562 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -72018 | 198625 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -72019 | 72018 | species | SA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -72025 | 91835 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -72041 | 6681 | subclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -72407 | 573 | subspecies | KP | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | code compliant; specified -72876 | 29962 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -73275 | 4231 | species | HA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -73496 | 1437197 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -73501 | 45234 | species | CM | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -74132 | 318529 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -74133 | 74132 | species | SA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -74320 | 3047704 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -74649 | 3764 | species | RC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -74694 | 216795 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -75725 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -75739 | 5796 | order | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -75747 | 3427251 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -76717 | 71112 | species | LC | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -76775 | 55193 | species | MR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -76803 | 2499398 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -76804 | 2732506 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -77519 | 418103 | species | PG | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -78060 | 157822 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -78536 | 58023 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | -79078 | 35627 | species | SS | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -79236 | 3426792 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -79514 | 34667 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -79633 | 52123 | species | OT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -79652 | 85545 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -79653 | 79652 | species | OO | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -82582 | 33415 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -82676 | 325461 | species | OX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -83312 | 7459 | species | AN | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -83321 | 70987 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -83871 | 3052570 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -85103 | 8906 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -85104 | 85103 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -85512 | 50557 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -85545 | 30449 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -85604 | 33392 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -85817 | 33392 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -85819 | 160148 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -85823 | 6970 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -86721 | 3402 | species | MD | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -86989 | 169626 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -86990 | 86989 | species | EH | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -87139 | 55136 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -88159 | 2888 | species | AP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -88770 | 1206794 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -89593 | 7711 | subphylum | | 10 | 0 | 1 | 1 | 2 | 0 | 0 | 0 | code compliant -90010 | 12059 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -91347 | 1236 | order | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -91561 | 314145 | order | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -91771 | 9219 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -91776 | 91771 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -91827 | 71240 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -91835 | 71275 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -91836 | 71275 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -91882 | 71274 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -91888 | 71274 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -92738 | 46569 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -93386 | 3050267 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -94231 | 1505891 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -94243 | 1489894 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -94642 | 5809 | genus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -94643 | 94642 | species | BB | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -94844 | 28843 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -94845 | 94844 | species | LI | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 0 | code compliant; specified -95179 | 7100 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -95337 | 11974 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -95341 | 11974 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -98220 | 2888 | species | AC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -98221 | 2888 | species | AM | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -99756 | 37850 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -100182 | 9980 | species | LG | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -100750 | 33415 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -101203 | 4769 | species | SP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -102804 | 4210 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -102805 | 4210 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -102809 | 102804 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -102814 | 911341 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -102818 | 219103 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -103490 | 3511 | species | QG | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -103723 | 327107 | species | GR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -103955 | 56302 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -103956 | 103955 | species | CC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -104430 | 37567 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -104431 | 37567 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -104435 | 104430 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -104766 | 251095 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -105711 | 278205 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -106324 | 47567 | species | CO | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -106325 | 106324 | subspecies | CO | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -106742 | 72876 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -107843 | 50515 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -107924 | 183385 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -110618 | 5125 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -111067 | 6746 | species | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -111670 | 5199 | species | CR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -112415 | 78060 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -113113 | 57379 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -113114 | 113113 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -113115 | 113114 | species | RC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -114658 | 3214 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -115354 | 104435 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -116704 | 6752 | no rank | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -116707 | 116704 | no rank | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -117010 | 180950 | species | TC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -117570 | 7776 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -117571 | 117570 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -117574 | 10841 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -117677 | 62784 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -117678 | 473626 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -117776 | 6127 | species | AD | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -117778 | 6127 | species | AY | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -117851 | 117893 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -117893 | 7778 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -119089 | 6231 | class | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -119164 | 2169577 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -119257 | 37569 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -120864 | 7402 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -120865 | 120864 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -121422 | 36291 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -121822 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -121823 | 121822 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -121826 | 30093 | species | TU | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -122260 | 28843 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -122261 | 122260 | species | DI | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 0 | code compliant; specified -123365 | 1489388 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -123366 | 123365 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -123367 | 123366 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -123368 | 123367 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -123369 | 123368 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -123757 | 6125 | suborder | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -124006 | 55867 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -124426 | 34397 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -124960 | 4321 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -126287 | 9265 | subfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -127916 | 33154 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -128790 | 3047678 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -128818 | 3430566 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -129017 | 166052 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -129725 | 1914297 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -130990 | 3417957 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -130991 | 130990 | species | EF | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -131209 | 131221 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -131210 | 2684882 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -131211 | 131210 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -131220 | 35493 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -131221 | 35493 | subphylum | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant -131567 | 1 | cellular root | CO | 8 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -133550 | 7586 | clade | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | -135166 | 9219 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -135167 | 135166 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -135168 | 135167 | species | BC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -135425 | 175121 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -135426 | 667167 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -137443 | 3050317 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -137757 | 39729 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -138977 | 9434 | species | MH | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -140052 | 327045 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -144051 | 232795 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -145388 | 34111 | species | MN | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -147100 | 6157 | class | | 1 | 1 | 1 | 1 | 9 | 0 | 0 | 0 | code compliant -147271 | 1293359 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147366 | 359160 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147368 | 359160 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147369 | 147370 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147370 | 4479 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -147376 | 1648035 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147377 | 1648035 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147387 | 1648037 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147428 | 1648036 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -147537 | 716545 | subphylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -147538 | 716545 | subphylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -147545 | 716546 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -147547 | 716546 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -147550 | 715989 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -150311 | 497220 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -151340 | 2788857 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -151341 | 2732532 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -153135 | 327045 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -153286 | 9434 | species | MN | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -153287 | 9434 | species | MT | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -155616 | 5302 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -155619 | 5302 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -155768 | 65386 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -156152 | 4143 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -156208 | 39729 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -156505 | 106742 | species | CI | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -156511 | 1293059 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -156760 | 9239 | species | SM | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -157270 | 3047843 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -157317 | 294824 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -157777 | 3427788 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -157822 | 5197 | suborder | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -158330 | 4747 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -158332 | 4747 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -158391 | 158332 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -158397 | 158332 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -158424 | 158397 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -159141 | 3052437 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -159150 | 3052437 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -159322 | 9434 | species | MA | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -159325 | 9434 | species | MD | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -159332 | 9434 | species | MO | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -159333 | 9434 | species | MR | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -159335 | 9434 | species | MV | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -159337 | 9434 | species | MY | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -160079 | 66236 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -160148 | 1930602 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -160394 | 278171 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -162474 | 1538075 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -163125 | 94243 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -163611 | 319058 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -163725 | 2231387 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -163733 | 2233855 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -163735 | 2233855 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -163739 | 2231385 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -165250 | 157777 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -165440 | 1884640 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -165826 | 3426730 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -166052 | 8427 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -166126 | 147100 | clade | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | -166236 | 55267 | superfamily | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -166243 | 166236 | family | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -166244 | 166243 | subfamily | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -166586 | 53541 | species | AF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -166784 | 8219 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -167449 | 70085 | species | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -168496 | 1503305 | varietas | BA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -168834 | 1895012 | species | PD | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -169417 | 9655 | subfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -169618 | 24966 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -169626 | 169618 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -170325 | 3050251 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -171627 | 5506 | species group | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | -171638 | 3745 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -171788 | 102805 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -171944 | 23461 | species | MS | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -172915 | 2743715 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -172976 | 2781 | species | GL | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -173087 | 333774 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -175121 | 9126 | superfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -175529 | 12929 | species | AG | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -176938 | 57405 | species | CA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -178830 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -178941 | 2218198 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -178948 | 178941 | species | AS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -180252 | 10293 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -180950 | 930979 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -181089 | 135425 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -181124 | 34448 | species | MO | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -181762 | 71950 | species | PC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -182093 | 95337 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -182724 | 155768 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -182725 | 182724 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -183385 | 107843 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -183963 | 2290931 | class | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -184751 | 1914298 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -185002 | 26867 | species | PO | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -185751 | 3403061 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -185752 | 3403061 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -185753 | 185751 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -185756 | 185751 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -185759 | 185752 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -185786 | 10979 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -186121 | 50435 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -186458 | 178830 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -186534 | 2169561 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -186623 | 7898 | class | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -186625 | 1489341 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -186626 | 32519 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -186627 | 186626 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -186634 | 186625 | cohort | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -186766 | 2732502 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -186767 | 186766 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -186886 | 675071 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -186938 | 3152209 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -187214 | 186534 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -190729 | 1993640 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -192204 | 9126 | superfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -192380 | 79514 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -192381 | 192380 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -192382 | 192381 | species | MA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -193267 | 62020 | species | MT | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -194960 | 2946635 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -195059 | 2748959 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -195633 | 8256 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -195798 | 111670 | subspecies | CR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -197056 | 111670 | subspecies | CR | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -197112 | 270256 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -197562 | 197563 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -197563 | 6656 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | -197613 | 74649 | varietas | RC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -198607 | 1250315 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -198625 | 127916 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -201863 | 11240 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -203261 | 94231 | species | EB | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -205083 | 45951 | species | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -211557 | 211567 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -211558 | 211557 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -211567 | 3039756 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -214437 | 8955 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -215788 | 100750 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -216794 | 156152 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -216795 | 156152 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -216806 | 4149 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -216812 | 4149 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -217160 | 69973 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -219103 | 4210 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -220121 | 53300 | species | MA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -222078 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -222543 | 147550 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -222544 | 147550 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -222556 | 12283 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -223251 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -223286 | 165826 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -223769 | 3047845 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -224510 | 183385 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -225962 | 453050 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -226102 | 49188 | species | AC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -227307 | 687329 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -228457 | 182725 | species | LE | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -228657 | 163739 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -228658 | 228657 | species | EK | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -229219 | 299071 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -231932 | 5305 | species | PC | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -232347 | 1437183 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -232795 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -232799 | 699189 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -233784 | 3047850 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -234792 | 172915 | species | SD | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -240201 | 85104 | species | BB | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -241749 | 1729112 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -241750 | 241749 | species | AA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -241751 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -241778 | 4037 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -241780 | 241778 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -241785 | 241778 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -241792 | 241780 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -241932 | 3054905 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -246410 | 5501 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -249184 | 675063 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -249185 | 249184 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -249310 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -249588 | 39733 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -251095 | 2732538 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -252798 | 214437 | species | ST | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -255330 | 453050 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -257883 | 9434 | species | ME | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -260377 | 3427013 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -263002 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -265123 | 291286 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -265963 | 2559587 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -268499 | 37573 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -270256 | 3047819 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -272620 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -274794 | 30871 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -278169 | 7982 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -278171 | 30725 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -278205 | 2908833 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -283494 | 1458186 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -287184 | 115354 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -287195 | 8034 | subspecies | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -290090 | 1195641 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -290849 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -291027 | 10814 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -291286 | 3240527 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -292474 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -292479 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -293500 | 421921 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -294824 | 41155 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -299071 | 33183 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -299368 | 268499 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant -301920 | 2741929 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -301921 | 301920 | species | PP | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -306901 | 38033 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -307635 | 252798 | subspecies | ST | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -310684 | 675072 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -311227 | 2946187 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -311900 | 51909 | species | PR | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -314145 | 1437010 | superorder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -314146 | 1437010 | superorder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -314147 | 314146 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -315357 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -315838 | 27483 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -315840 | 315838 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -318529 | 318559 | tribe | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -318546 | 319095 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -318559 | 319056 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -319056 | 8113 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -319058 | 318546 | tribe | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -319095 | 8113 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -320454 | 74133 | subspecies | SA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -320455 | 74133 | subspecies | SA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -321084 | 43464 | species | CP | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -321263 | 9434 | species | MA | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -323096 | 4581 | species | BV | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -323895 | 35709 | species | CC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -324901 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -325454 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -325455 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -325456 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -325459 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -325461 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -327045 | 11632 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -327107 | 249185 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -327375 | 12163 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -327387 | 3432893 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -327770 | 94231 | species | ET | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -328429 | 119164 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -328527 | 2743716 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -329860 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -330383 | 249184 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -333774 | 151340 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -333921 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -333938 | 333774 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -334425 | 270256 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -334873 | 163125 | species | PC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -336476 | 232799 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -336633 | 144051 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -336635 | 232795 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -336987 | 3426880 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -337052 | 325454 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -337687 | 1963758 | clade | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -338153 | 9681 | subfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -339076 | 53058 | species | CP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -341117 | 7983 | species | MB | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -341128 | 160394 | species | BN | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -344417 | 39750 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -345249 | 39725 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -346391 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -347957 | 140052 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -351425 | 129725 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -351426 | 3428809 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -351428 | 351425 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -352235 | 35323 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -352926 | 39733 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -352927 | 67753 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -353154 | 5874 | strain | | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -353769 | 153135 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -354837 | 2839668 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -355688 | 155619 | no rank | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -357852 | 40948 | species | AL | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -358814 | 121422 | species | PA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -359160 | 4479 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -359505 | 46366 | species | BA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -361688 | 2609695 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -364270 | 4036 | suborder | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant -367188 | 3064797 | genus | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -367682 | 797075 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -368620 | 64021 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -369752 | 3240498 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -371833 | 95341 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -371917 | 56785 | species | NC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -375141 | 435738 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -375142 | 375141 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -375143 | 375142 | species | CC | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -376274 | 376275 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -376275 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -377833 | 92738 | no rank | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -379583 | 33554 | suborder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -379584 | 33554 | suborder | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -384633 | 9434 | species | MA | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -388435 | 1520881 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -391337 | 260377 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -396331 | 5303 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -397273 | 46108 | species | SM | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -398816 | 336987 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -399178 | 9690 | subspecies | PO | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -399254 | 38124 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -399255 | 399254 | species | AD | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -404260 | 3208 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -404297 | 114658 | superorder | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -405558 | 3240468 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -410297 | 10045 | genus | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -410302 | 410297 | species | GL | 6 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -410830 | 3243772 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -413970 | 39740 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -416867 | 6222 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -416868 | 416867 | species | NG | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -418101 | 5820 | subgenus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -418103 | 5820 | subgenus | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -420948 | 87139 | species | AF | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -421010 | 3240544 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -421921 | 4454 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -422676 | 5794 | class | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -423054 | 75739 | suborder | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -423369 | 8034 | subspecies | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -423370 | 8034 | subspecies | SL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -425264 | 76775 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -427924 | 205083 | subspecies | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -431037 | 40272 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -433372 | 252798 | subspecies | ST | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -435738 | 2072716 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -436486 | 8492 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -436489 | 436486 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -436491 | 436489 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -436492 | 436491 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -437064 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -437489 | 2555566 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -437490 | 437489 | species | SA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -439490 | 2585030 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -441227 | 473626 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -441892 | 2888 | species | AC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -442243 | 215788 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -442302 | 2960910 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -442316 | 82582 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -445316 | 72876 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -446318 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -447093 | 5037 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -450882 | 25628 | species | TF | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -451864 | 4751 | subkingdom | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -451871 | 147545 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -452284 | 5204 | subphylum | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -452333 | 155619 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -453050 | 3240525 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -456398 | 445316 | species | PS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -461132 | 442243 | species | LL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -464095 | 2732506 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -464925 | 464095 | no rank | | 11 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured -469369 | 475327 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -473626 | 117677 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -473674 | 473713 | subspecies | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -473713 | 117678 | species | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -473783 | 39734 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -473784 | 3048236 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -474943 | 5125 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -475272 | 475327 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -475273 | 475272 | species | EM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -475327 | 7089 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -475347 | 119257 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -475348 | 475347 | species | PF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -478825 | 12058 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -481315 | 3050304 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -484021 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -485724 | 3052579 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -490134 | 68416 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493796 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493797 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493798 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493799 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493800 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493801 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -493802 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -494651 | 3052771 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -497220 | 8220 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -497679 | 8220 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -498257 | 27337 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -501251 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -501252 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -504568 | 8015 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -516546 | 41549 | species | CJ | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -526119 | 249588 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -535378 | 41071 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -535382 | 41071 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -535600 | 10780 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -538002 | 73501 | varietas | CM | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -547124 | 311227 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -547455 | 147271 | species | PV | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -548681 | 2731363 | order | | 9 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | code compliant -548688 | 10374 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -552816 | 99756 | species | EL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -554155 | 63405 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -558016 | 10442 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -558017 | 10442 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -558690 | 352927 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -559297 | 5039 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -559298 | 1681229 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -559305 | 5551 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -560253 | 112415 | species | LL | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -564644 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -569360 | 5506 | species group | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -569578 | 2696291 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -570949 | 1250315 | species | CM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -570950 | 1250315 | species | CM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -578617 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -584378 | 41154 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -585893 | 2732549 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -590647 | 3052353 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -590745 | 353769 | species | MM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -626155 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626156 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626157 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626158 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626159 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626160 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626161 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626162 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626163 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626164 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626165 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626166 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626167 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626168 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626169 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626170 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626171 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626172 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626173 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626174 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626175 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626176 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626177 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626178 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626179 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626180 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626181 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626182 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626183 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626184 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626185 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626186 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626187 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626188 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626189 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626190 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626191 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626192 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626193 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626194 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626195 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626196 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626197 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -626198 | 37130 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -632743 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -640623 | 1652080 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -642248 | 39724 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -642994 | 442316 | species | HM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -644269 | 31371 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -645133 | 31870 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -649996 | 3427005 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -650164 | 231932 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -652723 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652811 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652812 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652813 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652814 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652815 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652816 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652817 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652818 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652819 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -652820 | 35740 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -654128 | 2982316 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -667127 | 39831 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -667151 | 135426 | species | DC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -667167 | 175121 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -667516 | 38144 | species | NV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -667725 | 72019 | strain | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | -674952 | 3152147 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -674953 | 3432979 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -674981 | 3152147 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -674996 | 291027 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -675063 | 2732461 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675064 | 675063 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675068 | 675063 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675071 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675072 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675073 | 675072 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675074 | 464095 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -675075 | 675072 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -675845 | 1980412 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -676044 | 3426852 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -676058 | 6127 | species | AR | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -681501 | 241932 | species | TC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -681950 | 1028384 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -685445 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -685899 | 3432503 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -686565 | 10841 | subfamily | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -686982 | 2946630 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -687091 | 299368 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -687329 | 3420546 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -687332 | 687329 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -687339 | 687329 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -687387 | 3048408 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -693996 | 2501931 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -693997 | 3433814 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -695850 | 101203 | strain | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | -696855 | 11974 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -699189 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -702736 | 3050262 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -703582 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -706525 | 82676 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -706526 | 1513275 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -706527 | 1513252 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -706622 | 41073 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -706663 | 7581 | family | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -707741 | 706663 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -715989 | 716546 | clade | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -716545 | 4890 | clade | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -716546 | 147538 | clade | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -735337 | 6599 | infraclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -735504 | 325455 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -742010 | 102818 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -742845 | 162474 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -742914 | 39724 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -748365 | 2721536 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -748366 | 748365 | species | AL | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -753343 | 287184 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -759124 | 1231296 | species | BY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -759804 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -763898 | 157317 | species | AS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -766764 | 2916678 | family | | 4 | 1 | 12 | 1 | 4 | 1 | 0 | 0 | code compliant -796900 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796901 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796902 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796903 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796904 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796905 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796906 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796907 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796908 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796909 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -796910 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -797075 | 3427773 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -861365 | 39831 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -861561 | 3240517 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -871765 | 687387 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -885375 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -885376 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -886583 | 102809 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -906906 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906907 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906908 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906909 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906910 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906911 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906912 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -906913 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -908833 | 186767 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -908834 | 908833 | species | GA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -911341 | 102804 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -930979 | 2982303 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -935296 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -935650 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -936057 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -936058 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -938257 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -939922 | 674981 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -940834 | 1513253 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -941259 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -943329 | 40948 | species | AL | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -944994 | 3426677 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -977912 | 222556 | species | OV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -983644 | 73501 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -988644 | 439490 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -990925 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -992212 | 2748958 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -994805 | 9266 | species | DP | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -997078 | 3426990 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1003875 | 3650 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1005902 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1005903 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1005904 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1006621 | 158391 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1028307 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1028384 | 222543 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1032459 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032460 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032461 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032462 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032463 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032464 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032465 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1032466 | 2585815 | subspecies | PH | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1033976 | 3052581 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1033978 | 1028384 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1034061 | 404297 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1035782 | 129017 | species | MM | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1036719 | 1033978 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1037890 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1037908 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1046402 | 3427747 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1048227 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048228 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048229 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048230 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048231 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048232 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048233 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048436 | 1239565 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1048668 | 3428042 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1048854 | 3052665 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1049565 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1049657 | 85823 | superfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1050903 | 3428207 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1054649 | 3433064 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1056880 | 4523 | species | NM | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1056966 | 43817 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1070324 | 1513273 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1070408 | 1513260 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1070409 | 1513256 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1070410 | 1513261 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1070413 | 1513256 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1070417 | 1513262 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1071164 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1073966 | 686982 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1074486 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1075431 | 163611 | species | AG | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1077831 | 186766 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1077832 | 1077831 | species | PI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1080004 | 171788 | species | FS | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1080924 | 120865 | species | ZC | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1087440 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087441 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087442 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087443 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087444 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087445 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087446 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1087447 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1094167 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1094168 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1094169 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1094170 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1094171 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1096141 | 3052771 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1111709 | 699189 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1112098 | 79653 | subspecies | OO | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1114942 | 3428669 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1115383 | 3395 | species | CS | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1115692 | 3427248 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1123862 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1124990 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1125630 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128946 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128947 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128948 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128949 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128950 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128951 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128952 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128953 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1128954 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1132022 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1133751 | 3432492 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1136133 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1136150 | 39249 | species | SC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1156497 | 3243775 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1156769 | 1298633 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1158979 | 117851 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -1159556 | 124426 | species | UV | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1159795 | 205083 | subspecies | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1159796 | 205083 | subspecies | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1159798 | 205083 | subspecies | DR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1162296 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1162297 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1168062 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1168063 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1168064 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1170422 | 1307798 | species | LV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1170424 | 1307798 | species | NV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1170425 | 1307798 | species | PV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1170656 | 3427106 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1172985 | 2982806 | species | JT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1173713 | 5314 | species | GS | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1173763 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1176516 | 171638 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1177045 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1177046 | 12701 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1177047 | 35300 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1177153 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1182518 | 3430695 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1183241 | 37960 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1185359 | 371833 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1185418 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1185419 | 1460422 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1185420 | 1460422 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1187973 | 2960910 | species | OP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1188990 | 861561 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1193292 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1195163 | 413970 | species | AA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1195641 | 3426935 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1195776 | 195633 | species | PJ | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1196387 | 644269 | species | KM | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1196474 | 41479 | species | AF | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1196494 | 41479 | species | AP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1199150 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1200970 | 2050584 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1200971 | 2010320 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1202142 | 3427967 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1203539 | 1208309 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1203544 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1203545 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1203546 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1203547 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1205678 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1206794 | 33317 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -1206795 | 2697495 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -1208309 | 1891715 | species | DD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1209932 | 2707335 | species | CS | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1212766 | 1460422 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1213620 | 3051989 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1214274 | 166586 | subspecies | AF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1214275 | 166586 | subspecies | AF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1214955 | 2844804 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1216472 | 1678146 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1217821 | 3052256 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1218098 | 574 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1219210 | 73501 | strain | | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -1221206 | 291027 | species | SC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1221208 | 3052258 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1221437 | 3433265 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1221521 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1223561 | 3052724 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1223562 | 3052723 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1224679 | 6200 | order | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -1225181 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1225182 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1225183 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1226115 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1226680 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1228988 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1230847 | 186121 | species | MA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1231296 | 283494 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1231522 | 3303203 | species | CD | 4 | 1 | 12 | 0 | 4 | 1 | 1 | 0 | code compliant; specified -1231523 | 45357 | varietas | CH | 4 | 1 | 12 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1232392 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1232637 | 10293 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1233522 | 696855 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1236101 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1236102 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1236400 | 1723728 | species | PT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1236676 | 2810354 | species | IU | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1238886 | 675073 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1239565 | 3430629 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1241370 | 3426670 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1241918 | 222556 | species | LB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1244085 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1248396 | 1513263 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1249508 | 11102 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1250315 | 12877 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1250520 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1263871 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1267897 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1268974 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1269006 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1272960 | 1972597 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1273128 | 3427357 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1274605 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274606 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274607 | 37130 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274608 | 37130 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274609 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274610 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274611 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274613 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274614 | 35741 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1274615 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1276652 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1276653 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1278288 | 2743705 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1279040 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1279099 | 2955836 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1280412 | 5794 | class | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1284787 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284788 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284789 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284790 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284791 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284792 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284793 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284794 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284795 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284796 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284797 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284798 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284799 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284800 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284801 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284802 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284803 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284804 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284805 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284806 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284807 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284808 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284809 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284810 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284811 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284812 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284813 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284814 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284815 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284816 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284817 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284818 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284819 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284820 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284821 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284822 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284823 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284824 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284825 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284826 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284827 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284828 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284829 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284830 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284831 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284832 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284833 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1284834 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1285372 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1285373 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1285596 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1285597 | 1285596 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1290996 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1292273 | 166244 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -1293059 | 39829 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1293356 | 1648033 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1293359 | 1293356 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1293364 | 147428 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1294138 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1294139 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1294140 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1294141 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1294269 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1298631 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1298633 | 194960 | species | KC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1299309 | 2560077 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1300166 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1300981 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300982 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300983 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300984 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300985 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300986 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300987 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300988 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300989 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300990 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300991 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300992 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300993 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300994 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300995 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300996 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300997 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300998 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1300999 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301000 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301001 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301002 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301003 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301004 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301005 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301006 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301007 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301008 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301009 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301010 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301011 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301012 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301013 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301014 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1301015 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1302145 | 181089 | species | AG | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1303385 | 3427043 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1304916 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304917 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304918 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304919 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304920 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304921 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304922 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304923 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1304924 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1306546 | 2022857 | species | CM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1306950 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1307798 | 35278 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1307799 | 11050 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1307958 | 3427760 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1308539 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308684 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308685 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308686 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308687 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308688 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308731 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1308858 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1309536 | 107924 | species | PO | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1310158 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1310159 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1310424 | 37960 | species | VD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1315262 | 1513265 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1316582 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1316938 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1316939 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328324 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328325 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328337 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328362 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328363 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328364 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328366 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328367 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328368 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328369 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328370 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328371 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328372 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328373 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328375 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328377 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328378 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328379 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328380 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328381 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328382 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328383 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328384 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328385 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328386 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328387 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328388 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328389 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328390 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328391 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328392 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328393 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328394 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328396 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328398 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328399 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328400 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328401 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328402 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328403 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328404 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328405 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328406 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328407 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328408 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328409 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328410 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328411 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328412 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328413 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328414 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328415 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328416 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328417 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328418 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328419 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328420 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328421 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328423 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328424 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328425 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328426 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1328427 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1329649 | 1507402 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1329799 | 32561 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -1329801 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1329843 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1331744 | 3433836 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1335476 | 2170170 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1335477 | 2170171 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1338369 | 8287 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -1341693 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1343063 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1343920 | 1914295 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1345628 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1345631 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1348659 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1352932 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1352933 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1357295 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1365186 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1379687 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1379688 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1379689 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1380111 | 473713 | subspecies | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1380456 | 473713 | subspecies | PL | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1380908 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1381121 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1382995 | 3052702 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1384549 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1384550 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1385657 | 686565 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1387562 | 33184 | genus | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1387563 | 1387562 | species | OO | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1389422 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1392499 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1392500 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1393935 | 138977 | subspecies | MH | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1393936 | 138977 | subspecies | MH | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1395574 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1395575 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400138 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400139 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400140 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400141 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400142 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400143 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400144 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400145 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400160 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400161 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400162 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400163 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400164 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400165 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400166 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400167 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400168 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400169 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400170 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400172 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400173 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400174 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400175 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400176 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400177 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400178 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400179 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400180 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400181 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400182 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400183 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400184 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1400185 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1401779 | 2768478 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1406314 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1409961 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1409962 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1409963 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1409964 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1409965 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1409966 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1411646 | 573 | isolate | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1413252 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1413253 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1414655 | 3052569 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1414807 | 315840 | species | PC | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1415246 | 354837 | species | CM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1416941 | 34145 | species | CB | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1417983 | 72407 | isolate | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1418810 | 119257 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1418811 | 1418810 | species | MH | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1420012 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1420013 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1424547 | 147271 | species | PP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1427476 | 2788865 | species | CV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1427522 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1428763 | 40068 | species | TO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1431455 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432547 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432550 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432552 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432553 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432554 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432558 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432561 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1432563 | 3432505 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1434070 | 2169886 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1435450 | 473783 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1436892 | 3431044 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1437010 | 9347 | clade | | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -1437180 | 58024 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | -1437183 | 3398 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | -1437197 | 4447 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant -1437201 | 91827 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1438697 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438698 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438699 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438701 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438702 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438703 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438704 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438705 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438706 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438707 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438708 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438709 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438710 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438711 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438712 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438713 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438714 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438715 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438716 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438717 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438718 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438719 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438720 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438721 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438722 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438723 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438724 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438725 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438726 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438727 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438728 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438729 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438730 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438731 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438732 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438733 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438734 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438735 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438736 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438737 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438738 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438739 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438740 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438741 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438742 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438743 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438744 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438745 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438746 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438747 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438748 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438749 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438750 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438751 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438752 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438753 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438754 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438755 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438756 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438757 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438758 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438759 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438760 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438761 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438762 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438763 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438764 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438765 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438766 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438767 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438768 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438769 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438770 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438771 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438772 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438773 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438774 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438775 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438776 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438777 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438778 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438779 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438780 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438781 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438782 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438783 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438784 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438785 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438786 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438787 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438788 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438789 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438790 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438792 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438793 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438794 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438795 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438796 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438797 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438798 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438800 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438802 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438803 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438804 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438805 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438806 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438807 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438808 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438809 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438810 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1438811 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1439320 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1439321 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1439322 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1439323 | 548 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1442610 | 257883 | subspecies | ME | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1445963 | 3296 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1446379 | 2821351 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1449984 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1449985 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1451263 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1451298 | 160079 | species | AD | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1452516 | 1298633 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1453155 | 753343 | species | HR | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1453426 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1454021 | 3431136 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454022 | 3430652 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454023 | 3431121 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454024 | 3427841 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454025 | 3432597 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454026 | 35342 | species | DL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454027 | 35342 | species | DL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454028 | 35342 | species | DL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454029 | 35342 | species | DL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454030 | 3427963 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1454227 | 3428035 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1455602 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1455603 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1455604 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1455605 | 573 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1457165 | 1307798 | species | WV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1457322 | 3052666 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1457503 | 62110 | species | DA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1458186 | 3403061 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1460422 | 72407 | strain | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1461176 | 41773 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1462681 | 3431761 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1462682 | 3431754 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1462708 | 56866 | varietas | LA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1462709 | 56866 | varietas | LA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1463138 | 3440 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1463140 | 1463138 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1463147 | 1463138 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1463675 | 57401 | species | CB | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1471299 | 3047854 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1476584 | 3047783 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1481465 | 1238886 | species | TN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1484106 | 3137121 | species | AT | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1489341 | 32443 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -1489388 | 186625 | cohort | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant -1489872 | 123369 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | -1489875 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -1489878 | 1489875 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1489885 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -1489894 | 1489885 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1489904 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -1489908 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -1489910 | 1489908 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1489911 | 1489910 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1489922 | 1489872 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -1489943 | 8111 | suborder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1497848 | 39756 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1503289 | 2501927 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1503291 | 2501928 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1503292 | 2501926 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1503293 | 2691594 | species | BX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1503305 | 26473 | species | BA | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1504569 | 3426258 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1504732 | 944994 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1505891 | 274794 | tribe | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1506574 | 40119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1507401 | 40119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1507402 | 1507401 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1507725 | 1231296 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1510155 | 93386 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1511771 | 2946640 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511775 | 2946635 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511778 | 2946627 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511779 | 3430893 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1511782 | 2946640 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511783 | 3431402 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1511784 | 1511783 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1511804 | 2946635 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511809 | 37960 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1511810 | 11012 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511860 | 2732549 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1511911 | 40119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1513238 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513243 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513244 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513246 | 2169595 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513252 | 1513243 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513253 | 1513244 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513256 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513260 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513261 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513262 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513263 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513265 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513273 | 333921 | species | XX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513275 | 936058 | species | UX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1513294 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1513308 | 69973 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1520881 | 147547 | clade | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | -1529392 | 3052730 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1534549 | 1511775 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1535266 | 1542665 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1537102 | 5872 | strain | | 1 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | -1537975 | 1978543 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1538075 | 452284 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1542665 | 1231296 | species | MY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1542744 | 1910928 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1548713 | 186458 | species | OA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1548718 | 1548713 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1548720 | 186458 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1548722 | 186458 | species | OA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1549198 | 311900 | subspecies | PR | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1549675 | 8825 | superorder | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1549864 | 2034996 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1550518 | 1972596 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1554466 | 584378 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1562068 | 1902501 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1563660 | 3048345 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1565088 | 3433066 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1566705 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1566718 | 1566705 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1567544 | 171627 | species | FT | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1569052 | 327375 | species | EC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1569053 | 327375 | species | EC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1569054 | 2169801 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1569055 | 2169802 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1569056 | 2169803 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1569258 | 2734409 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1573459 | 1747648 | species | RN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1577137 | 2845625 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1585420 | 33375 | family | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1592764 | 1987744 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1602124 | 3432496 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1603563 | 35740 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1603564 | 12456 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1604871 | 90010 | species | YE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1604875 | 1891741 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1606764 | 12109 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1606765 | 1606764 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608041 | 2843859 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608042 | 2845619 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608044 | 2845620 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608045 | 2845621 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608047 | 3052520 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608048 | 3052800 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608049 | 3426277 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608058 | 1884461 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608060 | 3052756 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608063 | 2501942 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608064 | 35303 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608065 | 2845713 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608066 | 2846195 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608067 | 2846193 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608068 | 3052749 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608072 | 988644 | species | SB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608075 | 3052748 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608083 | 3052536 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608085 | 35303 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608086 | 2845639 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608087 | 2845621 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608088 | 2501945 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608089 | 3428964 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608090 | 3426285 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608091 | 1977105 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608093 | 2843935 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608094 | 3052540 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608095 | 3052826 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608097 | 3052553 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608100 | 35303 | species | WA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608101 | 3052632 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608102 | 2844095 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608104 | 2846668 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608105 | 2844861 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608107 | 3052827 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608109 | 2734386 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608110 | 2734387 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608111 | 2734388 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608112 | 35303 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608114 | 2845539 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608119 | 1978541 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608123 | 2844833 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608126 | 3052554 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608127 | 3052543 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608133 | 2844037 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608134 | 3432584 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1608137 | 2846667 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608138 | 2845626 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608139 | 3052248 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608141 | 1884460 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608144 | 3052212 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608146 | 1978539 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1608533 | 3429955 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1609290 | 3427400 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1611877 | 2734433 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1615583 | 182093 | species | VF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1615758 | 3052522 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1620892 | 2734371 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1622024 | 347957 | species | DR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1628834 | 1156769 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1629665 | 2956585 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1629666 | 2955770 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1629667 | 2956586 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1629671 | 988644 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1631554 | 1986112 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1634381 | 1723728 | species | SP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1639119 | 5819 | family | | 1 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1640277 | 2788865 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1642018 | 3051977 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1642515 | 3048458 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1646350 | 198607 | species | TV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1647924 | 735504 | species | HP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1648004 | 147376 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1648008 | 147376 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1648023 | 147377 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1648033 | 147369 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1648035 | 147366 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1648036 | 147369 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1648037 | 147368 | no rank | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1648481 | 464925 | species | AP | 11 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured -1648482 | 464925 | species | AP | 11 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured -1648483 | 464925 | species | AP | 11 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured -1648484 | 464925 | species | AP | 11 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | uncultured -1652080 | 147387 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -1653394 | 11617 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1653395 | 11617 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1654339 | 3427583 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1654355 | 675074 | species | KV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1654357 | 1111709 | species | LJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1654603 | 3433152 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1655644 | 117574 | species | PP | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655645 | 117574 | species | PP | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655646 | 1385657 | species | GB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655647 | 117574 | species | MB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655648 | 117574 | species | MB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655649 | 1385657 | species | GB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655650 | 1385657 | species | GB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655651 | 117574 | species | MB | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655652 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655653 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655654 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655655 | 1655647 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -1655656 | 1385657 | species | GF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655657 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655658 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655659 | 1385657 | species | GF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655660 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655661 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1655662 | 117574 | species | MF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1658615 | 2748967 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1659219 | 1897731 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1659220 | 1897731 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1661062 | 2955454 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1661063 | 2732549 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1661392 | 344417 | species | VT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1661395 | 1986960 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1661396 | 3433226 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1662272 | 526119 | species | DA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1662286 | 1723728 | species | ME | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1662464 | 1285597 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1663127 | 2219055 | species | PX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1663197 | 328527 | species | GT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1667384 | 2956328 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1667587 | 50292 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1670662 | 3052180 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1670669 | 2788865 | species | LR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1670973 | 2844799 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1670975 | 39780 | species | UV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1671382 | 352926 | species | AE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1675862 | 3047795 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1675864 | 1111709 | species | OI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1675865 | 2560642 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1675866 | 3048442 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1676181 | 117574 | species | CF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1676183 | 117574 | species | CF | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1676267 | 1662464 | species | RN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1678003 | 291027 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1678042 | 441227 | species | IM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1678146 | 2948661 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1679172 | 3431243 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1679238 | 2560479 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1679933 | 2955300 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1680130 | 564644 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1681229 | 229219 | species | BG | 4 | 1 | 1 | 1 | 4 | 1 | 1 | 0 | code compliant; specified -1682186 | 330383 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1682187 | 330383 | species | VT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1682340 | 2169902 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1685502 | 37960 | species | PD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1685755 | 3432269 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1685953 | 38144 | species | ME | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1688637 | 3240554 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1690666 | 336476 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1690672 | 3431365 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692045 | 3428012 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692107 | 1428763 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1692242 | 3428321 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692243 | 642248 | species | AM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692244 | 642248 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692245 | 642248 | species | CO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692246 | 642248 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692247 | 642248 | species | DS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692248 | 642248 | species | FD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692249 | 642248 | species | FC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692250 | 642248 | species | GS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692251 | 642248 | species | HC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692252 | 642248 | species | HC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692253 | 642248 | species | LS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692254 | 642248 | species | LV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692255 | 642248 | species | MS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692256 | 642248 | species | MS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692257 | 642248 | species | PI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692258 | 642248 | species | PK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692259 | 642248 | species | PS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692260 | 642248 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692261 | 642248 | species | PD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692262 | 642248 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1692263 | 642248 | species | SB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1699094 | 1985375 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1701404 | 1385657 | species | GG | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1701405 | 1385657 | species | GG | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -1705090 | 2670808 | species | LB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1705091 | 2670808 | species | MY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1705092 | 1231296 | species | AC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1705297 | 44560 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1705841 | 124960 | species | IC | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1708248 | 41479 | species | AP | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -1708572 | 1987123 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1708653 | 1985405 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1708712 | 2734349 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1711684 | 3426175 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1711685 | 3047382 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1712570 | 3052523 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1712572 | 3052541 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1714362 | 3432941 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714363 | 3432953 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714364 | 3432943 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714366 | 3432946 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714367 | 3432948 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714368 | 3432950 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714370 | 39756 | species | RC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714570 | 3432493 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1714618 | 12091 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1715288 | 1548720 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1720595 | 3047681 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1721090 | 344417 | species | TA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1723728 | 151341 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1725329 | 3048283 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1729112 | 9126 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1729141 | 3052606 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1729670 | 3432971 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1736759 | 2010321 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1737345 | 2955369 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1737346 | 2485233 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1737522 | 2006147 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1737523 | 2006148 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1738045 | 10814 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1742594 | 3426866 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1742595 | 3426867 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1742596 | 3426899 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1743411 | 3052366 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1746057 | 35278 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746058 | 35278 | species | BT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746059 | 35278 | species | GM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746060 | 35278 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746061 | 35278 | species | SF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746062 | 35278 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746063 | 2982806 | species | SI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746064 | 35278 | species | SL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746065 | 35278 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746066 | 1249508 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746067 | 2982806 | species | WA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746068 | 2982806 | species | WA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746069 | 35278 | species | WC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746070 | 2982806 | species | WC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746071 | 2982806 | species | WF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746072 | 35278 | species | XC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746073 | 35278 | species | XS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1746074 | 35278 | species | XS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1747648 | 1511809 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1755198 | 1231296 | species | PL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1755467 | 39756 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1755752 | 2955269 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1755785 | 2955271 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1755792 | 2955443 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1756157 | 37960 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1756191 | 3052711 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1756445 | 10567 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1756615 | 939922 | species | UV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1757958 | 79633 | subspecies | OT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1758139 | 3431814 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1758883 | 2844039 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1761477 | 3432872 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1762023 | 2006158 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1763507 | 3052719 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1764085 | 3052685 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1764086 | 3052690 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1765736 | 3433231 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1765754 | 3429964 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1766554 | 693997 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1766557 | 1534549 | species | GP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1766559 | 2080833 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1766828 | 3433039 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1768064 | 1714618 | species | TH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1768874 | 37960 | species | SA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1769780 | 336633 | species | AC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1769949 | 3052037 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1770265 | 12289 | species | EA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1770613 | 3431645 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1770617 | 12174 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1770618 | 3427713 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1774200 | 3426712 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1774276 | 3426179 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1775963 | 3240550 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1776109 | 336635 | species | GD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1776153 | 3052183 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1776177 | 3426172 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1777015 | 3426174 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1777016 | 3432951 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778558 | 35342 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778559 | 3432787 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778560 | 35342 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778561 | 35342 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778570 | 361688 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778571 | 1778570 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1778572 | 361688 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778573 | 361688 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1778580 | 3048218 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1779340 | 2845835 | no rank | | 9 | 1 | 4 | 0 | 0 | 1 | 1 | 0 | -1780507 | 35249 | species | MG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1781241 | 675074 | species | DP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1788315 | 3052043 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1792583 | 3240568 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1795648 | 675074 | species | PT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1798085 | 3431697 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1802790 | 91888 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1803898 | 2955588 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1804153 | 2560620 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1804154 | 2560621 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1804156 | 2560622 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1804622 | 1804623 | subfamily | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1804623 | 3524 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1805494 | 38144 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1809242 | 675063 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1809767 | 328429 | species | IY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1811230 | 3428104 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1811408 | 2560648 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1812179 | 1233522 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1812308 | 3426765 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1813613 | 675074 | species | PB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1813615 | 1884450 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1815581 | 3426347 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1816484 | 2956587 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1816485 | 2956588 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1816486 | 2956589 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1816487 | 2956590 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1816488 | 2956591 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1817526 | 3048157 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1819678 | 1231296 | species | CY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1820326 | 2560321 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1821222 | 38144 | species | CF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1821227 | 38144 | species | XA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1822365 | 347957 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1823757 | 2501999 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1825924 | 3431731 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1825931 | 2169738 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1826059 | 2169885 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1826822 | 2956583 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1833824 | 1856642 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1833938 | 3433229 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1837089 | 2956547 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | -1840528 | 547124 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1841147 | 1231296 | species | BY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1843734 | 1985426 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843735 | 1985425 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843736 | 1985412 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843737 | 1985377 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843738 | 1985379 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843739 | 1985393 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843740 | 1985376 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843742 | 1985372 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843761 | 2844603 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1843773 | 2845922 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1844928 | 3052135 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1848040 | 3060718 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1848042 | 3428898 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1848150 | 2956607 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1848151 | 2956608 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1848152 | 2955781 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1848153 | 2955782 | no rank | | 9 | 1 | 4 | 1 | 0 | 1 | 1 | 0 | -1848169 | 3428880 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849328 | 90010 | species | EG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849531 | 908833 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849532 | 908833 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849533 | 37960 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849534 | 75747 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1849535 | 3433234 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849537 | 2955264 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1849542 | 39780 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849543 | 2955492 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1849544 | 988644 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1849545 | 988644 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1850906 | 3047737 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1853762 | 3427761 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1853865 | 3427722 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1856030 | 39756 | species | GS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1856031 | 3240497 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1856627 | 908833 | species | PS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1856642 | 3431756 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1857323 | 2613861 | species | TK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1859149 | 3050361 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1859161 | 3433233 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1862127 | 3240463 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1862824 | 1910929 | species | GH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1862825 | 2004962 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1862978 | 185786 | species | EF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1864484 | 3050363 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1868472 | 1770617 | species | YV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1869931 | 687091 | species | EE | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1871153 | 3431208 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1871631 | 1809242 | species | RS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1872710 | 2169864 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1872719 | 2560351 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1873455 | 1914447 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1874267 | 39756 | species | MT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1874886 | 3426918 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1881013 | 3433853 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1882382 | 535600 | species | SO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1882732 | 103956 | subspecies | CC | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1884450 | 2219049 | species | HV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1884455 | 2501985 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1884456 | 2501987 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1884458 | 1513294 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1884460 | 1884455 | species | AX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1884461 | 1884456 | species | AA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1884640 | 5234 | family | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -1884832 | 2956541 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1884917 | 1548722 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1884991 | 3426929 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1885248 | 1897087 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1885927 | 2956522 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1885928 | 2169692 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1886606 | 3240485 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1887213 | 337052 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1887214 | 2169878 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1887215 | 2170255 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1887216 | 2169879 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1887217 | 2169881 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1887218 | 333938 | species | BT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1887219 | 2169881 | serotype | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1888309 | 478825 | species | WB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1888311 | 1809242 | species | BT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1890365 | 3429978 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1890423 | 649996 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1891704 | 37960 | species | SJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1891713 | 151341 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1891714 | 151341 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1891715 | 151341 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1891741 | 1891713 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1895012 | 2976112 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -1897087 | 186458 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1897538 | 1910929 | species | CB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1897731 | 194960 | species | KD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1899219 | 291027 | species | SL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1899566 | 3427738 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1902501 | 3432190 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1902502 | 3432191 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1903340 | 1906179 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1903412 | 91347 | family | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -1904408 | 2955296 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1904409 | 2955303 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1904410 | 1723728 | species | RH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1904411 | 2955472 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1904439 | 347957 | species | SR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1904880 | 3426844 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1904881 | 3426840 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1904882 | 3426951 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1904883 | 3426968 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1904884 | 3427111 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1906179 | 38144 | species | AF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1906245 | 336476 | species | MV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1906317 | 3430613 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1906668 | 3426850 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1907771 | 3059782 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1908665 | 159332 | subspecies | MO | 2 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1908807 | 1680130 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1908808 | 1680130 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1908811 | 1680130 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1908813 | 1680130 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1910928 | 2732539 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1910929 | 1542744 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1911602 | 2560077 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1912919 | 1049657 | no rank | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -1913124 | 3431741 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1913125 | 3431742 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1914295 | 1914298 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1914297 | 675068 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1914298 | 675068 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1914447 | 3052624 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1916095 | 79633 | subspecies | OT | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1916236 | 1761477 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1918013 | 3152110 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1918014 | 3427581 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1922348 | 2585030 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1922602 | 1922348 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1922604 | 1922348 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1922669 | 1922348 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1922934 | 2508259 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1922938 | 1922348 | species | HM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923351 | 1922348 | species | JT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923697 | 1922348 | species | WC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923716 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923726 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923736 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923737 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923738 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923739 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923740 | 1922348 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923742 | 1922348 | species | WM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923743 | 1922348 | species | WN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923745 | 1922348 | species | WP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923746 | 1922348 | species | WP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923748 | 1922348 | species | WP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923752 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923753 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923754 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923755 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923756 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923757 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923758 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923759 | 1922348 | species | WS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923761 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923763 | 2560845 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1923764 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923765 | 3429963 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923768 | 1922348 | species | XD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923769 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923770 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923771 | 2507505 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1923772 | 2560846 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1923773 | 2507320 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1923775 | 1922348 | species | XN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923777 | 2508251 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1923778 | 1922348 | species | ZM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1923781 | 1922348 | species | UP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1928073 | 1401779 | species | MD | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -1929150 | 90010 | species | EA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1930602 | 33342 | order | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1931113 | 3427361 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1936269 | 336476 | species | HA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1938656 | 1922348 | species | JT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1940252 | 3047706 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1940555 | 431037 | species | MR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1941233 | 2844440 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1941234 | 1941235 | species | TG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1941235 | 1910928 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1941236 | 1910928 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1941237 | 2844569 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1941238 | 1910928 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1941239 | 2844612 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1941435 | 3052705 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1941436 | 3052704 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1941437 | 3052270 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1950126 | 3047760 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1955054 | 3426987 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1955247 | 7524 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -1955493 | 40068 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1955730 | 3052333 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1958777 | 1073966 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1958778 | 336476 | species | BI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1958784 | 2576578 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1958957 | 1250315 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1959930 | 371833 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1961665 | 526119 | species | QH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1961666 | 526119 | species | QH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1961785 | 936057 | species | RX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1961833 | 8941 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1961834 | 1961833 | species | CA | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -1963758 | 9989 | suborder | | 6 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -1964372 | 345249 | species | CS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1965238 | 1111709 | species | PR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1965306 | 1680130 | species | LS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1965344 | 2734294 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1967841 | 2734385 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1970065 | 2169757 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1972572 | 11271 | species | VC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1972589 | 32613 | species | EA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1972596 | 32613 | species | EK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1972597 | 32613 | species | EY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1972700 | 336476 | species | DM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1972716 | 3433267 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1972995 | 328429 | species | TV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1973265 | 3048451 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1977105 | 1884458 | species | CW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1977392 | 3433830 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1978413 | 3433335 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1978532 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1978539 | 1978532 | species | LY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1978541 | 1978532 | species | LW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1978543 | 1978532 | species | LK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1978920 | 2560649 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1980412 | 3151837 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980415 | 3151839 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980416 | 3151837 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980417 | 3151837 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1980418 | 3151839 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980419 | 3151837 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1980420 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980421 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980427 | 675845 | species | EF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1980428 | 675845 | species | ET | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1980429 | 675845 | species | EC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1980430 | 675845 | species | ET | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1980431 | 675845 | species | EI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1980517 | 1980415 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1980538 | 1980417 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1985366 | 1910928 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1985372 | 2844423 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985375 | 2844429 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985376 | 2844427 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985377 | 2844428 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985379 | 2844441 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985392 | 2844504 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985393 | 2844505 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985405 | 2844518 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985412 | 2844528 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985425 | 2844548 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985426 | 2844550 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1985699 | 3427192 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1986112 | 3433737 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1986190 | 1770265 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1986960 | 1986961 | species | AA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -1986961 | 12058 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -1987123 | 3429213 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1987125 | 3429215 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1987129 | 3429219 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1987130 | 3429220 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1987140 | 1987125 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1987144 | 1987129 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1987145 | 1987130 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -1987744 | 3052163 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -1993640 | 3403061 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2003309 | 3050241 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2003394 | 564644 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2003395 | 564644 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2004962 | 2844585 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2005033 | 1566705 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2006147 | 2955470 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2006148 | 2955468 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2006158 | 1891714 | species | BO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2010320 | 3427360 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2010321 | 3427352 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2018325 | 6994 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2020310 | 1554466 | species | AS | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2021209 | 35300 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2022639 | 464095 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2022641 | 2022639 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2022857 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2029065 | 7516 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2034996 | 2034997 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2034997 | 2501949 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2038729 | 3431046 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2039307 | 516546 | varietas | CJ | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -2045258 | 2806 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -2045261 | 2806 | subclass | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -2047826 | 121823 | species | CC | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2048238 | 2486284 | family | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -2048239 | 2048238 | genus | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -2048240 | 2048239 | species | PI | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 0 | code compliant; specified -2050584 | 3426905 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2065824 | 166784 | genus | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2065826 | 2065824 | species | SS | 10 | 1 | 1 | 1 | 2 | 1 | 1 | 0 | code compliant; specified -2072024 | 3048204 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2072716 | 6274 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2080833 | 1511771 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2136291 | 1292273 | species | OW | 1 | 1 | 1 | 1 | 9 | 1 | 1 | 0 | code compliant; specified -2169561 | 2732514 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169567 | 2732535 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169568 | 675063 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169569 | 2169568 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169574 | 2732537 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169577 | 2732553 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169595 | 151340 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169596 | 151340 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169609 | 2169567 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169610 | 2169567 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169619 | 283494 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169650 | 2169596 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169663 | 2169574 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2169692 | 2169650 | species | AX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169693 | 3426186 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169726 | 3047715 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2169738 | 3427008 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169757 | 1891714 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2169801 | 3427756 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169802 | 3427752 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169803 | 3427755 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169864 | 3428201 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169878 | 1513238 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169879 | 1513238 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169881 | 1513246 | species | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169885 | 3428514 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169886 | 325459 | species | EX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169902 | 325455 | species | GX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2169960 | 3429932 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170064 | 3431495 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170103 | 2948924 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2170117 | 2845912 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170126 | 2845932 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170132 | 3240474 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170135 | 3240546 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170170 | 935650 | species | PX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170171 | 935650 | species | PX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2170255 | 333921 | species | XX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2172821 | 6657 | superclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2204151 | 12429 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2218011 | 2005033 | species | AU | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2218046 | 3143224 | species | MP | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2218050 | 1566718 | species | LM | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2218081 | 3101718 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2218082 | 2218081 | species | AB | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2218119 | 376274 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2218120 | 2218119 | species | HF | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2218135 | 3101718 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2218136 | 2218135 | species | PG | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2218198 | 30092 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2219049 | 675074 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2219055 | 675074 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2219250 | 469369 | species | OA | 1 | 1 | 1 | 1 | 5 | 1 | 1 | 0 | code compliant; specified -2231382 | 2231393 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2231384 | 2231393 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2231385 | 2231384 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2231387 | 2231393 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2231390 | 163725 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2231393 | 3814 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2233855 | 2231382 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2248770 | 1777016 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2259808 | 3052031 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2290931 | 28890 | clade | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -2315733 | 14366 | species | CB | 4 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | code compliant; specified -2485233 | 185759 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2486284 | 37844 | order | | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant -2497569 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2497570 | 2497569 | subphylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2497571 | 2497569 | subphylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2497572 | 2497570 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2497574 | 2497570 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2497577 | 2497571 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499398 | 76804 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499399 | 76804 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499403 | 76804 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499405 | 2497572 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499407 | 2497574 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499411 | 2497577 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499606 | 76803 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499615 | 2499606 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2499616 | 2499606 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501926 | 3433752 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2501927 | 3433782 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2501928 | 3433784 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2501931 | 11118 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501940 | 3151839 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501942 | 2948893 | species | SG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2501945 | 2948721 | species | GT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2501949 | 2499411 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501952 | 2499407 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501968 | 2499405 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501970 | 1980415 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501971 | 1980415 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501976 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501985 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501987 | 11157 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501994 | 1980416 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2501998 | 1980417 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2501999 | 2509489 | species | TK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2507291 | 2501952 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2507320 | 2599620 | species | XM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2507497 | 2501968 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2507505 | 2507497 | species | YX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2508209 | 2499403 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2508239 | 2508209 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508240 | 2508209 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508241 | 2508239 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508242 | 2508241 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508243 | 2508240 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508247 | 2508243 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508251 | 3433816 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508258 | 2501940 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2508259 | 2508258 | species | HM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2509479 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2509489 | 2499616 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2509500 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2509503 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2509509 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2509514 | 693996 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2545470 | 1985699 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2547355 | 1679172 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2547356 | 1679172 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2555566 | 95179 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2558200 | 3073811 | order | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2559587 | 10239 | realm | RX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560063 | 2732504 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560069 | 11158 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560072 | 39738 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560076 | 11158 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560077 | 39738 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560078 | 39738 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560088 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560100 | 249310 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560105 | 2560063 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560185 | 2560076 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560194 | 2560069 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560196 | 1980419 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560218 | 324901 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560230 | 324901 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560252 | 1914298 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560254 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2560289 | 11572 | species | OA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2560321 | 3051377 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560349 | 3047686 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560351 | 3427571 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560371 | 3047722 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560468 | 3050285 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560479 | 2560100 | species | BF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2560568 | 3050310 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560614 | 3048219 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560620 | 3432238 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560621 | 3432521 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560622 | 3432239 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560642 | 3051421 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560648 | 39760 | species | IL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2560649 | 1891715 | species | DS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2560801 | 3050360 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2560845 | 2560088 | species | AX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2560846 | 2560088 | species | AX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2566501 | 124006 | species | CB | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified -2572045 | 1761477 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2576578 | 2560218 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2585030 | 2559587 | no rank | | 9 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | -2585815 | 91776 | species | PH | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2599620 | 2507291 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2609695 | 12877 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2613861 | 1980419 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2621980 | 568 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -2622732 | 367188 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 1 | 0 | -2654645 | 1761477 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2670808 | 190729 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2684882 | 131209 | subclass | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2691594 | 2509509 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2692248 | 3041 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2696291 | 33634 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2697495 | 33317 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -2698737 | 2759 | clade | | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2707335 | 5455 | no rank | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | -2707348 | 5455 | no rank | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | -2721536 | 7953 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2731341 | 10239 | realm | DX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2731342 | 10239 | realm | MX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2731360 | 2731341 | kingdom | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2731361 | 2731360 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2731363 | 2731361 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2732091 | 2731342 | kingdom | | 3 | 0 | 1 | 1 | 0 | 1 | 0 | 0 | -2732092 | 2731342 | kingdom | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732396 | 2559587 | kingdom | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732397 | 2559587 | kingdom | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732405 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732406 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732407 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732408 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732409 | 2732397 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732412 | 2732091 | phylum | | 3 | 1 | 11 | 0 | 0 | 1 | 0 | 0 | -2732413 | 2732412 | class | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -2732414 | 2732413 | order | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -2732415 | 2732092 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732416 | 2732092 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732421 | 2732415 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732422 | 2732415 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732423 | 2732416 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732424 | 2732416 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732458 | 2732405 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732459 | 2732405 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732461 | 2732406 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732462 | 2732406 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732463 | 2732406 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732464 | 2732406 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732498 | 2732407 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732499 | 2732407 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732500 | 2732407 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732502 | 2732498 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732503 | 2732499 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732504 | 2732500 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732505 | 2732408 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732506 | 2732408 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732507 | 2732408 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732514 | 2732409 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732515 | 2732514 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732532 | 2732421 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732533 | 2732421 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732534 | 2732422 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732535 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732536 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732537 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732538 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732539 | 2732424 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732540 | 2732458 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732541 | 2788829 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732543 | 2732461 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732544 | 2732461 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732545 | 2732462 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732546 | 2732464 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732548 | 2788833 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732549 | 2732505 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732550 | 2732507 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732551 | 2732507 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732553 | 2732506 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732890 | 2732544 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2732892 | 2732503 | family | | 9 | 1 | 4 | 0 | 0 | 1 | 0 | 0 | -2733223 | 40120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733224 | 40120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733246 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733248 | 2842408 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733254 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733256 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733291 | 10404 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2733293 | 186534 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2734294 | 1891713 | species | AQ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2734349 | 3427224 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2734371 | 2733246 | species | AI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2734385 | 3426146 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2734386 | 3426109 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2734387 | 3426122 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2734388 | 3426137 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2734409 | 2733254 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2734433 | 11584 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2734594 | 1980418 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2741926 | 47523 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2741929 | 47523 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2743705 | 7953 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2743714 | 30727 | family | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2743715 | 2743714 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2743716 | 2743714 | subfamily | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -2748958 | 2733256 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2748959 | 2733248 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2748967 | 2843481 | species | IP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2756270 | 192382 | subspecies | MA | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified -2768478 | 33372 | tribe | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2785011 | 6544 | subclass | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2785015 | 735337 | superorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2788829 | 2732459 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2788833 | 2732463 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2788857 | 2732533 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2788865 | 2732541 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2789204 | 39804 | no rank | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -2797651 | 707741 | species | ZC | 1 | 1 | 1 | 1 | 9 | 1 | 0 | 0 | code compliant; specified -2810354 | 377833 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2811596 | 224510 | species | IP | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified -2812636 | 3166 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2821351 | 3313 | clade | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | -2839668 | 40093 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -2840056 | 3403061 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2840070 | 2840056 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2841720 | 886583 | subtribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2842243 | 2732407 | class | | 9 | 1 | 11 | 0 | 0 | 1 | 0 | 0 | code compliant -2842247 | 2842243 | order | | 3 | 0 | 11 | 0 | 0 | 1 | 0 | 0 | code compliant -2842313 | 2499407 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842319 | 2842247 | family | | 3 | 0 | 11 | 0 | 0 | 1 | 0 | 0 | code compliant -2842325 | 2499407 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842369 | 3152207 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842407 | 11270 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842408 | 11270 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842542 | 2842407 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842594 | 2842325 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842607 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842620 | 2501952 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842645 | 40120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842680 | 2169574 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842848 | 10811 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842882 | 2501952 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842921 | 2842313 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842923 | 687329 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842950 | 2560063 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2842995 | 2842319 | genus | | 3 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -2843481 | 2499615 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -2843859 | 2842542 | species | AB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2843935 | 2842594 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844037 | 2842620 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844039 | 2842620 | species | CI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844095 | 1308858 | species | SD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844423 | 1542744 | species | GB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844427 | 1542744 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844428 | 1542744 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844429 | 1542744 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844440 | 1542744 | species | GE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844441 | 1542744 | species | GE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844504 | 1542744 | species | GP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844505 | 1542744 | species | GP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844518 | 1542744 | species | GR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844528 | 1542744 | species | GS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844548 | 1985366 | species | GC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844550 | 1985366 | species | GM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844569 | 1941236 | species | GE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844585 | 1941236 | species | GH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844603 | 1941236 | species | GS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844612 | 1941238 | species | GE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844799 | 227307 | species | GF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844804 | 227307 | species | GH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844833 | 1308858 | species | SH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2844861 | 2842369 | species | AH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845539 | 1308858 | species | SL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845619 | 2507291 | species | MB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845620 | 2507291 | species | MC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845621 | 2507291 | species | MD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845625 | 2507291 | species | MS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845626 | 2507291 | species | MW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845639 | 2842882 | species | MA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845713 | 2842921 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845835 | 3431573 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2845912 | 2169663 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845922 | 2169663 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2845932 | 2169663 | species | PR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2846193 | 2842369 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2846195 | 1308858 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2846667 | 2842542 | species | AW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2846668 | 1308858 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2847088 | 3052611 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2847270 | 1902502 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2847522 | 642994 | subspecies | HM | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified -2848317 | 1961785 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2866655 | 9918 | species | BA | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2867347 | 64579 | species | VR | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified -2870378 | 1511779 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2871195 | 1902501 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2871196 | 1902501 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2876817 | 64579 | species | VX | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified -2890311 | 543 | no rank | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -2908833 | 2785015 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -2914707 | 211558 | species | AF | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant; specified -2916678 | 3239874 | order | | 4 | 1 | 12 | 0 | 4 | 1 | 1 | 0 | code compliant -2927998 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2927999 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2928000 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2928001 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2928006 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2928007 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2928008 | 241750 | subspecies | AA | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2932129 | 53124 | species | PH | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified -2942679 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2942681 | 2732408 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946186 | 2732541 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946187 | 2732541 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946194 | 2942681 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946627 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946630 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946633 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946635 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946639 | 3079366 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946640 | 12058 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946790 | 1661063 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946823 | 1661063 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2946827 | 2946194 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948661 | 2946639 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948686 | 2732892 | genus | | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | -2948721 | 2501987 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948851 | 585893 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948893 | 2501987 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948924 | 151341 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948930 | 2560077 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2948932 | 2732892 | genus | | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | -2948940 | 2732892 | genus | | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | -2955264 | 2946790 | species | AI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955269 | 2946790 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955271 | 2946790 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955296 | 1891713 | species | AM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955300 | 1891713 | species | AR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955303 | 1891713 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955369 | 185756 | species | AL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955443 | 2560100 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955454 | 2946823 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955468 | 1891714 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955470 | 1891714 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955472 | 1891714 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955492 | 2946827 | species | BI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955588 | 3427735 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2955770 | 2948686 | species | DB | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955781 | 2948686 | species | DF | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955782 | 2948686 | species | DF | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2955836 | 2948686 | species | DS | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956328 | 3431861 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2956522 | 2948924 | species | TS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956541 | 2948930 | species | TG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -2956547 | 2948932 | species | TR | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956583 | 2948940 | species | UA | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956585 | 2948940 | species | UB | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956586 | 2948940 | species | UB | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956587 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956588 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956589 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956590 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956591 | 2948940 | species | UC | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956607 | 2948940 | species | UF | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2956608 | 2948940 | species | UF | 9 | 1 | 4 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -2960224 | 2946630 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2960910 | 2948851 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 1 | 0 | -2965324 | 49669 | species | PL | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified -2976112 | 1461176 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -2976338 | 153286 | subspecies | MN | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2980669 | 159337 | subspecies | MY | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -2982303 | 5338 | suborder | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -2982305 | 5338 | suborder | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -2982316 | 5338 | suborder | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -2982806 | 38144 | clade | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3004043 | 74694 | species | VL | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant; specified -3039755 | 27434 | suborder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -3039756 | 3039755 | infraorder | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -3042114 | 34735 | clade | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | -3044472 | 548681 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3047382 | 10639 | species | CM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047678 | 12258 | species | CR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047681 | 3425826 | species | WC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047686 | 10652 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047704 | 558016 | species | AB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047706 | 10652 | species | BT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047715 | 10652 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047722 | 10652 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047737 | 558016 | species | AC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047760 | 1911602 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3047783 | 310684 | species | CR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047795 | 558017 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047819 | 12141 | species | TM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3047843 | 10652 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047845 | 12270 | species | NA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047850 | 12270 | species | ND | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3047854 | 10652 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048157 | 39734 | species | UI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3048204 | 558017 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048218 | 12051 | species | MN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048219 | 12036 | species | LN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3048236 | 39734 | species | UP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3048251 | 12270 | species | NP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048283 | 1299309 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3048345 | 558016 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048399 | 687332 | species | BH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048408 | 687339 | species | IS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048442 | 558016 | species | AU | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048451 | 10652 | species | BW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3048458 | 39725 | species | CZ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050241 | 39725 | species | CB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050251 | 10319 | species | VC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050258 | 10358 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050262 | 1232637 | species | SC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050267 | 180252 | species | MC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050285 | 548688 | species | PF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050304 | 10294 | species | SL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050310 | 40272 | species | RM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050317 | 10294 | species | SM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050360 | 1232637 | species | ST | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3050361 | 3048399 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3050363 | 1507401 | species | BU | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3051377 | 2560194 | species | OJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3051421 | 558016 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3051977 | 2733223 | species | AD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3051989 | 2733256 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052031 | 1507401 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052037 | 1507401 | species | BL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052043 | 1507401 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052135 | 39725 | species | CY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052163 | 742914 | species | CR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052180 | 10803 | species | DS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052183 | 2842645 | species | DH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052212 | 1980420 | species | GY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052248 | 2501976 | species | HW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052256 | 40122 | species | IL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052258 | 40122 | species | IL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052270 | 2169609 | species | KA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052318 | 1653394 | species | MM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052321 | 1653394 | species | MO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052333 | 12051 | species | MP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052347 | 11229 | species | MP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052353 | 2560185 | species | NN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052366 | 2842923 | species | OH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052437 | 11572 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052441 | 11572 | species | OS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052520 | 1980517 | species | OH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052522 | 1980517 | species | OJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052523 | 1980517 | species | OK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052536 | 1980517 | species | OT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052540 | 1980517 | species | OW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052541 | 1980517 | species | OY | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052543 | 1980538 | species | OA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052553 | 1980538 | species | OW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052554 | 1980538 | species | OW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052569 | 2560196 | species | OC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052570 | 2560196 | species | OC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052577 | 2560196 | species | OI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052579 | 2560196 | species | OM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052581 | 2560196 | species | OP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052606 | 1307799 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052611 | 1307799 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052624 | 11095 | species | PS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052632 | 1980421 | species | PW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052633 | 1980421 | species | PW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052665 | 11584 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052666 | 11584 | species | PN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052685 | 11584 | species | PT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052690 | 11584 | species | PZ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052702 | 2169610 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052704 | 2169610 | species | PH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052705 | 2169610 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052711 | 1506574 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052719 | 1506574 | species | PR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052723 | 1653395 | species | RA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052724 | 1653395 | species | RC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052730 | 186938 | species | RC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052748 | 2501994 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052749 | 2501970 | species | SA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052756 | 2501971 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052771 | 1511911 | species | TU | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052800 | 2734594 | species | UH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052813 | 2733293 | species | VC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052826 | 2560254 | species | WP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3052827 | 2501998 | species | WI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3054905 | 3487 | tribe | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3058443 | 1172985 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3058444 | 1172985 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3059782 | 2733224 | species | BI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3060718 | 187214 | species | SE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3064797 | 2235 | family | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | code compliant -3072906 | 379584 | superfamily | | 2 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant -3073806 | 3078114 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3073808 | 3078114 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3073809 | 3073808 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3073810 | 3073808 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3073811 | 3073808 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3073812 | 3078114 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3078114 | 8825 | clade | | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | -3079366 | 2732543 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3101718 | 376275 | subfamily | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -3118152 | 2621980 | species | HS | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -3137121 | 1463147 | genus | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3143224 | 1585420 | genus | | 1 | 1 | 1 | 1 | 5 | 1 | 0 | 0 | code compliant -3151693 | 2497571 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3151837 | 3151693 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3151838 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3151839 | 3151693 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3151840 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3151845 | 2732423 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152106 | 2942679 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152107 | 2732538 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152110 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152116 | 3151840 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152119 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152120 | 3151838 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152124 | 3421323 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152126 | 3151845 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152141 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152142 | 3151838 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152144 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152146 | 3421323 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152147 | 3415267 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152207 | 11270 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152209 | 11158 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152475 | 3152106 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152483 | 3152106 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152501 | 3152107 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152639 | 3152207 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152641 | 3152207 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152653 | 3152116 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152867 | 3152119 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152873 | 3152120 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152905 | 3152124 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3152926 | 3152126 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3153030 | 3152142 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3153055 | 3152142 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3153067 | 3152144 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3153072 | 3152146 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3239873 | 147537 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -3239874 | 147537 | class | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -3240463 | 12195 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240468 | 12195 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240474 | 12195 | species | PB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240485 | 12195 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240497 | 12195 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240498 | 12195 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240517 | 12195 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240525 | 12195 | species | PD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240527 | 12195 | species | PE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240530 | 12195 | species | PG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240544 | 12195 | species | PH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240546 | 12195 | species | PI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240548 | 12195 | species | PI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240550 | 12195 | species | PJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240554 | 12195 | species | PL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3240568 | 12195 | species | PN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3241188 | 1343920 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3243772 | 3239873 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -3243775 | 3239874 | order | | 4 | 1 | 1 | 1 | 4 | 1 | 0 | 0 | code compliant -3303203 | 27319 | genus | | 4 | 1 | 12 | 1 | 4 | 1 | 0 | 0 | code compliant -3342348 | 79653 | subspecies | OO | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -3358290 | 150311 | species | OF | 10 | 1 | 1 | 1 | 2 | 1 | 0 | 0 | code compliant; specified -3366610 | 2157 | kingdom | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -3368986 | 2622732 | species | HS | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -3368987 | 2622732 | species | HS | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -3379134 | 2 | kingdom | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -3390273 | 570 | species group | | 0 | 1 | 11 | 1 | 0 | 1 | 0 | 0 | -3403061 | 10239 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3412625 | 2732092 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3412723 | 3412625 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3415267 | 2732540 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3417955 | 131220 | order | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3417957 | 3417955 | family | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant -3420546 | 3412723 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant -3421323 | 2732540 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3424890 | 2842408 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3424891 | 2842408 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3424976 | 1511860 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3425084 | 2946186 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3425096 | 11270 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3425105 | 3425096 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3425826 | 12050 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3426109 | 3424890 | species | AA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426122 | 3424890 | species | AB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426137 | 3424890 | species | AG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426146 | 3424890 | species | AL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426172 | 2003394 | species | AC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426174 | 2003394 | species | AE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426175 | 2003394 | species | AF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426179 | 2003394 | species | AH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426186 | 2003394 | species | AP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426258 | 3425105 | species | AV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426277 | 2842542 | species | AH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426285 | 2842542 | species | AT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426347 | 217160 | species | AT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426670 | 10814 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426674 | 10814 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426677 | 10814 | species | BA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426712 | 10814 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426730 | 10814 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426765 | 10814 | species | BD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426792 | 10814 | species | BG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426840 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426844 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426850 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426852 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426866 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426867 | 10814 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426880 | 10814 | species | BN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426899 | 10814 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426905 | 10814 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426918 | 10814 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426929 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426935 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426951 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426968 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426987 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3426990 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427005 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427008 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427013 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427043 | 10814 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427106 | 10814 | species | BV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427111 | 10814 | species | BW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427192 | 3424891 | species | BH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427224 | 2003395 | species | BR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427248 | 1511809 | species | BC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3427251 | 1511809 | species | BF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3427352 | 190729 | species | BM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427357 | 190729 | species | BN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427360 | 190729 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427361 | 190729 | species | BP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427400 | 190729 | species | BS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427571 | 2560105 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427581 | 1918013 | species | BI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427583 | 1918013 | species | BN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427666 | 39731 | species | BO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427713 | 12174 | species | CA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427722 | 2022857 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427735 | 12163 | species | CA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427738 | 12163 | species | CA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427747 | 12163 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427752 | 12163 | species | CD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427755 | 12163 | species | CE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427756 | 12163 | species | CG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427760 | 12163 | species | CI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427761 | 12163 | species | CJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427773 | 12163 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427788 | 12163 | species | CP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427841 | 3152475 | species | CL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427963 | 3152653 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3427967 | 2842607 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428012 | 12160 | species | CT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428035 | 2169619 | species | CA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428042 | 2169619 | species | CG | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428104 | 3425084 | species | CC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3428201 | 2169569 | species | DF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428207 | 1511810 | species | DD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428321 | 3153030 | species | DA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428514 | 12059 | species | EL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3428669 | 2842680 | species | FP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428775 | 10988 | species | FZ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3428809 | 129725 | species | FD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428880 | 3152867 | species | FH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428898 | 3152867 | species | FS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3428964 | 3152639 | species | GT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429213 | 12091 | species | HB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429215 | 12091 | species | HD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429219 | 12091 | species | HH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429220 | 12091 | species | HI | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429932 | 12316 | species | IP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429955 | 3152905 | species | II | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429963 | 3152905 | species | IK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429964 | 3152905 | species | IN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3429978 | 137757 | species | IC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3430566 | 156208 | species | MD | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3430613 | 2842848 | species | MV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3430629 | 249588 | species | MH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3430652 | 3152501 | species | MK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3430695 | 10812 | species | MB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3430893 | 1511778 | species | MA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431044 | 104766 | species | NF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431046 | 104766 | species | NM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431121 | 3152926 | species | ND | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431136 | 3152926 | species | NP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431208 | 2022641 | species | NN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431242 | 10892 | species | OC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3431243 | 10892 | species | OC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3431256 | 10892 | species | OW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3431303 | 10405 | species | OL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431365 | 2733291 | species | PO | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431402 | 1511782 | species | PA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431495 | 10882 | species | OM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | -3431573 | 2842950 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431645 | 3153067 | species | PN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431697 | 3153072 | species | PN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431731 | 119164 | species | PB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431741 | 119164 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431742 | 119164 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431754 | 119164 | species | PL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431756 | 119164 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431761 | 119164 | species | PP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431814 | 186886 | species | PC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3431861 | 185753 | species | PL | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432190 | 1511804 | species | RB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432191 | 1511804 | species | RC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432238 | 2560218 | species | SM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432239 | 2560218 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432269 | 3152873 | species | SC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432492 | 12137 | species | SA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432493 | 12137 | species | SB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432496 | 12137 | species | SC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432503 | 12137 | species | SP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432505 | 12137 | species | SR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432511 | 12137 | species | SS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432521 | 2560230 | species | SP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432584 | 3152641 | species | SW | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432597 | 3152483 | species | ST | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432787 | 3153055 | species | TN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432872 | 12234 | species | TF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432893 | 12234 | species | TT | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432941 | 11007 | species | TH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432943 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432946 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432948 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432950 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432951 | 11007 | species | TJ | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432953 | 11007 | species | TK | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432971 | 11007 | species | TS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3432979 | 674952 | species | TV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433039 | 1298631 | species | TR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433064 | 3424976 | species | UB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433066 | 3424976 | species | UC | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433152 | 1513308 | species | VA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433226 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433229 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433231 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433233 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433234 | 674981 | species | VN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433265 | 184751 | species | VP | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433267 | 184751 | species | VV | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433335 | 2560252 | species | WA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433737 | 2508242 | species | BB | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433752 | 2509479 | species | AF | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433782 | 2509500 | species | AR | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433784 | 2509503 | species | AN | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433814 | 2509514 | species | AS | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433816 | 2508247 | species | IH | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433830 | 12176 | species | PE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433836 | 12176 | species | PE | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3433853 | 12176 | species | PM | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified -3456997 | 4762 | class | | 4 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | code compliant diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/virus.acc2taxid.gz b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/data/data/virus.acc2taxid.gz deleted file mode 100644 index 55c31c83adf522d66adebabd4621bf2b63ff5304..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 10768 zcmX9^cQjnx*Ve|wXc4_j^ymaL(IZF@qD1c`BkCB@OLU?PB6<&k=-osodYOpML}&D< zL)35H-?#1`d!K#pI(OfDo?V`^4tvZ!yp%|cJszQRwni-%f2@7~TnxW^;4`N4)}}*j zM+`6iQ*_j!lCkwRhTyYeln}0Jo#rCu}xfcfNyO;4_ z^nQEdNhf#GMHD;?LhJy0e2BTE6#||S#;pwq~2tg zwr)mrSZ2(`(`X(jCsH-g8B<(9PC7QvP}H4h8FL*W_nUWiRIBTm*HqE3_UeCz^Y5&% zq5MCnLCJjeGsj>0#aK_?Yim2n-@O1x%}YFBrk#2P&rHlzXVj(O3ID;LMr^R}BM7g{ zzjfs^O4RodsGPE(D30%Z_;Lw(T z$+3#KMzGhq`9s5=2U`As}uS%E6}$N zBXtv1ho5?;5hjjzQ{<*X$2D%%un=$sML#ny4zn7nw z$BMQ5&T1RlkbcA2pud+~#tmU|`}mtCXWpzyi~_nATn5vKwkdd_;o{j$JQE0Ugt1nB zbeD%0V}1MZ6G4@76Z<=6>GE)^`bBc#b=tq6cc0?)Yk`2f7ea1r0rGazJm?@(=c3E4 z4$%s!Z^0yK3E5mwdsofof8F`X!S%|NGi|%v#jqDLSZ}G;WM_3Yr-%0hP?X`DVRRg2 z05Zxz5W`mxxs{4ZF2g}7DK^zpbjHV~$sx`1Qp9sNg3-=jMZ(NpkPB?CUvI)?_z46}2-ZItI9~rU32%5@Qdg4sT$86;r zD5O_5NqJ$QVv#IdOn{*5@pfgbV_M}KN(U#`oM+u{{)a3I!<8M}Q{zWh*& z-3(52cX7>)=1?mL^t+S@n563OqZv*3)@V`Zn{!#^TjLQCb3eXG_A?u$S-5GhXS{wu z&ejQOyptL~jM_!ok5b3q%CrAno#ZyoVHmkfH)B@U**edeqoCD}||Jjn0s!dltGhz??gaY9msAmP;DhaDMN*6|37%kg2s2fj!74GnIP)8DBU ztvh0@8i-4e)8EP>Y|b-4P{oJ(-+BTb??sv``+xkYb${;Q)^g^PnLEY#d6>5OcsLu6 zv)!QivYXK?)KS6gRq?cYuU%0f@`LcLM`s+p)(VkUAkud@8+MZFXlM~WVJQrhzH@+K zQ%|<57q}}HDs18}uVKF5xZVhwDis?1`aAjy=$)&3QO*giJZk6?l55d8a+3zfKi~p# z-p#K}=Pm!cD1;#4!>q8ib!oHnNST_~{@~~K?}q01gS!{|CE7L!cd#>zxXCs!7hk)2Li*ic+KM#$?R_-Q!U3zEQ@cPmyUbKZ^B&Di-ZMztm#E4OkE$_ibc>(j$D)t1awx)&MYzG9Y=0+o{fbyUUFxosq zn=6U>d#bW&p{Lix%By2o9S-waXR2`DGU;Ul|NZvPVt?RpBHYvWtwNi4MqG?oA9d)} z1`ith?8MC{X&7w#;Cz(&97*}*pu!)}e(vgPQTweglY zzmP$?zyK~XM@GJ0ZszaUt5n0wU@g=QM)BHOCG1+xg2kJ$nkA+!6jPLvpS$zPS>}x> z_LF`{QuF=Ge=RcRBnZX6B%zr%uiQ)e(ICxtl|t17hS}Q2|6!+T=>HVA@l&4PA)b_Z zI6Odivc2Hyw!p6l%lha1_SIa4+>gI&kv|&L&dmc$O#MDAVJIc@e+Ar4x5+kHY_%^? zsCa*ah{F9<3IMYvHFpnIvG;zjn_mL=3Kc${$KG!vS7Dnm32{ahTNEusihaaXt*b- zBz?fn$tkfxSL3BGAHCKx6WT)isPRC@22QQD+}Qkme3GIcCiN*>?#%KAb5cF)SI-n& z2VApyQIi^OrXLU0_AFZ3yTA5x%z(Y=HJp$_3|pJfyojb|cQLE%sWAAJlcw48&_x*a zdTs zkCpDXvw4i2_fr(;z@J$mMh7WdY-;I^*Mc^5I~HPTg?70V!h0IkW#%yc27!~P>Pnlq zfHA1sR{YC_CwtbjwuN#`ZZkM-hK)GVg3ONr%K-XM&NlQXnJI}x$dUPx1uNs^-h4q% zK79{cgq&|^i*FZBa-GdQ-VZMde?P07P+-w!McKpl3@Lf`70FA_zi#g9a%N3A&_M^@ z6H924gV7!|Z~ z42MW7@A0<%!`_F$wU}ZX_q|CG3N5T!?8^-CPCmjBb|vBv(N23Gv3rEE;{VBk<`Aod zW19pwKo&LY0Hq-8%{6@^Rztv-Etre|{4dR;hgw&ffAFOSNdo~+_qC0Rz_Dal!KxgRf z58Ex&SVkLA*t)4lNBFX??j1Wkc0DbJ!4cayvuB7LtV#cCIlg4Uy61-7g{=`k>vKrY zHeaDcyichyd*_HOSG|5jX%?#d(b3~Db2!jWux!r6;A%60F!FEd)>d7mgw(rng(p3* zbA*~m;{5)Qe;>m?pDaGc&aI@CkA+{+7-Jyuh;7+sgbR$o>szk;v-(kfimA4_YqcRr z48F{WqeO}!yC`6SUGRMIrXW~o->2;FYL8Dm_bG2%@Kx)CALoV{OF+(=Rfaq3-E7x0 ze!AJgSD>f-bG)3iwFoH(qNL2Lr0mW?EaMu<61*AL02yS$=|y)oh{l%5D!HNShE%pq z{~iGC>jE2eJEB=UoY_dA?$B|@bzpK z7SwXq!{oQJ7NaacE>tHYh50?S#g?uGuJ@;V@}Zp36*g5l#bmOWN{T&;3vCb(R$ts@ zl!wgDn=&|mFW6|yqH^hf%Ho{&pL#UtQ9m<&Y%ykp3oijyp}!lk+6Rra*T%-TBk4f? zzT^JNISoaZ3H9Ou16HtqIw8 z&txO$owRdDp6*)$T-d)lO&Exfx~vb9;@TL$nb{bj^rev~MS+wGXui71>3RVRpVNo$}9TniQYW(!{mNia)Qdr&huX$#cpPDI9We~!e%uZ{|H*Xn}s=qAR0h z0%1E1RrU+1hiY`6md^5jJo{Km-=6&juy6ZEk)OS!8+GiQ@>|nfo#I(qVR9&%THd`PMWPJr@ z>G4t)di50jf+7|DT4TY%*i736ea(ZWP_~hXzTT|J?dE4Wn=q~HVq`hqWYR7lzu`msA)^^eC~gWSkVHS9rCMg(DmkCIkR5F zyOZ#iGiB7bjW(1=!C5QSn-kSZ`kCd&W&ta;Z6B^r+QHQL z-h%Ev7hBm`p})}{r9LwopG?c>fWo#(H0pWl9dzUQ+SQ!Pu+e{H>aL#Duri-muthTC zx67w4wd~T{X61HHh&jvtSJ*n8eZcUBOJJ0r)b~(o@J?jr-temopnCc zdTO536pqW>SJ=-747NU^!m(Kndj~v-?)!;O*7=9`?R59V2`#a4EC+ z1iZdKOD-}OpK5k4xjcaS6_cMj6+_ogQ?|x^HTUULIOMdS>p%VIv$C&t%OA;f#QARj z6}hzQP<{l9cSm4rt`}t)tX`qjQep9LQV*MVhs#NL!OhCl<&ne3UFd0iupu+*Bq?`X z0eqK-x$ZeN5~uT7cLR)|6ZOUvwjg(+*LPImtirpzn%;KW-WieAR5w0C8XH*|AU(D@ zy&R7VD;_n`F+@}jYvT48x2NYfs0`aT@jdW!hpE5sC9l_4!IIyd?r+U;+!H>n1zUg7 zp=+qOsC3ri(fL#>Sm0;;&h4#xr92p2nWGUQzdBTDnN?K@12wq-5D$1?Qud*h-(!Dd z1fVVF)sJ3~^V*TAG)6pP7tK{ZQ`c)mJ4Q|Fy0tb}tDLDSr`F3pqAHyzw0UBj74Jd- zg|&R@8#j1~Q0z&2J)84daN^*))t?w{%T+7!0052D%ZL_(&oV)56a(f5tK>gO+Ph;X&N?_M@?FtvgpC|$*bIJT3_LymZnv{B( zWpsy$IIVnVxE>5b`9@2(&L+>IbFZ1u;@Ow=TqgB>D)&8G_NbcWHW0SdZ1=$Q{o7A@ zsPqGTqf%vfS&9zYRo3Q_1$Y5bX`*bs{JRV0xaXvOkud}V)V6Z(ErJdU#uT? zddz>JASFR(#dCv>C_Tl6e2iK*Kq$!-1z!wC}7P%V0MiJKQAo6O0X=xaqR40~LtCM1OsZ(GC zk43}^*?lh$FK3`fxi8Q?E9eBkBCQ6PBr-)VzoATF#1emH>k>b14K7iuj{PEi-a8zF*3llD-eHgKaKGX8W;Qc5hX1rlhZtx9S%3 zrwhpClK>aW<+I))o|$oQYcpI-iYo~hGC@zBbI0TB&KuENQN{$+l!JqAg^eAO@mH*7 zW%(?ZQV5L&h%l=f+F$=e^^X%*vVU2rjqVmEYYtvWD}%()S}Au%wP>MVj`pGac)V85 zxk1TB6nMk#L4Ei}3qY$5QG5X_$7R^Q{281WN2Ntl7pD9E8OmTRCD&u=m?;Uo4=wOy ztUeM_5s6eS3_DiT=rQD>9EdBFj*fq{wrcnId$(tG>l}ky>g6b~ylGb&?@E4+sT+AH z6?FA|(q36?{3sj*?Ow7)5ZdF`1Rp^ZesA~}qR8`^9DP<0AxwZ`DZal z1L1F*xaFT(FkQ`W76~k$AXw6eHBqc5V?^OBBu}x_4;8F{&*cQRF7N^O&%WFeKjzq( zGpy|BZ1u2a(P+5Q9H8_LSCV_%9&E?}n3O&Q*#=>WA88iJO=AFdN)a9qnO!(r#*dCxZ&M=@LEBMf<)=Vb;-aF)+&@6o4w?WlHwTY5FKp z!S8d%Rd<3v&`-Y}^0;z%*g-bRHTsU`8f8`7QGMxeht*()J3&8ik&#(_;cI&>SGC;t zlGJ?BDLaY#!Q0Xac&WR*2RVq;sY!=n->t$UBC?9UC#d`)3kvIzskDdE`};|1$m8IU zJ6Kt4`G8AMyzj*OUQ^CK_a`WSuWxHqjbbjAg}y=8PqVuD&j!Tdq{K)BjPDh8==~{m z7guR|iorQE5B8o#6hkW}k9c)ngs38tKYO8mFK)I%awyhvnN|L7OyHSn!?KdQFPwr> z^1hJjol<>sDEWKuKPl`FNQZ-qQwmis;_;vFv5 zDQaD|+grO%JpZ2I+eW6^k^U5ZgD$*B6eF3_j!5A0ZkP}q@zKt&lHdxGRyz$~)8E>? z|1#tT|M?O|CA@v{Gj5M6=>MS>=->*(EGDR@Ztumfxl#xQN@2YfdRCtOmK`1>Li<_ zIM^(70h>q-Ix~hWjuwbb37vwVaxXk{<(G+Aa9M=Qs9(qg4}im5OimCr%mRk@^)P@| zXKh0gnAtm6qmW|VDhpILM5rU4PiG&&bIIcTqBjh5n9RZ#98TwcO=%^QfbsgpVntUx z{Tg3p`Dqye1FEH0n3W@iUnJ%I^QP>y_H+G<9HMiZqep@sT;CKFURQVGdz&&U?fNWO zuIlT3aEwp%FVE)78gOH0un4^~Iof0U>HYe}ZhFu^o-Y`qfg>r9nRYJ5?b}6MIG|Dk z_#$o>Qmo(6wHFpL>Gx@IP2Y5}#Vh@cg2hJ@Rz%U%-PM!0G!Sxc%PmWu)ndnn27mE1m=T^uQQ)`ZqI1Y1>=Y+rc7?#$r*^<0U zQqbmKsE9cSyGnX>2FdAKBCKN*CHgekZPtU1!fx?-^(uV6ne2|;Uw&cC^KcjauuS!W zHIDZpJ(6(M9f+ppG!@CB_{7zx z7PzRBF`B+e9l9K(o*psVz5ZsHv^l36LAy)ZGuI`6WA!R{My@iB9g6!BGGw-XhTJM$xnW4%W|nE z@JtgZ$rjMIjQ2#5P`~pfVubl@gn5l?2XB&8s`C$@zHK0t6-x*-Uu!$e*MN2Hmp;-8 z@O)>?&xX7dNN(shl0m9zGM&Kh7WDnTu>it2TryopcovU}hd%AeG&%lw0Y~hIPR}kJ zz)`DlaoA#eLK;Qs7EX#V^Dn8X0De6<7>}X zP99%Vz9_H?EIWDJYM!8~lu$acs7O;;qPD9sP89xq(v6)D5qj-hrnXuei0wu*n3v-1 zUUDPx8hVulSzqIAl#A}Oe!~m!%uW&WN8OT)dZ+TUy_B_T|25_R0-~$76Dz^?uYZK| z5$Mz?$GzUJ2v0}}0u5ZPBX9`$O?NTCI-`*jZ&6y2FqCqg+bMZqM> z-1150Sv=bN;Z=$bBuUzJKcR&6()Z8S4-6nJrWz|KAzuQ6&P(ENlmF~*)bSC3zE;V| zmCsevRWx~cn}NpYUZUr6;<$p#yQ~Q_==?D17C?R|W!A<4nRcRSkQcE+%pC1{1#P)m zl=7++6GlxkgYk533$|)5tNaK-zg-&i_316r8AubxwVBWczbc43oZrnqX7rpZ`^m zfV&V$wypF@%g@t3Rh+HQ=F0Lh=Z>%a40E8@?<9_rt^*#b%hj9}3K)GaUVs1fBK9p$ ziqAkzvgs3DZ9q8*mh^G=R(8NC5qE*yU94yDl( z9#&+zkcWr`CF7Sa;ty7esv=aq8jeYK_QNB5%Wvr_s7o1%xJxp27 zlT|T)%aKvpVZ!p4xRij;N9&@k%CePdCIKvcdC-&ShRgeFc>)duQi@EypaiM3#DKwE zkQsj`2_NM$-t!${dX^vp?^U(3k70v1KR>5FG5}e-ATD57*P*$Nf5cUyIHF<5V4}Sk zZB$DCn*T>$Km5#|zR+HE#^93KJ4RKGEQ37{|7*_Y4oR+x{C+bFfjFf)+5kcwaOgYR zUxGJMAY}*Q(Z0NY_>VkP(tJajFWNHjO!u1Z+e`IzH}*e^aXyEJ(s4cyA#>Z`JB=P> zgQ_}(B1j*dQ6T*lD;y)9tZmm~<}(s@uV2`rvp)}yzh#hEV3SxA?>0fDi8**Yt5da~ z9_uPFqIuJ~;6gGwZyb3=pcm(a_oWVh*r9<9g! zH^gKC4mZ^6)@; zcm~mxhG`^V%TCX!(6_3M;#4$a+qu6<{KioHA482)UtbtYdQn#v$?c1cxBAkYdeimv zOpmiQ^h!_~GAPAkzKzr^f?=Wu7bq4`W?@0pB!Q{mb-&)Qn;jC{=#<1bS5Y69=EUxn<(n*1$43vxcfF$z@r87^)RFxm@=m3yea__;q#v) z{q4CGT9*ey>Us$(vuDwU3&hz_gq3d9eC_AKv77onxt^&8*ng3W!-@k^Ww?S<*RZgi zB3$x7Nl--30#z{Zo!{&UWSTU~z97)vO}4=WE>% zSgIQWykB7r|9e={KqX?$Z8T6*aLCH$!+PcX&P2ysZAC`bq#O4KJk(bF1l|VMt7%C* z!AdO5q0Cg4SQaWcK}%QZ8fm21Ois|>XNa|s({wGv*{k$2L_J$uTeWR^pxnV5RI{#a zI*!}CLKjWEBC!Mn9ppyU<}7kl_eI+ zzF1ndb?3nvaN7-J!0LGRfY5ukMtws#S0mnHe_-aT5$~i{5sBk`$52Ouoe$x3epe(+ zd3X=j`hw#L#o_#7l{pMvB^5z8LHw}~5;sL=$o}Znk&8cG*Pbb-=|+FWjMfl*TSzh@ z(|(Q5Y*k{j6PczY2AxB^^i9)*C?Dxj5tZC$FYB<3EGl{Hw= z+O5H(SfdC$L02n69P$3Jznl6+gcoKHy?by(A8CHi%;S#kh*#|z_32BacA@{9>Q$aE z1In)JI!*a&KS$p@N{n0_SQGI!GyYgBrs^=NvojBKukNFyEgH#|d3S>rGo`07h&&R% z8~_}Q#Z?Eogb7t!yv8R#ytY`PKEI|O8Pvq68YxJ3NB7?syQxYvb*5Co94?{as$Hw` zwL1S9oYrWf*i|h{|J3=Kl7f0x2XwV0WLmld{(^>$7D|A_Q`2KPuqD54%UL4o>V1t> zkbRmqTb1>l-X2jFuv|daO*CVHup|iigsFcJUmy>k$?D~ySZA~Y!V7-*Pp=-It`pZb zMvHD|U(P*6sJYqlo&-TqCn)mjw&0Q$o8;^4EbaT@hI_jGxaDFkMeQ^;x0rrhE_jW( z(8e(7Da@qVP`RCTk{g6=(*y(to+Y*^)^vHg7wTj|^!I+8k}k5mr-4$?E|1nEttqC- zcE5K6?gX`2+^0r-u3M0_V@>!9%zRR6qetmV=_YZdK zUC|Rhpnd9saf%PkP?=nY@YNS%f35tj)@)w1K&f&W_DvEzP!HwB0Ls55LZc@Bmi7LG ze7o+gyNE4^60gKfrF^zsX}Q5q^c>|V?DP z=7*c%>Wc4qEG2IH4EQIbuWbykErL-GdkqLno`*PCYHTx)+^cqPD$8v#r|7F=qfqS_ zToOA&F=nbg&iIZZnvXV{6aXJEBq+F4>y{osH?|7S^xVl9vI3Z|_Dls!`J;(*TUhJd*<71fl{-b4i1Wb8tK|apv$B8@1 zCZur~+PKXOHqNDm_tzl5VM}XE*PT?lg*Y$Lcy?>of1G={vv_4zXY?)MQq|ZPM%<}J z1*1x*G5<)%qQDvo9;@RRl3Ak6j@gRLkZsC$ldr}zH{b2}p7SX^DYn`F#(qJYmd9&8TAOK=L$Xk89+0Y(X=B7OYr+Oca!;} z2BzDekq@OYyrktK;XC9 z{r20FpDxeow4c2GpYxwTZ+CzDwE4I_dHwqE%lW6x!{^=R_Sav%{@;_=m*nWXFT%J4Yn2D?#KZ#_J9gEnQrd5Hf#CTdojfFu*V_Md`&-Jj7Cy}WutQt1$*qhAs zh_3M@VkVl2MB21rSeq+9l%6EoJI_VLlZZz1`LbxDr+jj8c|Hhs3~AH7e2lrsStZS3 z(cv_imJL_XvCFhfLKW0ck&YHH=`?W?(6LRSV_^oiN_!ABW03V;vIbjvDq^8%5vNHc9B{P^s{p5on3U5-pF7Q| zJfntJ8@Wt_Q2j~7qb;Ifvei)V3^C`WMWdk}ld(EM=*NiZ(gXa-;hF9xjusx%s_2YS z5N+C!siV&_-HAytn=&nYbVzqi0P*4TOH1aUusPg0R~ezm6Oq_Po69sPp@7>wD_Vwk zG|WKr$t^5%kBN9{IL3UHG?vL@L2xfIv&;#fuOhZw)#rgD$_bg&TY#lnVkU8bJ)%i} zLMx%6b5XQZUon#`!?Xuvdn;%10Dx{5lc|j7K_yLF;Ri8;9-O!?Mu>5#B4eQ_kcctg zQ0T~3I_8H7M`pXty?KaWb%CG~&kESOK)fXku$ey$Yk^ZXPo znkP`|h?7Q>D8z_$O_>dVK%*3OnG;8HN=4)s3edF7J0Q52MXJA`*px8>#g3zJ-=Z(* zW-B!GHJ)_)pUXf%j^IqBKeGsIgT2tFCA19L`4Mt^VscGfZ@ zu!u)4^WGM2%OX!*2~CnRQJ*U*1tV$$TY-W)B44C0m25#^s_T<^r4bdYCJlT=;Hwh3 zs~RM?R&qD)7$nmw7el&QosQ9b!=TDh1AgPpie1jbpZq}In}vhFHFs1sM*z)+aX?6l zX?4N@PSp$(3WcI)bf~`S9j=|lQl)`&Bq70^kZBdjEM^K$iFU5@Wzsy$sD}=8T7pFn zSfvLWW3~-V?FXQbQ=%3R28eH-8V*L|tL26r>uYuEjd4&FQE{w{vkl6H#*l7Svzb8y zg05L^*_7e9!?c8>V=qAoP8?#G!W9TZp`;U~QGyl;m7uU7$drN14D7QNon`K@VNYVp z=CF$6fbb1HD&j5Vz=^{ z0)zJyVNb&m86S!eB9<^6F$nKm{Sz$`O-Jqshq=`JIl3&OF->J)#Szu$^U|F~icA$J zS;;uqVX`M;S@GPV&1(k|#@;&4o_b+Lj0K8k8j|7!ug0eobH}l89Hz!_gDA%}AVw}D zvxXhYvh%2p6FMG_=0)Bbj5N)Q8ab+8I*vu{^1QVxj87#yuWryejsqRx2C!<}JVODY zI>MfYanyQ;fwEL#V}@Cga@OT=oE2G;U|(Ic8v?YD(S=mqzamlRLG0>sa zrVerpk-`xGi;z}BnngV3+kx9y%>JquBJ3R{XG}D}AW`&&1DkX01^!)8#e9((b5~1K zEyg+&wXgXBT$)@nQb)k(QY-ekDFet*mAs*W#Vh$ihsl~y^J=C;7K5-TuR#~mxX`}~ zSWA)~3^ho#pfQE`XtIExL&s)VN8PgJG=(mzr@OmAXc=W@bK}M2q*^wIf-Y7wxh8$C zi1k!N`eLM*`bS58Q&T=;gW529-ns>082h+@4IS_y*~cFvv&;y%p9m_j!2H zVURrxS~J(+w0}c3SmO*5!6%C(Z-L`uJyaqQ#}Qx@v76%$x%OgBNM~EJrXbKmj7rA= z{UJ%Awc?g8S)<5%U&M03ZU;_MlQ(Y;r`6!o;qjG&s&!O+29f4TO%-X5vs6uQynxBP zoR3&M&zF^B!7|g74HKVg`lbTqMyy5x1n9Rd2eT2}gQIPX>lqpG}=K9K#m#FouDi1(zc1U`y95enSGE zfa)n*;Z@f)i*R_KE283>_FsTWw#}@aK@UowVhh7TQXX}jxp=nJ5sM9bp(|Lw=RCj~ z<_2f0>d=m|QTCi+j^n%}7oAW;s@ALnG+9uE_*jmEYglFsGN&{Z%Wj`G+wjo@-{P~M z@Xj4}%u6!|&Oj{N&S8t!rl^`d2PFx<4 z(T@-VzRC>aAkBYknJR*L(xno}hr4|`UtmYUOu{=8ag;Kw=J zvwJ1TOB@f;QLo6aIPiwQ{{tN8(T<o?Lu${`Aqws~^t~-<`br z?)>fDmxr4zpS-+0fBE%)e|Pfj|DAK=zNWTraq{Zo{QHZGAAk7%^6P(n;{ERK&wR)K z*#qg{ec-Fd19QQv%lh%B%X2>Mr+V`8;`}#f_q)44ZLc2oXIGo;`?Jmc{r>D~bM;|+ zc6ImZdUIyiausrQb>(kqW1C>#`gZ&7t+T(Q@%HM?+1r~>XVcc}&F#(mPwV|^z5cS> z+~03^tGAo|&DFZC*6W84yY1$BzoNcc|8;e}dDxsiy7rXTckkA8`fjs7egF5>di`+o zal2ZtciX$&^>(*fuXpd)H`l9w9UYIKt)2|{^mAG9>DQSlr~fK@KK(u!_34+HWvA~C z=3TA-yrQ;RU#yr{>zmc<7xaQosjt@SkM}Ej@p$O<`&E1T>0SP`zq;FP*B@^_tu9`) z7wdLPtM$*T_4iV-F<%lVYU8owcGAL-#+Zm9xZlud-vtd)!oPY+wEU(9{zTA zWQeP~+uP0ketUiTZnJ;*`SktYf0K^iZ$3WU-QDg_UR@sj{OULg==2ekUtZJ)tH0cA zzpU2lFE~W+ufV}ht2MKpHBZ}eg0XywFgIeRq?w? zlO~%0c~HnZyLmy9ZnC@CB)bs|1(hOifeN*dhP-&>0ohFo9Y-kbXjMiBYO(kz1!ii8 zab$)8>L2RpOtrLFV1%iRosnuQw$>`zc5Lfo{Lb%g;QYduj#B#H&iU@W=iJ}IGqC+EzEhC9Q??A#g_m0KBz<5g?Q^whP_4fxFdzDxdn;OTp^h8g0hedR_ zXJBZw=Y}m0Y?aII0Y^uVZ{7c<(LQz8n23+w42Z|@92wl`uxwDky!vyQM%lqI`M~EW zj3+u1aRp<<7g+z%!06E4S+QRnWq&8V78vdv-0bV?85|Ki1lqXG4~fog-6M`65H)l= zk>xxd>b~x=h?0*xySl=TT<4dhXk)icFODb zczlG6IoLfw;zPp;<=N&B2oPsv2iiDpI4A~ua+SjQG3X1d^o^@4@h*oqT^mH&J<^rf zI5gOp7}&Bs+8iAn9Ug5Qv$z8m-%QtB2Vv7hNv2_{;;cruCC&pGjC~T(rs-{1O^hFeeulIpP4Q3 z-hq(Jl%KN^`XA}&ogQPdjWJ_i&7Fg~Y4ItU?L;#E$=77b79>+vrN-IbBlGSIlF5Vo=?@bprgo~%GENo5}9)!*XyB$$P^W5 z8G47z1;3KnrXf>bN9#4oxE~g28M=hbhACtVWS%_Uo8WSP)-_qOA;|2n(Bp91#Q0~Z zakc}X)t1xVu#Y+QBx{!S{#mEzMxkR;Ijt8JOb?cj zeem0ls%acBI8du~gdp29iE$Cx`82jgWC1T@FMEp>s=2l|#~h2W4%yp3^0j|)Kf^pQ zUCW~2_=_c^w?)RaR@2^Mg8lpg#!q~Crk=SbdJk3*$0MR+ca65W37kBWO*Uhkmu!h5 zwk~c~GTTIB9!u363W6KUDzz=>n=zhD@+I_M(fHX;8FQ|Z{Lw1DoH>PXZk2KOY5&@$ z81sIc9v4JR9}9E5H9PTkPqvn!`^BUdl3w_{e!8~LV)}V6VH%UY4VP#cI$X?GW{{4s z?BjE39G9YZxPUPb9s8kq-$~hsi zWzVY~WlI!1s30G;0MoNYdOe#DdQ0?r&B!l1iV44vVD(fD`2#pFYU3D`_42)%_ff3( zIOk`q_d*r(Kx|%8PB8-x9oM|Kog^kPjc`U>);5wq!ZPj*#~W}t6yp3RI)b-q|Ds96 z9LZq(WZW{sAPT@jX}wVoS;&5KG%M@;f{EVMqdRu_^A+jH6zBJkRI6!$fjJQ0? zaRj{`T4uWw%zDaU_#fZA>(@Ak!IwUcUz`&ktJHf#2ZHG<)pOB$V7hY2Z-}=b?>8zw z+Fii=5Uzb8i*(=&e4O$#`U=eVKSnhGaegq3F%Z8kuhTl3P(#;eGcKa{VLEf+Q@p8) zr>eOj=>6Afyp3~;;Od@af`Ex26Zb4f(-Yb_^^!yjiB>V1Teci)*wHY0cbGKa7S z?{}4vEs*&+-y<%6(KeC}jG4mArm#+H#2p$PusC zu+5?)t({{*xOQhQ$E9Gpd=dLsboA?3wO7i`!UD!r_WN3a=6w{k;_Lv&jEvh>L30s< zZEt(@xMrDqu8!@KeLT5>&JlPQAJAuDdnepnN!4>>!0&KAuP6TKSi?RSy${~b`9Nd` z{91$plaXgCpQ9hvc+WMA4afEBxW`7RF7S8u`nd5k8N}0|65Dq<3LKpp{} zx*kQ~b1&6t%a<2QQ*nYbO;ajjB*Z>_1>Ap`w&?} zHQ9o>1C%>)W7!y1N@6&&(pg2PPxVtii_#%7TNoTk)V*l+1wngmATtGPtXOKVBdnhjd znujaNKGgXCv@)+`?)d=u9Pi29FM0?++1qF}tp^O=dX2s<;rr=>{N9MT{P!*7U-+#z zmt$3M-rB@iiR>Q!rhwXbImA2=Twdn)8E|q{3Hc3Yl}qWmhDMMR-=jPkL(O}ygt%+J ztrI74>DKgDvyWula~)b10;c_5-W%#FVTyaT=4ckr#W(XwdM<9#n!#dXo$Gx8m&iAgQ_{BHDN2e0Ufy-w4 zzaoUXu#w`(en0&#eG6|vP3g;_ILABAFfivrVeU7#F zSIwpzZ8I*en%`#%YS$Zz+q?&!xIc8)Zi~Teg zHXmL?v4FGaeMJ=e$i>kjt)mq&cqD^bQ(pI(fT!$k zdPo;Z&8d}>-De63zrEFcS$t7h5=e2kRty?ln(D4o@HqTPru$5M5DU2P6Ku-cMF!Db zP!sy*BzK*NleM?H&lFPCy^`UsQ)bTpna3R=(b*oHz-6e9e@k`OiGxd4j=N4-_RuAd z`%E#Y=%p<8nX;89PI}xyz{B~sxX%>eL**X#hq9GF{&)f=*#Cc0+#d>W+rK&ie29X= z36>QOZU3VCL)7*iX%hgCL(Qoa^Ir&_4X@5q001A02m}BC000301^_}s0suce?Y#@M zC0BVKcy3GR0VCAAC|g?yTH3`16&6RT=cy_IqHA{v6`+@;mXKsf3&bNbF9it1!XVXV zC*Cn;AmDh+5Nu`a$&g9#Fl!~mlPo6!Gfra1iIR|)V=v>_iR0KNfUzMsM*03a=iaKm z+^SpW^u672R?3`P-Irdr_jmUG_y2$2|2ThZHVg2%{cmo~iYIS#@W)w(&y%ZXhUb=3 zCxcUWysQdN-5H#^^~9+l4#F_IHoQIz!y=96VHgELcIwTqf9o6H`6sVW(^GGG+v@^6 zvxm-`%`~?SXTEPNccg7Ja~fN6Zmn+~J+|3X-g#nn&#m~}g3oRE+;n1gEB<^-bzhp! z?mc&5Sz~`-hYio95g~KDGINW#Y<*K^(=KF#$XrHtNBua{u09i!gHXvb??I7~y z3uiM`x=J%^8>aA)%y4ZbV-0>Ic+)7~(Y$dh*Ye6QtyY3r)p*u%rLv{n7`20XM$pGf zJNOAPz)!D1_#b-v+ujttEt>f&^q+U*c{BCo-7WerUmN`>OyV${(<@K5(a(|{@E<#W zHe<{lg>uS4BCKB7V)c@>uv!pS zakNN*RUBnuyp7c&?lvlpZmpTD8&@bJ8^$C~tk3GYk*bnTU8<`N51U2YVN?I`b%afR zWCAu<0*pV6Px1FI1~zYNv8g6tbH_c~*u=nQ5$9Q!&+*EWbO)P!2b<&AN1luFr9-OPo=^mdccsJaz!j7({so(Tk6?+voZz5Iq-|yaAujpS*CUpC&N0jQ%}hXYh?tZ-{4ePytB@K_C~wDnxcL{&K@ zI~bc^5=b3T=l6g*pR9L$Qxu;}Pev!AXtTXVo9Q!v<@R5I6Y=ED1lddtLl(BqL{t<7 zS)?=yl41^&!X4YaSnS|*6>w4xD}~{{G}0++%U#R7nzPC>Zkcsm=O7>&K5&Z;lz;t+ zD+!d(zW<^LuEk4$%9pV62Orr2Dz~<%{D~>3WYjmS>94Y#;m{cyfi`Ru8`|!Y?@y z^^W3wAGw?$e0&mwmjl9Q0H&Y8kMzlxwGh_(K^Vu2u%L|<0Kqhjc1(E|?QE+@>G+j! zzJOxWXvsACcFa@Sxl6ahU1}OzTVZWoTg$L% z8VSRMGpW?^gT^53`A5&Z;aSrUQi@f-3!e)Xv{!CvK{z=I!mhm%CO{)A;zc&kiX;uT zvB*0&`#6kJSz${!l`y_yrNU3;l^Q=wgo7UQDugpec{Q%MV~6mJAeSeb?H)$a3B}3@ z8F2#c=&T$DZrg~5aYT6Kc>%ogV$rz(U6gzjXG=S#vX!kHEtK+==A~1Wy!N?cV7bi! zcuHe8TQ6w-b>0Tei%CKARjd0x`K|3Eb#yRni+A7mFvwAy&GCxEU?5s^YQ)Bd!C{nD zNrtCvm~IR};*Io-(G^0JV+Zz3jMmn={XJlGCvf-}c3Hf-x^CMKBbc3tuCB#mG0&1N zmhJq;F9RLp`wC7_(@4%eU%5`nZBuFRyWs!rx6UV&e*U^C zJL&wDv;8}td^()%_qTQ_8bB%8GjJnkyI2Gnd`Nl~`HqziIwulVT6j(+HANvM{3cha z3WST2S{*15X|S0GO(*KD`23sex9#)M*-M9U2){k(pa3=x7C|(}&uquuWE~3klPk?k z4g2d?E>2Tr6ufCixWW+IR92iL^gnhW&)8-OHVe!y20ku6AHHPU8Jx{tJb+QUeUV3b zoY5AElPsRcY20xh;SMlQV0*yblen;OJ277iS31N9Sw~fFWg6$q%VQP=&-;AUu{k9%D29U-O*SLvrEoj zgCk_XUMdM=1Ap1k;($%f*xt!DyT;?y`Fe)~_T$Odw{YD)0j|@}SF*r1TFmiE)19ay z?@rhZ9uRz-M%KDkFf+t1*1mRx1ZCuTvaS&8OaCigRrv=4RTq_wL||EPazifUF5vWT zeE!$hZOzJ6i18=af{k`r0e%?PIgImYhZ_&N3;)pzfEq_cp^RlxK`4;i7c~gmTA4<8 zN`a_V6w<<>6pkv5UpZA}j-91vjQ9?c&28D60N&#vF(ymz;6=m0uDk=_7_}Z$);dsG zu@kZ_x=r{vtQms`4zZ=tu4znN^UCAK)B?bHt|tx&j786`f9%h5!s5wi1{0kCq9$K+ z*O8gJ`i>Ti>qf!Yi*XCnsEC6(y|Nu#lAZ*E@1^k^?zs$x%rn9>#N3u%xwiS*hj~o0 z%{Il;SI*F{K6VL=)FX7-whjje&SmXO4`EoX+|oEWeI+)?(Y0|HCl-T~VR#}0|8ruo znOpQKK=6}TwGa7hvAXi#F@VTo`^pbWyWlIp|3)nZDL+l+3W3uh zJ&&={u~r(`ZOX)MK5!#ZWZ@3ZGv$!1T z!nCme-dV#e%Qrit$AH#Tfy!5lZNojRSY|s;Xck88(M<9fDsfT-`9R=HVV!jugPDR- z4E@A!O5I@RmArv!iQijs_GQXfyrku9Uv=4K6ZX_QSD6K;er;=Z{nnCid*6Nt?PL}} zn2d>Ui{rFAx6z{8OE|ZjF^|BD0B+&T?7 zEKwp0#H3Foc56uq2ZnZ^JfFwFI~`urLWo-_c)8&J1PVD z9_EXki@NBz_s5A(HBEysor%VGtl+$2Tv{a@$uvYAgcr8aj>{Y&8Y8Mh$8T@!iXJon zWB0WR2EF!&?wP>qYk=q0t!<8Mf-wbjDQ#Ko)Oj*!NR_9ZxaFfo1J*_-R;ufG`jS?Xu)g& z5k8#b751FKpmT*kjU!uG+zIf15u+ohtU-Vo)i|0#7bMwK8n1@1iWpQYDIj`z%CG#* zgq_Wv(eN|d%&&gyDqrUQ?zD^J6|SC!YnH0c;$U3yW40F;nMK6br=U> z&EVBI!WXs#xX=vY-jtB2aVIm#L-4K}{3E)c9VU3?g2O%+ZuYVLTNak{&>Rr5l zB$IdKC0yz@X)7+~QIf_(kqkxq*3q5|qsFm=T@82*;B_lzN)VdHfomj`2HIsw9=P@W z8h<#O8+rSg8p&M#b1l3VzF^8N{2zedAK>%Cr+3EkdHdrVFNjcy7fCXYVJ5cmjl1CG zetf&|!?|!YfMsyMJ?vHQjF%es0+8VD%i4|fOGhTGl&H*K!fHPIjBcg(?zd71OGUcO zi9nzhc3OYloz@S--*6kx5vA+<@Gv|pDjY|_T_#Gadbhxg!#=aY`2ZVwwo}gD`k-ei)6k4g3*9D*EqiGS%h!GwbJ$L z#;>iciDPi_JL$NBY1j47kvO*wXMSX*^70pT9A!3)*e;bfjdOUmX%ZI$3E~pYhhmaK zTGxSpYwJpvRn02DIphTKwRGJ7I9pOAf9+FG0Y!4EMd8X(6!xM>;w%c2U{0@WNA!-v zZs*|tf~YDE65J!%N$j6IGG<%C&BzTpAK#15jsNTj+=7$sS|3?!tt~yBgWy0cnWr$Y zL&@-^E(Lrng_R;UEFD=^s%bnQYxlXTaf`XCfy?FLuM9tB?SM2g9&;%>(wvKXtN%<* zhF=H$rvdp-Q6PDwi-wL5pkH)kXPA*;&(d(7_cAEEXlMqbgy2Wkus}W)V1WBZG}O42 zS5{SH;1-;5AT*{5^uizg^-Bqj_fO&`FI>d{kN?3I4&IVSN=D(>D+UOoJPTlm@Je?s zy|fFmkCP>`CH&5+WRN#2PfDfWODPbR@_?~Oqs?=-$zA`}SDy+f-Z`4-R}7}NXV@u} zz7=MRI3LLMQ$|bWIt~=J+8Q4!2>}6mK}#2Za2+WRjAfXZ>$eV2$5(siGfx1hO9`l> zv%7|Y3J2oGAkPZKjX{o0v*Rdj-(KPDc9MA^MM_v{m?LYoDsk0YQET3Oh*cCq`a)O2 zv$fjD#h&f^FIu^`lU{a9zG-+ejyJ=wUTFe<%V1Toz@R;6Ep$4KLJ70Uo(gmwoOCIN9Ze zdc#nPZkNEEM2psk%7bhHB`**1UJXHaV8004g%j!f%KA0PipG(RP_AnfuN}vl#y`Ux zxiPceJE1@S<}E_xS&vT%UtRz>o{we!#^qfgd~yhqu&UGtgdY1)u5}JV~6le%s;*JhE`7bRrkUPcr^g%$AQT=FX;rQ z4@|%-Y4HM^U%=}OJ9;MW!j(^hSS&pW_sdicoG<1p1uoEt#xlf!N}1a8LG{yFbY#h7 z4U)mBIksGdum)PGPx%>Db1?Nh2lI@1W^peP`j?NkUqbrvDZWU#(pDb1bbHetoxOJC zO9)RBSK?xkgQ{Na*ukQs7p}Shx(aKw*EEf#Qc%{Etm53QG}IJgt{X^zrLBFdxXU2| zh~@z5UCsc-BHvIbiB`p)A9?%vh%WAHLA-qCD$i;yZ7@JiEUAPI{Z?)Z+Yb&37i zXcz@9E69Kl@=c>^!E4=k#yxN&FlGRP&B{KB?)l&G4}Vskhb!c+_Wa*Hgj&>{|6nNt zP)2Al$14oFYq*p3?gv z-rL&~`>siwO#&zKWd6TvX0v={Hg6e%E$(2$u38niCsfYe1?#)=B26t|HEZcKvUH8n z9>A&v;@7H%3JrFZ*LBkzY?wMRFY*~>n@8$Qin7k598!FK4|j0c=8+y9Ou!D~y$)p< zwQ^IIPPs$9xbR}8=%UjFquT-S3~%*V&?JrB0&?iPldroeDI z^$~?d+Tu_w!Y;(>Xr70NAauEOObv3w)Kuv2lpb^sNFbU^7a}_Myo1^{V;g2ekM^Zo zOHuM)9qZhY*9`%c>{cbI6lR_k#f~WgcAfu*tFVEl4K2fmQdF4|J_o#6xV9D%l~z_k zxvdc(;F_#R!DxWhv9s`uN^rr38s{rlvFgoNpFgXfythU2jpIn}6=+3S6oKHtD-L=h zXWZ>MO0RV|SElqTM660Vo~u=*q*1lwdf+_3_InjK1TFkNi~p|TXUnG>#dgCG_GzmS z_M=zQXCwNDUHPmuBEm_Qz}r{wPze0?gPgo z-7wjhq>pQ`q zH^O%fWXQ%CL=o_~4o5H=^B#Jn{}aoMo~sZH-d;*Pc3I;a^*+9e2L*LY$ms zmx$*MEj%6Ren3_Ib9yD6+>v$c4^VKbrmSpPNst#B+Rv48f7xd?Ug!|VH^rMBk!N6` zbWDEbR&p1YZqV_Ob+5#(I7!-TKL`tQvZGF+Uv$O#M8H#Sarq%dLYJjVVQHvFkJ*No zV7Uz6wZ^rd5m3VLWS@7w-D}C3X=TGt0VIDOOaHlNcIV*w{b9+Yw5?*y({#QlIHW z_QxaRKbBvGC@^SX zu*2ZM+MZ>lHMLt(ZxJX#bVMx}ey%HocE0iO3v!rv>DC;VTUk2l*g1YiA@6PYPcFUF zPfqeqU%Db|KKv0PYrdz&{MF-_?@iVeiv^K2Mb_mN7oBtZ1RRKEid_x4*OBn16dchK z&V$D*k8DH5bfu{p(=e#Q&f#wGG2ScQjKH~JWjfCLOxI!Vo*^W&!BS0-5pc+elR$L2 z#oM+?Vt!^sl^>*bP$4#CB@=K#Sx-|YNTarArfdEL9W zIf~)#UIPe{A&7$%TQLq6@s26jY3>!a&AlA;4K7>`YYP|6cN;23G)7b)DqKMgP+HVB zx}Z-(Xz;F1PHfr%jo9h?fWy0SuO?S4Z|XZoFxqCQ7b!uL=lQ(oxUM|jfhC|$LpXR2 z_7FlFi}>(sj5F*kpL1*`j~W(&Mq}* z`e(r9wS?KyyV?351+#DTFuSOS*+qoeP3g%nEQ1qanVyV-6M5Nh{B_AX5E9M$1;VL= zaG2BYL6~Q4M#7?)=Se<9;+NcI%S>Rd>e_W11`5MvjnGCojRu;EG^k?-{7fYA?|+X+ zIK6B(r6}sv!0B!HM7LcCvgZvgPH!5=X*bzJmq3yg;Hc+#g>gKT(JtXsI}C9ZAgZB% z7^W@LjuN0J2vEyBm*{F)S6+!|#Mfozp3PkA!^miV@ruB$uc6en?`{Epw+u{2V`76q`l*tL=M*vm>xEonJ02fG>E~|jPQz>h_L#q=Q+oBt0pM3|w zBiiGyZ*8CC*YFPAc*E%>|JKIU@*g80zRH<-{ zO5ZP~BZaSPRcYmUPN_?!902IDS{`Tt++pEF`9M^cdE}{G0!%)HQ_+N)Ls*mz^D_rBzdQ=XWE5G)FK+E-ogc zCW_Ky>E*pE=4tDAi`A-~%-cRjy38xvmA-0xrF-?0iQ<%;Z@h}E7$}^Dn{A}VHH`R; z%F8OQvHVhUDHuo_u9cL!G7J(dQ-|70W@6#&I(IeQ)3;FP&z=dnZV1P)S53BLt3k;^ zFO0JRc|tWDk}C&x4s|E=t>*~q=tmE3-FRH*9}_4P*p~6c8%CfD_wKG6CP5VCbG+iH=mNIR zR^5+)&Bx8uSZy^VL5M>QqT04ZlM4#px2T(X-{L8Ci6V*)c9^MT}7k`grXAG3sebwKZi2x1#ftT zz^ev}?z@n)!TN1W>Up3ylg z;Sk1gcg(Y8Q>`#Sh!b`p&aMU?%&jHY)_M#gg#*{bf*@@)JAROB?>F!`{`vOY-uJJk zRC$mb!LYuIsh{sYMe4n^$5|WGgu%Syl6F<7!#7H!f|kw6>_7CU$0?miqY zlnCK6a3$PVj`3WpJ<2}y@bVenj)$L)=QHgQXMkTb55E+ZI9J8CQ~PlI-yjht(|P0* zzXhLHKSmi&ZyfiD<2}|-6nbHfO5UAxz|v>P7oJj=475-n5&4&OP1BMtC--rDAHp@ZsRg$h;;U^$*^UW1pj9WmB;2(|a8M%&sMGT#^~K}v$Id^E;S7O z@>LVq-K3L6mK{U$B#t4GcWvBuvAc{lje+0HLGLSU^0Gcqc6Y7DpKSG|e>O&B|C~QH z+Ak(bh9mn$zJS4_S8wFbuHm9qOJ!*uRd zgkS$<%AZ~b+6bu|m{T16--7g7{4wUnHpq$r+MmGgz65X`n zKnJy=C;tkc&0eyyh_4>PCLN?F7c~5H0fucLzYyEPsSxHf7YK?@iB8zx_i!Co`!ib&(mIhY|-5)G-qz9 z9|_hFb<{BWA2242gI;1VKOV?SZYvMJsR8mCx*KPLU+=D3YslP10FXeu81-v~-~vyNn*YMz@fp)X3*if2sdH5VFg09X$GBawN|yLL-@R?z zW`lLP(PDS9M7~HC!8~82aaYEDdND2+o)P>3}+O6);Xda!IHXdM)s6N_=z z%A&Y;HP+_%HxUMI-8@=D8Z8Fr+TijeEhPyTgB7H#)GoFiZ@kKYx3Ekbt6gSPX-dD= z#&v06ZDXW@v3U1#rYgZrNzp~L<%%G=rcpWq%4xRZCbyJ)u0c-W5is!b)Ks0!_P)Y1mgA^(PClE%MC!6v%K19{kE#fbS$ z(T4dQcdu^YFMRJMP-ouP9_!Z+fs+k#lzCRfVK&Dr34435L+5tddtAA^f-8H`4ym394cz%NI21|W@=-DxMn8%*!`WH*i?FbaJB7z{;xg-$etQ)!+aXD zr*Aum&LI`@QCF(4yTVUz$_x(=Ub6+)u8gP{6htLFkQBraHa%Jf&+O`^X5`tH=a*_i|WDkj%s0)xEn?65ujvoEoC6 z;hxk?yUMAWhC{GLq=L&FAeWVO1iU5>jF=RZ??u_8#<%Q`OQody559vC|D*r+`4f{% z>GQR}xibW0c-V3FZ4Ku@I>BJjt8?3TO*{5s1*GqKB`m0x3@C$cfZJr`(SwGeKkay} z9&>*=O8TR^y*G|(!ud*;#*62j;a&}S9e48ibTL1 zKbZ9=8|pO4N~ig;KicM;hKq8d;bN0G%7QGM;}!PiJqJ6t2i52_4v4p!Vv@GAKd1um z?i_z3wgp$LaQ&~q>K)Lm-igx=Z`x3>r<&K7oGSoQ1w+iUd5R=BL zrg98d*3>|_Q9@LMDY)$7wxmY0%O(nd6j}Y-Z<0K8&y;oU6(?Ye3dWFw=~R8>-rGH0QkHmT%a8X+yC3nE`+9p4L)c z`1Kb|0PFZ_$ifGIr_;jk-yf{il!Zl*rulpUf}s;Xx@|GTr6U|;8dJeVg9^fVBV6fL zCFw#Mf2Dq-vi7Z39xiX(JBL1`ZH&P0ZMd~YG*CV*EavR5%qHa17QJM%sJ*ur8Sa{V zXuDyzS?sZzVDxQGVX{~I!V_M@Whwo})}Fn(|yb0&`jCR39 zJ?Dx`+wWWd%Cjb7L7MyCN2o3?gwn$7|6I7};IJ0*a7Q=POl~T!CG6 zAnCD+Dw$m+ILxQeaKLEdw(A+`xw882tcGPBPmVHOh`|2P&V_Syc47qBa7UF|_83U! zQCGCG=p5F78VgsrtZS~T${KR#YA~^WT`TVS;JUo#K(cYiOij%EWtzQ{hc{6 zV#{8;*AAgKQV5yFc}meqoOgY$cNLwLIK58IoQmTQAbX^$xL$X#`NX2Lbs+ea6`A!P zFY2;ft{j12I|n&Q16p~MgOQ2D?!r5Lb{X?Dqqk(ze|FgmpSA2*_cx|c z-#4sI$S1!<*Zb?*1>Q5hz`efXBu!%6cGQX@=vdFw`>fT%S_a|F2w|+DJah}mtU_e! zS*Q|J%jrRkYez|ApnOx+E21l<4?@(Qc(tw729>teF)aSadP3Isj{viM--pW?-${)7 zEM4>(Q1Q ztTaF$dPX&@p4WQA?>U6_A5Mzj{$ORS|F@UZL4IwEwm**co(DOEy^7}a>J`y-!Q7)b z5;cykg?lBi6-mf}XQ~ch?a77-vHnWEdtF4?PPdE-H*vgMz02|>&gSH-FTPE!S$0&D z5SP7DmX0FPSvRJ(Mk|N1siETu25((eYhPAp1XaJI+S+rZD6+luFKoBf9B#`L$AgL0 zhyfNERnA3OH^X{Y?;*`WXp}-p3x`sa2y}5=D_JRDxs_$qNJQELtwb8j727cL;m9hd zRiL7+tw6v^3D4PhrmU4)axOhj z3I8BY+1OpTp_@pVy16 zYIp^?SE!P?n>X>8*pKVTi8gwF>7)r~?_P}$AR2)q7EE(IF9t{bs^}6S1fygRv$8!Ib6D$YYib%$hvkv#7b_QN`doiDHP?o zJAB>L{Ku*PuDtVsZ>0axo=cQ3(hSNP z6|7|g+4mCkhzH!hdcJzAMMb00l(mvwMNlftsj3Lme;i;D%weK~X=P{1mBOA8ieF=ep&kvN{ z9F(1jL5bpTo{{j%+(}M8A^+AA=kVcTM@XCjJ zg({yro`KDA4bGG@($rK~Y&>97oe3i~u~+E26|*;D=|8QBAXv_lc+C(jT{%<{w;9z% z0aWJr*^$>pw;_&FilS0nd5#Z~zyWs&g99?k7nXSr90;%_QdV#wN&yp8dBQpTDwMGk z*4tapx#vOxaWQ!|=qG^GcRbV;mEAIgV%Fu0ETUl9XeSQlMG|+ZcDrVS+PYy-@VM(X z+$VnvjIiLgW)u=zPW|i~e!vZ`Ce8+Z#b0U}_1ix&1*a!h9V@={`fl#Vb>legIU95l z6e;yAPQn2@1pi+sN*kcMb?UasXg+3n{NON1HXJ=fomT0`AOct9-@VBeH0tbtDCY7hgOIcnW>>4|F5T4&_R)gZV({QM;_z>iK@_+AFMfILtv z=6EH&Z~t@*EOc$FU1B7m-}(qapgPv&p_Jlx;^+!_tsu34%1$)(#JT#n9O zF|zmpH9rc16n752vK?6{>wG#IN$HdpG7wGZZV*1%5_hlb_;BuO$1wsI4)s7iNcDcq zR&FTIlfUvDK=NODBQ^)6v!bsME&Ehv$vljcp`4JqMp#+;%!8+EJ*$~<0GPp<(YEH5 zsSd)=ohY3B`VY6Mz`r>u(fbXnDPmin-JHrddeyxYIo9c%`tH ze0U*1(zS;BMk8!Bqf7;>Dxn2z3wNZ)lnaFs!kQG8%i8+VD>eKXUZ34YlgIX}wcBvY z*hMS#`|?k1x3xPuoak2!=ZBE}T2Mdvuq(dUmFTA!)JO?}gTp1PXttOK2b$NLb+ee5 z=(lcdF}0fidM^QVh`~sLUVpK;ov{Nwo3i_o0n(zPp3JOq%gVYg7Y#SYV(pay+0QE= zV*Il_zx#o!+l2F9buXMa*pJ3~ez}(c{J;=6VK;ao$lGCx5k(MDmmOPl!Bl_%qINig z5wE!T5aevvRF=V|;oRjQ9j#-y!*J{%e!vShB}k0DPv4o2SlbQbV6j*fmVNj5k!2gZ zXFoY5b)R~>J_7h&`u&}I{Je1_cN@2&&6~)>bdH~C*VC<|Z||pUQV)TH5RKMQ5F7^a z)=pjcaGK4Av-pUeI7wUPvhJeGMi#v@5jLT-l@>XbDok;eVh zkPeV1NGxGSGTT(R$*R)zweQ$QDjX(bq%SKtPLw6;C|5#XWRUPliS}&iN*^5mxh-)X z)k@OMw%@Z?GS#t9ZRfKO>$gcbSlOEadK@}>b!z2q{Z?T!(oi8O%i6D@*in07VGNuH zEvro&^)(P$Y$ztZW97F8kJ8qBMGMe-h5(92YJc;P^zEXXf)+--%4cj%Fsx-&LHRIR za?du7sU4|&qNEk#HyV^{y;?SKyAaGfp5sVPwV738O?9qX3Lo2VUv5}(eZ>m)pScw7 z*VV5d?eIDRd$NeKJeuQ`C*3IV)7!naLICv+hQcJv23{`R2(?na;ZmMqR>7(Z;x{L> zd|d~g=dZlei{Pf7SSB`Y{qckc&~)%z(1Yg!+CC@3K=1DAyvuGm{uF#wOx3)s zwDN^erY?=bRum9dcmp!S^(amP!?i|+;Q?WnZ&*I`pJz*(_Gc5y!+cGP-E-E%u06B} zC>J=icy$R1aj#VldAM}VmJ$F~8oGHkNrD>lZa1WHetWib?B4y_EgZdNe?M<%$;qH& zR|FYiNc`-YLF_6J164s|AEm|~safgEGh6P4ZJMc32u=O?-RBd#y^IC#8Cq`IRcdF; zh8IB=gOmyKC>+X@N2siI>AG&IwdZK?`XKhH-32@<9|uHHG9_yo-#@gxo{4$#A6&M# zcyv;R^0Ac+civACZm(!@d)fZDtyF;|NfW9cgq*ZPF?6oghe<&492a~zl(t%%QfcJ~ z={l9?dK#h|_oWr`;C%ZrmLc9yKA@dNl*^C09m{aVe>Q%!)U0wNjVB)4TC1xxc)E(L-Zrkyu(BKw}bSDpFS1Vq}Z4_r7Hy-nxD~;1wpMla8TxjO9(UC$^ zn7T3kEj!u2tN+ti+F_7CH>u#OS>^>#pT z5%rMNj?YWuR1z>jQ$RH9nTnOA0Y6YXaQ6^zFv?y9594~2qGVW&Km>GWEuH3U&Q~9L z#sc5|##|>@xeBQNWdQvn=XZww=Akbk>-8^bHzq`ebPh5o7^u7eSq%OFDvmPRQUwMW zW3654kfnTOaW``99RLwC38Q}H#orcfM%U}}V-q&&cLJ27z~RzMy2E?p2u9l@AQo-; zSWJ3EoOH%%(OrhO6Hi5bD6Ary)bi4W&;<+5Dy|?=P#Z*E9gM3mMppH%yFYQFb)@c{ zlzaa>Soy7#>eX`-t{y@r@2U;LHeE1{Xb?=V183app^eR}4Q$$1p!t<>5-Q*Nygwad zHon+FlNAOhqMqaU+CO&@t@p2j*_bB2d@t7Yi!|17wcgk7yI!iWjFmMyb@*bjY{?slb4eF?Y+|H$NxrQog zp-~8fEhwyOYfp3NeC2_b6ihVI-~R(`@xU(~y?SEWEp4c$eUv62ylphuZH3XE8!F0@ zMNV+_vblGqyD@7uMZ`4y5)vu6BI@P8cB=ctbhmXj$~{;$b?E&k&+H1F9~uFnOW#i0 zl&3{PM`HiJ`DUGyr4UTL$q!hbY#mSUZ%#=e8=9<_FY`A zk_@J)bSfdO>w;C$5ZirObGMept+Z|M4-79Q*OK8rJckhWx!hChcngAbE$UD3@4H@k zuhmbn3$3e8xZ1_fwA=)k9(dAxvFk8Xw4ksxJ)19ojEZk zzUyO02&CI4F)v@IJ_S^?c~Q5`uA2Z-To6c?2KS7ff=A-F1l7(W}gWuMb`78(OaWR)t<)`1p1k zkJ;8C0a;Tz3YS*N+Gz)0SBe}WM8uA8YF|TNsS(XVUGd!JFo6V!9gr9IfV{X(L7@zS zUlI+5QLhGn>68Qr&5dgfJ6Y){#l&E`Ys?wz98=BMXLoPr|7tJn9em#Ib) zZsRk{EsgPKnt8%<9N;x4TaVq08)^hk$CBTR&vozXk~E985D4=&A1V&O!bNd6V0~AK zu8`3C>&7b^E-KD7j240!!Dvryu0c&K(On0T<15qEC`yTVUu(MV9YJKso-cCvNAn!V zt{WY>OQ&lM7jGO%-9e=46_OfsJC3T2=UC6ffjm?$YNAf};x#kONqV^RqjawB z9F=3zaIlRGRXXQ6Ne_8Pf$tuZC_EYrLGA0MhIJ}kzib-Ha?*}uXFQ#5jMd$6wAb~k zqL1JHX(}ChWqaiA8UiQU)94VJ5W(0$Cy$b(*JEc_tIA69Qc*@Z?6?o@MJi2hsbytD z9V*MFWKtNY=IU?~4kxy%T&IwuS@BSR|0C42_mNRm>ooLs&Hl=ZG{N!Ai$#_UsalY( zbZvEIKyKF3qq0j`)upQ;pi2cJ&-cJjc>)(Dp!K=e(6ARJrN2yY^3U}QrDJQTS}$I+ z5t{+fpXiN*{qB)3AzTH~`Lgu|5%p1;bi1~L{U~LMS!$|kMdkXA_AAFH-G(NFxi058 z?Vih7Bm6^1k{#QxJ*a-~7urg}W0S^yQ>7rWFu(P*j&Qhh2&=dwmxFXUV<`>h)Tv+x ztIqrd6i$ILglj<}hA%2(K|T1M!?jTwJaY|w&~LPb8h9A@#~55a<9NvzT9V=_`Mild z^ZnHE=e$k=TI>r~9A|Cs=mHcLPWg_IpLW6L{WJ{UQudsyh+q9Ghxm-!m4s8~4F>14 zeGnLy?vpa=U7w%*Qd?R6wSPP%&E?8f8vieRmAwAjM>~zC@o={(u%iWN(J0G$xece+ zPFjOtT+{GO)|9v!5Kc;ME#r*CAAtjM7HcQhF+smYf-ye7d|_vTt{#DCTQp9WBb0&= zJYJ9vNu#yzgUoTtM&R=FBwe3Zo%ve(Er;I!m)f;Xn-@ig;v%xS?*3Ip-C|)jf|l8h z5S*m=^FUP*vkEe};#?Sf<<@9;<;=&y;O-$;75&|1J=w#P(gaAM`?*!Sy=Y|_k|7Y1 zUS(d^&aFu2U3%@VicP4NzHdO$xlERh<5SB|klRjkn4=jUT(146PF*u$?fEJb_1Vwt zHo&V!)*hagiMoLDG+*?xZHsRGkJE+AeH?!uLau-(?Ls5xm8A|{hShbW5UVnWl|HW( zbM>KhY~BaEBHAz;_0rV{p+9?1*Q4Sk`(w8nArwWFogGD4lng{5f;kFWE|v8_j%&Cz z@CnP>g$3odKI6*#i4n+J6M;SeNd6v{onF*U^83gTB)#<0Fj+Q$3kZ>}ZCTjsSaH?G zK!le@!0FI%k8Q~mtEFY0@>o?%xAr~7q3kxUam&i#u5|E^d}{7Y6G;u3pSt#FDDgRN zX1Lcg=1un-X*|noUBr8SaEgma;qn_Pj(O_-1=+o?1LnQ$AwhRMZu%V;aaTdM3s2gI zfDC@m@ye1lF7=6&%B#562>pbp&T<#If4Gk6dktwf0N{yByS@6Z{lST|Rdq#D%#(1@ zYm3k;9wyBl{!VRZy9#D}1jCLiO2@5mc1r=R-K(9(f?T%ThqA|sajzT4(g=uS=j0g` z-+OfZ&n)L&U7@CU-86BKNUz`c{QeUM(~+izN!B`6cy-d?u8D&cvGJNUwl+#B7ymiX ziG%C-kpB&$7=GpD{Qv+TiwFb&00000{{{d;LjnMkJng*;v?WJ*9=b=ny6i5=rO7%M>-6XpAR?{m7(*6BXI_v|zB%1UeY>6tTP zq54kM|M&e@sU z?mhD|rSG}(WwUVBJkfRG4M~#cVK}ANJUR2mZ+-K(zx_LI$dWT}df@f+uS_NvOeV@I zuDQ$oO4^cJ*SFUHW64~06HfTqra&r3A{r-8A$>}@pzX7j1PTYIT{oiutmb>0||C_=ysyw}X&OG?m z2i_1p5Ka6gK)3w*#gpS#e@6q5ULT+|jPtCR;#I`iESU5Xc1yFliayY?2DIa6X3=~WW`tFg&S%p!%A#GQ()lh@?>~PsDP3RH zM&X2ch709-MtQz=eH=pP=CeQsNbJ9R(s>KS`EPv|0r8Gt0ElOdsoFi8p^Q6yP9Ez)!sha%d=;nNpRCcei!CJc8KHi?$Z^Hr&} zs+`)j+H#K@CW1g1*@4B=b2=pAw3*GN|5HR*vKG%4foA zZ5}#c@sq*79kAbVcswdP=zRb6gib!@h~-Og?)d&A0OusxrOBxQaKin;31@LSn@{Og z%yz)ZTL*VDc9}JbOT!!nHwT-f1uJFEf>M=M>8kcU6pTNHD^E7V?tb8Q zJ@7GCO(yf@q5MmI*v)qiWth+AGeDNdQ98|&WWEDe7{$AIee&YTgbV9(w_>$%7^|2o z0x6iS5F%7T#qi4uN?zid(k+cwRXDWVaZDf?57g0PPuw#Ab=ZwF9{t6q6W0I#(W^(C z;{OgXe-xkJd|GP(X9t2E&69|HL7dN$X`H9w4%kWSGbcE>%&7t$C>L8$^4bKB^|*Ed zxy7X?oyg(eJk;3!^hd_n{-PIk-*t!C zE(i|+1O!%GF{S_loPg%s=hAwC7Jg73!d^(T77$tk0HN1`$L>GlU%Ct+yx}EB5Eb0k zn5^dw;1Mo%LOv^s=GdiKGR@;`w!0VNb}zgZ=e}mbtzB12E3~zmi`qTwwZ@$v{^!}% zwAS0tjB#EsBFBXVU3~+EK#Ohv>b}M1?Y0l2kj!$D=lL{DihS277p;-`92sSo!?p-p zGv-?BxUMj^)K@wzuw;Fh@9>J1LRel`+^%O;Cdbx$hBB1&RMLr^UjCxy{JiS2%SJ%> z2Y~1Y@%cS`k|l)SbTEX7m&i;aAK0z%i#cy6?!Tr`E zY*+h~{1~nF!rLz$vDysF`%C!zi!YM3xMkR(=lePIkgP>EixE6$GekQ*?p*tIEnFpn z(t5sIS%!^-_|PpYCZ%$`k{cg+EE3pbhwvPNJHG*_eHW!^AKwXuCX-k8Ay@2YXT#>q z&GI6Qrt~VZUF_0b>~5!k+j^d=m0}L%AI1+9v&L4g@M|Tw@9RLQpwz~=R~*+vq#^9!q;|fQa3V&skTW+4joehG;X4&qSfzXridD{g$5zf)cvWkUUf0c$xP+5d^XL)ba&PBomGdEPXfo2fm69sGs!FkHqCbKTv1qLQ@o;V*LKfam;WHqYl?Btt$c2MU3!jz9S4Qv;U6mj9Xz79 zEu%ef-sa(EM&{ZjU;DPZkHAbXg6CVu0JWEg%;!afC_2Xzg`|#^*Zl&gusoC!76%uUH<48~@%VSnwN~1*`QJ zoMyDtDPB?7Dm+=c;6~vQ2>Xonl&84^YTh`Na6RUO0#lv|w!o|o0F-5$0dyS@c{4tr z|5_`7-MSt?G0_j{Jj>H5Uh^#Mu^Gx0T8o+o72yOPT7#69exN}Qno{~DtgSTLrM3>i zW_%ThT!PP^b`s9G53y)B;f&)3s3;AmaZ665t@oLoPYGwmDp@kOl#VQYD+0h(Ti+ht z?%LCifBCIH{03V4O+S2OM5yw#r6>M@kC7+-=0UbE3$2NRM@>T1&T!P@2$*P>cvmK81TbO7!!i@pIg0Gqut(SeA zNs*qeynq->?K&qJGRL~|YvveZK^xlxmOCQw9n>9U*X(}w`eza-$DT7Au}{7}S!jEA zett*WJ34qs!oAvF0vd0cCdn-8IVj-4>p&|bKkfyeN9 z|C8Iq$3GZ=Jd7JFQDosX>M#s(yD@IYu7p>i_zF(OcOh&#nxEx51AVcM%b_z6`q zr__pjzF>YWe76RJ8w9`s5~d718R$~Gh)3N(1cyVfjC}@$l1@VXmiKbP`|qB)W(3~< z4S2pBc>jsl?yKuZ;GJZIcU~m<6wFmiBeX91OW0RrQ)I;r$BFWoWvs4UeCy`zt-Q)ic4Y26%#7F>Ona?@I#fpEsND48{?1w<|?;6T)!?uJw?^ZrSM zRJFh{b!}Bjf#i&r#t6nJApy?y*<@uy;Z|`nLXIsBFCm&Lrd$a>SxPB!YK3%Q z_`s}khu22bEKt=GS)j4=4DG|X<5}KucjJb?@Z#rd0G9WXps$&~JL&h@S3=~>5QGCC9vL(5% z8w1K-iZ4u|-X>FeWxExUNt>5GjQ zr_SbRuY64q>|{+*oHgR>EQRDx8tmg#>#$L+oyw5MU=RzvcmS40MHc|w6%G?>RZx=9`ht`LXQ-i zrgM%~1UJDe4r^pxYmr%T!vb46oO1)A#Ij0Q&)JrJA1S!K=ogwmOrzwlOfkJ$1lVJe+X-Os?#2tR}ZXr=g`E9QdcZ*n#@}vZl&na zLqe!HVjVai!4dVq>^jo*xOv2_YX)x6b9h->B}%E>jSkUh3S+<|r_qUI*5das7w7C_ zvtuJ0Mks{*SV$Y@)q`b#S+*}3w%9PUI4`DnC2hsXN+F=nJ?&e`xh{RL7R=#3s~pQs zWi3O-V@pc2L1WlshwzLn1Y9Q^`URQSsI9GOGmD3*1Svp{7HAI4JngtpGN5eL2$CN0q+-y>YjCcfS|67U zW5;xMyc;{NbJp%yRu_Ee@3hTX_l-eqZ|V^x;Vhx%tT1dFYKo#ge8_YI=|Ub7_7T_c zN@#2{&KYwnw=@A~*nO@6mtcXT^}r*r`k{5;+3*>v7tCZgTv*3_Qpr2f`?vifp?bQp z{#Om4+QU#s$vmE?Q@lDlYuv_J6a2RzpHbijJWpt@5QiST;QnA?!`1H8v^j6s36737 z)ZZGbZG0USM}||p!cOsDo4$UUdXNQZW9%Ud>QgCL?^+;{L$vMllKE9&K}y-PNbc9d zYrbKwOK0vpd@8S1WZ&3_SH2ruCD18IA%qwUg)j+QMya(6p1BMWIZLGdlZ+xhdj?SwSkss@OzB_)e~Fmza6q&(T2y2`b-|g=g0nP+of}Q7@yT+ z)^L?gl`v4HEn(XYWiMR#%JBn)udrHG?HE5Wj!{G=*h4sL2SS+V zo1M59ESm{Favuc;cQuCUt^ovlnhByP0_{1aSFyX<^449xw&`;M$7vjxeurw~HL<=B z{1sFh-{(pjUzAFhx~$Z(LwSba+pzs~$Iid~t8Ihb9c#h2u=8=ALBNiSB56^?Ri$gibSRZh*^vziMtWaB&J%#YmIWZBLuE*fFO zC;)pG)=R^4(q#blrU5K=Y9Hr~>59PMC9_WW)uuV0L-+;#6RbF#9(Ip0){21psxE`d zy0x`#MH(OWk8xnTIIA7cbB$u>wh(SG0P86J&;MslLFJk6JAVYK)B{AtZ(r*aRGvH# z)i}=MS>rjgd`eYtyMD8U^-EOp1=)c!X+S7zBLgdprTEn_98V2(-&6rujB?wo#gGf_ z0QJlxM+vB#r(;N-7cOUh{I`EjF7);WsJn-O+IQwhn9t{=+~j%Iy3n><@Ii8+hBLDE zwecBZRpwe(vPv?>$^ZhrQ^CC=7eMxOXnfC*Et_v{%g6=%*#&K=pRNVq!UbfY45#>- zwG}rlQGGiFuUaz$B031X62J33*FjK%O(>6U8;dmF42vTaNf6alv;zvVJ}knv&L)c% zbvD^Ngp5A#sOT-b{8}1Hp(VI^&86!|!>E;0yU4hu>&jyrJwq6D2;-N3xT$%${Uc*e z)KjtQmtvvylUmdBq5%+gnpo2;YG{_2NS0!kxXRjH@Fm&>ys8Aw4@`Pl*#OB)iL6G0 zK{cwb#o3zfArIHt6i;4f3IX-fUw}pbKgU{c|LQ(KqE7Wyb1>$4T1@9fJFR6!zwssF zq9AZJ$YkpXr4dr%#la}ok}1d5UgMF0-QY_!Cy)I22rlotP;(ayg;= zQ_*=NW2QSNlgV2yZ4KI)5imzl(e#xgP>SYlKS7bU79JbZm0E$2vP6dham55fkZvqv z0V1dxdlSCTa&mr-I=foivqZ4yw59y!|G0nv{3oN7#T1BL0g#Tc7QoX70~pVnb|-kq zWD064d>mC1HdKwTtW(>Pa|a=kQLeUvx(i&NvmijY^yNTG_=XaJ=vlK{8w^;@64@Pm z_BR*K;BSs{23IcYhu$Yz;9lMbTw7eVtRI3Wji!0l5j5JJM*}htnq!j%u!US$AzUBK zvTN$9_9}zWvxG$LY<0g4B{b=VMMckD3P6wkH4=c%4A!45A=*~}%A$md9kM7*i=JY% zI?!+vFoF`nK0Z2QsfBUpr}AQBMs3wG*et4L(q$ zr%{LN+gk>rAmG!8LZ4Np^lRx0ht-JMT`gQ!_!ZoRK)&p2cI*(Ik!2vCeW0=VpB&Yq zdeySe=QST{wQ1dlR@&Rj9K~tYuvckk_QT4|URAqQseF$MC9t!Q-DnpfK9`F7Ud^<- zz1hYG&oy30zyBSoks-7G>^Af91~A$QRe?s60jD_<;G!MHw|7K@Z!9QKS3<7g*7|OF zR%`6`D!=~fhFSV;_u>&7;pzCvzlAayZ>OcL;s zt#(;a@RYVSQadUYQktX~&>+4i!HXmL^Up5(9jV~0b0ThAPKAA`*9PSG_aT!#ZYu12 zo=@|~3o%_cziPpR0NdM4kE^r=F^Rvch%f+6z$(SCcdB#MuyFvf z+i~w}jeflv5dIucd)I$$$AF(a5YecB8*eJ8;~50?5Ik=WwaZ0i;HHdp99~MO#1%+N zp_K5dKzhiLUC*^5c!H?i%dcr%*1O(*-3X}YSpGcV_~T1jbNu1~sCJZvB+45}ub7da z+D%ik7O2~)`o*=C7NEIFJYbw8JWm=~mx!x1bF|*lz`dbU*+J%KFKbBebtGBjQ9 zw`dCJ-7Tkb?SaU^QO%lTna`3L&AVzhQPR392-g$q;j|gS9Z}Xox<04{%j}j`opd}` z?p!^dn4}>S{~n)@bOOHT9=z&!zF=qJox^q%Ks;}E1I@{mo`j`grCW*`J}MYFGk?fK zcL@2B`cS=c=)|{}~)L(K%B;w?O^p zMxlN_P^a-wzwtgY%!|p?^FGwu$+~fpEYht!N~icb-%YmC*4I4<&tGvWAa{gs1;Y-j zOIeA^)}Wj=?)VuBg*yJ}cCRT(8P{r@FR!Uc|3TY%eb2!#EJxXdAf=*=8lYxv!@|nU zQ|r^f1UFC)Qcdf*9^xO*fbsUQ*JK?)2JmTQ7E`r+!e^eYH3cVJ#*u&fAGPD6P7Y(Y zUmOX#qbYo%KD?;M%_~$K)g`0Mdh@X8^+F(x*FQ_owBO6=3IOu5O^&< zf43t&-!=fqZsb!er001tjXF02t#q0&h^VfxWrgivwNqDC)=0$zBTLd-wW~a6L0hgs z8?u-kn(8xu)PyRJ{Mwk}AaChs_`L0hJ3b84zJ4YN5hhOY>f9x=Yd^!rei~WT2oZhH zfD^XwQ`SS8y^st8>*JLsvHbljVc*AZSn*RD7Kpvc*rc+4Gk~vC3$5W*=uqUqP1O{TfVolY)WC%iN^0pH= zhkDD_u)??DAl)z0(-YyZUY6Ws>od)9G8R0jMcYO=kU9MP?Vw?*Vp8}t_l`XiW(BnI<6??kJ4 zJGq{&h=BA~)fU@<@t~@>U;5T7eOXmVfK17m4eIJ77^~WBFS%Tq0MLbf=KlD1@eRn089V5J{`kMJuvC!x8ksmVwp z_~+VkWJ>Nf6Qq%9<_|48K%Rfin3Ra_HhK^+{NyDqL@zlIB6#$9Q)&=}@aR$AjxKED zyVn9DxbZ+*WspL8R=M1-q18doiqtd=O(**Mqt7>9eB3OJa#?tJ!#B3G zrCv7-&3=WK#S9n~VcR29v>DLRi|7U@kH%0#634D_Y6ntG<-mory4FSqf`bS`79bRJ zyh^BZFgI?ETlvFHjnMBtqH zj$7K&JCr#Tqu}etR@H}_z4X1K4Bzhqo=@X*^hnF&2Yv9xor=)3@d@)7)L46mS-X)Q zqC3n$-)p0w;V?K$Bek&37S`GwUGn~KXfoPQ{eKsXSnH8xd%_3K>`Wu;A7H#(>%Q#? zX`05xlwK{dzcS6(1{``84WjV4>oV;rpQ?xtX`1mm*7>^S{Fc9eL3^Ritz$sgJHI8$ z;y9rTZQ`WEi|)O3L4p-!vVt#zL59+9bQP$IqRm=59tEGJ*7gaxsbw8|n=CW@Yd_Ie z>%5{5v80zt22n)!RNysl+cNUDBH<{_F>z_Il=8hmE1|Ti5ogvkC9$@pE@_^Lqe{?) z+o$4(DEJNQ6<)K%?WcbQ6#25B@l6A`^)Mr8n8kBs!1E;S>rC^x>oZny0ZxfpjfL_d zp1Im{OXf+RYmFS)@qJHut}kUXBG6^$wv2deXWBXlU$8vO_xyOHgvI}kFeT4*j&nP+tCaoBh3G3CU}aiuA>wahCSGUw7-e~T;c-g^88Q4l_>^MEw!0_qi9hyWo~SEVAxZAbI5&_3PUR8NB$e{rG6+1RAR>ScUj-U}LF0Y{?~tY%^gV-} zFP(7w1HayIF3%X%xFMDl`FH<2C?{9FcJTV5JnN;%<2(jMFr`;VdER@Qkq3np0Vs_V ztb9*YwGI@u75Vt(C~LQ%Gc^$1dEfuo@+E0I_fP)G5ANO~cjS;j;xrx4N0eFWnk(0X zV5|KKq=`0M*6wz0kpn<2NauAxI*&+^6RAu$jMAI31%UC}&p3DtMBcf^KZ_fkWd`{+ z?TmO^;Y5rVfRL*YSK7eiz7l~6d@UdG%D}7FZ2Z~FFfBQvBm0R6*==FRuwVMO8>{u& zUp;?h`3p5a{@SnXG(Yy2zvTPh?cX#%hV!sMt{cufer~1w#c~CM4l0vd*d|DnAmbz# zR$DM`2$iHYHmK~jxy+H}FY8`4O`(DQ`$Q1j*;u601EBSU1|g!O6q*zAyrgdg5Z&)k z8g97*p3UXlW3EL4Q!0=ojHcK)Gs*gXqoShfydw zbXGfPh0ktk`v39Y7&FS5s{N?q>$f@+^7>+nB3!Nb3X2Shb6Ct<(R3xC5S&{daym`Q zE3I~Ti7dc@rU3lF)bK6P&u&&Z~2Ei31a`H6-EEe%*i~=!)Y>)qTL#( zl`AWx1I4t)HnPlM^C;n0AXeno5J)y0M7GoQdijef=KKo{052W`z{<_VNi()NO`=)y z_{NX0Y5Y*G1MA~fj~XZ}3LJqzL{%dzM8XV?u2he&-`Pl@8=QuFD&25CER9qAFu?fC zk@F@uG|nUZIVyFKC%9Kw`d?f9`34nYN`3Zx?)q|1_74Hn8>5JS}@yvb@j>-c3H7}eERB~eit2}T|&4wH(auM(C(fVv0*DZgz0_$*YN$>JmX35qm75zCIVSZg}o zB}*#jU00Bf_{s*AWEhow>tbd}i0l$C{MvOJZL#^yL_ND)yI^vBkF*LLaI0A5A?Dv` zoa~U(h&FFDxf!4Dy{u(xj`v{^x1nd)ur(QeH_c}4#E6wf6BATE_gthkMqs;CMmkI* z40V}PGbu~94K8A2qsdpNO+-F!9>D9DmjCK^kYxI@#_&8i085`XF^dwq;y!Mtjf7!m zx<2fFSwRm)`pg5m#K?eZX3VqLE`sPS=_$vDt1Y>PMZzB+;o5?IHiyhRKi)SC82BQQ z;f7@4<-nM(lYHxWt$})3AI?elhFF3(i{{gLdvpE@MIk&UR9P8l99A1wLk5!`m4gHx z5}yDtvT}=sLL(`P^MB~s=2%j^ISf$XjlEjsCHGlaG0dD^DjL3!r?u5 zHDmR{D2MnS=UE?%gD}7#Jv7uP#;l><# z&c_#UetZ<1)KUNA_#EquM4R@(nRW+VG?htd5t5$YmS%PC^~ZTv5btZ?=z*yAJlDFs z1Qm94Tgy&19Y*n0tmZmR1T9SqV8s$dABR2 zXrf}^>7Zpffp*LyIiT5<^m*lP_tcCmMf;79TuC^6W>l_CKv012tq)W6 z-m8YWss4(eI4nT2Px0!WlfCQ|w0W-K@yWU%sV;>Mm{|8Zm67b!I==e_%elax`mysS z*^z}v^UVVggnQ-!r*Sd|CDm!B+Iy3jQ9)gL#uK8%PJ!8#V4-S`g3kpUG0fCiOXL}>V$Ts1%*guMUeqpCWZ>hQ5IsnLS2~n~b zuaHdRV%B4|xhYFk`X+D!tvqfjBqs=Td?VqvC0HqLwJe{I0^+seX|c@wMgG*u@n^of z!RY2bjP}=+DecX(3>*m!-R#`bkR`kH2o1(|+!A8Tqt<%5w6%|eM-!)z5KOph_R8#44NFXulpf(Eh5y{7NzrSRTry0AF zqNAYP0GB;jN&=__>B0_37gCwasW?9s$?QaUs#`p@4#P&*_EK&2nSa<;Dv0&KYMNu` zc{GOvG0)?cOIo?MS8487knL0nu~_@%)~@YcXLHbS3c8%>`e(NNdA)H@-g`Mynvozi zkNRRBO*LX1XT|l2mGx?&sLo)$tuQj?Sw|6|d(ep+dL2B(3lE~p_FaBcjEF-qE#jz$ zHFJ#6q^Fc63-`3VLB5@?$nFLc?F^fk9g0m|RgQK4ea$xx$I(n^Cg1Vuo zO6(b(d~@ChTW8=&9yfKZbgNAiw!J?q6Shh>K#qlj{jb`}x9|Yep=5wwyBXcfNC{_Ty;pl!2n?3{_~R48*fA%0MtjVN3G0KYyAs zz&++MqZO4k1f2Oa6RYA{TDKNPF&gM^DrSs6q?z+WG+$@4tTkdFS&j($mJjbtr5lh1 zi%!o(Ga?9tXq?jhT2ZeW$c1lp%>+$dmA)^1TSEWy{jvft$~cHUw}LoZYEvFNq-UfW zxYi`0w@~Oy&Ku^XSQ_ZRd@ycdyvUgn5TxLfqjoM%7`5@-ry*uY?)Xk!Qh$NOS54#B zSY>#ru={B0YNbk$@eEm1Y4Ckx^-0ER$GWAy^3ZNrTzMw@eP=*x1b+&B<3z{2zxr}9 zzPRg(WjOuuCtrjJ@pXgM^+nNNI9?#}kEZl$&D=_zmzA~eBfn4LT}KhOgZ0O?E&nJ>0wN|AHY8ND8cEgAA98cu)& zjFnz#9Ru?(YU2iQh5@(uW94c~a~`B?nXc*psz6o0n#Knrx{x|h=WeL-;u&o2=p=LR zUCbJJ@2J~msU?qE@P6g|*0J7oFuL(9YkKmE`D{vLNl!=?P;G=XbX!*iLZEh-kF(8H z8Q^#aIN?H<6|c3&59LmP(f94V=@V;+zxOP~-|7QTp1k<6cQ%lH#{rP-NAAwkJi(F0 zE1h*(W?K>Np=NJ3Gi$IZ6=+@n=0FdY8hnfPW$h_f1{@Jw>3hCk2Of5=zs0)h;b%}( zN;XR%|8#kA{Ug8rq=~-z!3Nx`d%@kmsIe(MNYZdtOzG7&i^QF)jfgpSVD~^OAo#Jh z3z0#N4sw=VL|^YqpNq|G-DF8XeJ8tMq8Cm7M-FZE+!LCnc-OwCtnVm)jn!l2?ds3( ztp0rB-%f<{Q~8Nx^Ik_9_RhXSQOGTWntwQp9yjehj?&o_+)@%GtN>Rzm)&VqG zQQ<2`h+A`)F@?;B(+sI&TYE+d|7%To_m@G#dw!Hg_uM@=A!-Ms{q_l6sGB5ouWlN) zaP6HJWqjrPfpLZQJnb_HSLju>GLqHOr>QDtOJI$h7q!lLq8^TK!RMFHYrWfpy*Rb? zOL@}74$y3;d8a0Gr8dVvkgiHkYit=n0fS8AzJ1Or>2fe}V5B7C21E@$4gHf8<@(G! zgzK7zpTWSP6StoHV3RD|KS~C_3s@4{_q7XJHs{Sl(C%gnO$$*N%`+;dXdT~5zb#`` z0Liyzwqg~Su9{bl=Wtdc5OXXmD)#e`A^Sp3$v1-MgA8y5myiu1OP7`BGgUb?m#lI@7zB=c=+JbX&53&( zul(bq8s%yHI1SGEm(Ob_5Qrgc+H2h@A1I1=Z(rMrz{9~QIS}b7OmWLGrBEXUp6~k? zP1n^!qZavR%lR$0A8i*IAG}EDR!!AcLQ`ClC~Ajsw7K|^ORk`e zn!q!g7@#30x|1;fzz3W4-!n=h{>oC)`9kOF{;+rb9U(o=oAu{0b$awn?@<9=A|k0B zv}B_4r6LJki-)$k^zQVY?_XywDIIodxO?wUp9eF#5Hs@wmcC!d9ku}7GlW;%&WcL2 zU8?XQs)OThP`R+1CvoZ>kTU^e)|0%hy!|GTOvYi--&|J6c*8Ed=Kztvh|e9^1!}n= z)Ox5a%S)+V8DEROK27LX#;-t6>7a6C%86ym@yg$eHobn|{_hawf*>wHoU*T-t%hBa@Eg>Qnyt1UH6pSiV40EyVkR$t$ z&T7YJ+C>~=w6SM-C`Xopt+R{f%ek~4M0Q*(FG9O#2%EiwY4drJW^@x;(sx;rFC5rw z96v|Fm3vf;;(N6xJZhFRrN`>P_nW!XrGI#}g@kf3)$#O$VU2Z#7hw6*!di+UHP)&7tHF6Rm=#Um+p0zH+ZrR5SzO5metO zdT$`47ziZdR7Pjn&3f-|g4FX*4^G9{3(pFvha@$Nr+DRUc(pPkLxGW^mVSr{L{l;C zN#npp3MFd^H5>dM{+5^3VVut;dH%J&(;07O^Iy6QG(L6tQ?R}MVpEuSSom=U52$O` zcO7Kk<;8T~I*7ClWGT2WYu7H`w@c{-Ip2b0FWc zXmEPVs0JsxclOQrT=U$Ev7^4V0iiqqgw-9@TyhNYIm@Sb#c_MDeAHrsc&nL!8z>K_ zP!ki!K&{hVC$@y!#BqfFx3w!_h61h)M{L}E~^K5a)?U^z3?y==ylfQ+iUoFQ#96tcNeJ7iMI)@$~7VV&} zmD1bFF_o(vql|!ZC?V$f3i^&iZ)6n1XSix++B zuwHT4b_%aBlOA{~I(n6{Qn*TOjhTGiI+yh4%bf4u+(qK~z0D%;JYbRgj?B*!=%G`* zl62nV|4m8p5|h5;D^nuPa~$b8Q2J!8OBqPtD&_jN_MX5QV=r8DeCb~SKHqhk%+JdP zyMr3+b`zVT37Mh{MjNbd%j>Q-b_$xu%}iiRPPaxoT9g8h%Y;{J#ZASvVcSJ(WQ)*U zi=kuVsv~rk_fKq{#lI67`HmG7Ic#WXCls73EbitTL!QW#>baz!1ui$4CXg37|heX7$?0Y zK6#!O^JI#zv)0h86tu%2)5SNkhFEQ^1>6QA9F%J5xTUdLmzq0%?dqyN+#$Dj-uGu) z9&vTcGB0`bH|V(D-c-~b7K{oo!u7+!IiAO`J4+-dwRDi<`aWX02gVDUA&Mu`6Zxrhc6>u#Afm!oVD=Lo`Sittb&;b8D66V5&T)cBOKqrbrv1msW?x9FM%kmeOBR)4zw>M{^2Se!2R_oF zl5QEXcu+|c7G(3;v~#D>%H0(L5t4Ml^ac#PB}Wco85a`U$MwL@;m-;I`LQiNBk!*G zuDcteiC*I-{F1T%{*&!Iu^SJ7XkY4b7SEfJbDieVy#w++GCn~aSjXp#deAjEH|@bP zS$%eQe2ly_a2?}KmG+lo=|AVRLmVFLg(d9_Y|06Z1WMI3fx+%8;B*{lc9L>>h{Qq% zu5>G;vSld(he;QiK8MC$3eC%!3h}8`i79rjI+1ptu?3vp`;=!8wkN+b=9azlf#yjH zW;@5S7y@^v%rI)&y|R$5FK!v$){eiQ%6O32X{kB)EaVrcRRZjYfjY`cySZ#Ul)Q9I z^CuV8mKR++#xy^SWooMFdEHLtI~mAcI+H@cnCU*o=%#bJ<#YXE}OMTi53 zj*m=PUa-z6`)iiw<@MhbC3sALiUEG1|VzSbWVkD#E(d^Xx_)KniwZze7mDp$gb$gxQ4MXVl zREecDl6{J=^Igd#ZR72aQjHihCDQ>90$Vw{l7Rq2;<=E@`PmfN4_TRfvl_9tF6lMr z+9Q)2mUqQ}cP}RMP9H);ug$YOgr1faovRgB=0jue*sA1+ez0Re#)2x?`wJp3O}yk* zx{^7S;1n;_zM}(A1i`twO``7^@^I0nT-~FS#SEw){pGfk==w3JFNQ#+VVuqAvY|GB zSiL=VQ5%Jz0D(7B7FmOe;Ovm*2COyi=`SzI@Y5f@bn@cI-ZpB-?MH@ZMH=Vn6t6T4 z`!*k48OHR>jRaq#0 zoYg@9d2~yx%^`GX?XLzxrFat#>E~N;dkcTZ1oYxY-Gr~zf@J@UT*R=}yn>Y@%-7ts-u>8V^sGZ}^_a=GCMj;}1s1wM6g zTRt%B1+M7MJZ_{ex?U)nwc7B?EyT!w5Vb2+T38|OIEMMKLbY8Vicz-^AHS)IAz!Gk z7+G6Fx!?z1aWPWoZ)=wRq63z`UtJTpC`6T0dKGPTNn2F#rRE}H0axTf+yYyIEn@?y z3FMqA_$yhTt$RA)RAn2M4(yN%@A{>SaH?M4oT@`ZhyQ{G|QE4?|mhZRs9NH3AF1;7Q*m^Srrz65OxgMQnxF| zorMT5A#nnPBqTWriGz>hIL1y)a&mGwIL?t1;v`ONlaTm$OClBhRhqj^k+*XYuK`z40Aye&{XN#^LF=Kk$Ybp2_1| zlZmbzkCm*dnu@7PKe9di$U9F=?zsh@oAJ37pOYshx8VDm)xB{zdDW?V@49Pp&#C)A z@n^;4o;&V;$MmYn9VhR->HhCJebe3VzW?pv=~Cabd`^G&{SUt9-Qfe_C|{ zUUSw&J#jn7x0BcPtuUIMzH@f^mU~aXqExTCn_R>{56D~SivNXbXnd9)%G)Ib1mRW@SH4u6MAo&zfU}kGFf8y5m zP~A3!(Be=<^C(RL%zPdv*>pZnqI3tAVzz>1at`)c!y4gK4XYhfF}G$$G$zojVr8R+ zXqu*OTp{)LAwL6H6*G&~r7yaau=>*vT|MG_ejC8LAD_>Dmd@v?7OZq1uom0trh9j` zQ$gpmh~`B;4U2dd&v$T3;}veVojsXICQC;$7N}CVIER8c+|@<|-VKM1M;co^^p9Rc zcobvy&i4U|_u%u;J(J0aCtlIQQT4(RcHpq)DyGvFWl1`XqC8*O<}jLDYjr+$QKY1r9Pg>Zdb#Yh=`DvVVZu|-cur_Yvs+yaU`;CvsFp2YjM95^b&9>Y#0LtIM;=c`l z@pS2gUEd2#Z10PCOnBtQY+5AY3W;ci#OLuJbjnAuW+yNXV_3bz4K58)I@n>A6n?v= z$>w0Z{)r_RTOBaA$N&Ey_DP7~^O7)d;YKC8K?w$=@3>&̿_)K7VxOj@xy7 za>po8tX*m^hFLmGqbXityt*0+yJxP1f1$im`NsIV_C2j&`?>GeaJ;l)($qkyF+zD_ zxqA-v8FDeA&Fs$aFFpSAj_t%algTx`$R({s$MFh_a7OMJ>|HbsXZdOeC3Xirj{iS* z9VTmy3$iiX^QCqKyo}(6!&`XL*)n&(=`33KhhH!magZ*@QvWJe_cK2K01vEreq_LF~ufrg0Ig zaL$-3ahgh}67Hd{KJ8vR54WrTo$on&#Om)N*BdMR5Pp)ya`kWDfAw*kry(7T5UUTP z!aA5U>tH@c;jqJ{al9JWk2Z=q@N<~Ycq4_!SS4MdStFYYzp7b4;W3j zosJ9nH}AcifTh>|z+ONOJU)N(<6E%Rx3<8h`vAKurU|3g^yFC)lkv&pv?r#4!>*ap zZl%6dX;TGG=@|wC?U_BVugU&^^j_)F>{J|W7S@~q1h2#As)#Jn!o_*r5F$G+PF~QZ zMZ0W{y*9Tn?4n*OT-Y2Z%=NhlWbHP}$VN5f{~=BOc*I?cnCF((ILwUuB2xo#@>LQ)BZ zvkAxPq5pDjZiD_b|5L5JvfCPU!Uj~7QtO1mV|SSscme?(2m=GRof}gNw{l(GG+Oe?sT-+X>>o$4!0@9! zr$e?cwE%Aa$khbk4_|xnhyzI5>cN(5CZh0;7Qt)xL2x%wn72fJKF2N#lVTRF;7p4Z zoFBshMD*iSa86+F{905#Y#=-nseJ)|_efw#i_I=p2Z+20pErN?89?RzEh^WILdBjv zx*CdP4qs!6SJ6Sm`g5NID#9zPploVk8ow+nw`@vLHMNiHp(zidWenjm-|V~{114|7 z=h54+VU{#rzh|HC>4ME$o0LV#6kjcmy35J;0}xC~`7Ed*^|+rY zFYU{dh2;1be|pFLKR$WhKA7(*Il_;KAZg&$QCKbhw_yX6%=MKl;jeMyDd=SSk%KNg z-jJcX4om(BmUi8n$j4tCxqEw;UD$9ki`rm13qjUJ8Q!Z)&YrZ7okM#qaLY|RE(fb_gxJ$cZ_IPPbuoGi*9Fr=Eo zLisfaErM0ro)rn%>13Ye({$D$!oqxo&24l^@~XihDsh`5l=JXZ((&N)$1Wq7 zzk1WtN5K4z$-=^Y{ePSb3-^ZhY`=I2<{n=)NkeSQDZPr>%EBd90K|a+9UZ8q_I%-b z$}p`=SvGP#5c-W!L>^t>%rb-ht^U>?Xn?=CbKE@(6nQ#?7_Jbw#wrmn`)5q zl~h4hF;P1%=R&*KNFW(>6DT1VcQ|12ae+2L!x&W51BAt!K126p*g2vFfBtwkOf2&S z|IsIp;f%hzMffHAAiS6J9?zhgK|P!0T{3I7x)&%*p=7>dU-4@gtFmM);M(-(((7CfAtOg7Ao*%9U+dL4W0) zh37+&_Eh63PZ}?fn_H_R5auJ2H7H@|%{J`0yBCyb5yxJR&-phFNju}&PFM(+sm!A zeVnes?;Fk{jiWt}8NpYi01l3RnuXb{CyUg08pkUTzA0VhlqK|O-T0#M94JFVu|sg{ zM`n?(v#%5&A<^MMoVxik68f$ogqDnPF`E-}lM|^v%?YcOhfr8p5dXjpbsFeqUe#z1 z@CeQzml;iZHPl(Rp}cM8LM_u(z?dnwkNg>O6gmXy=h(uapFV%YPWxZL>BIPZ;A)Fw zFb2o0W#01~cjgpd=c_9-v9!b^_(@jq>bb88XsLs)RqVf>!)U!Ow@{`3!w zS+I*uLlKSh*NOUkWxL>)?X%$BM0whBe>sdazS@;%mJq%T2TPZ(391^_DX4VABsNh~ zISz4V|veRYnT~O7zIEsbnIF-DUdZPl%jeXtXeNW}rrUl0%kJ%oq}%jROr8!pyBq3gPjZaaXwD8$<~W$8`@Q;5)Qn zFUwDMJ=J?Yeh%ULx2_pu;3=u`yYcx>NdM&%x3s%39|Cv}A}1lFqr3>G1&9cn0bzah zceZLNVjaZOkfTe)d!_HO+JQdE*v5MFkeiThM!@_Q)=L!MXKpsiY*h}p?2bkbaaQ0cKDOl@e2(I`4;qNT= z_b)zsa@|4^-a6#P3gy&3L||#~(vAMsE%u{W-4vfsUuq?mj}9$%M`FoaGnfBk6Ll*u(DRTpTTh$M;gXO#ht*ZI0z?jmyYW+ z5L}wt7|rls(cT8K)KmEk#dKYb^ye1&Soa)%{>U1W%kfiq)g?B~@1?yzp|q3e7E@kA zmM7UXD`r_=x&~?}gtq>~A_R0SLg#i6I=3ZCPKDvgFh5b8NKZsE z-Yix*Z%J%k`61x-ytlRoY}Sic)=O-r897)}dSy1>+M2@&Hx~7z;QxE0=N5&wQi&V57BAy$u!!KYxDul!}whM4{fA&avx}RM`~@B zMiPg~6km%KpPkz)>Yb#{8RfwXC~NLf>7(bkAatd!ncpA)ad369!^#O8%F_=w^PQ=n zmI@<3a@AyV!_vdLX+4}msu7(R1r^rX1cTfXMV|&r4x`8c+?vM$mhR2fLG zbgHuA)%GDiLttf_ft4){&@X+6GQ!?BTqtw~Se999Gs2>DmPAv$sGMl;LLrWT%XrFH zl=Z`9S-KKTHhv>;5s}p%kQ3Z!eFVb!$U>oYEY*cTEuoP0#a1J~p%=M)$i>{SsPhanjMDZTO)La9B0kB}mQ=#?R;(THm_wNik3 z>(-9XdAV^l`%o~yVTJ$gTZ{Pir>`R!Zeft_AA%%2BfbsOs3@jk8qYhm!IsqcAl1%5 zToZu;QRKRn>({Oa7ZIdCXe3W*h}jkQc~E-Hshg_diU-C&S`oMV3}&dL8^+OJpDgy- zU;YO+ZSF<;fV$T{3*jq3-KCcesuSyUf0FcFK^}HsnhN(};~9Yn+P&d$5J)x*I?mr( zWCMIZw^8bKz3VT!Q7Sn~Ngji(?U1#*vUhoD6avx`8!3RpEKA2o&GxC;y+ryLb%ya>GZlL}3OpDg5$DjpC zo361WDyDH7u7a|;b+tc9a&5(g=Qv>Z8&`tt2L}X^4QPSC(_rLuQwrrNQJPXzN16XT zB&KzIfj^kG1!%wSoHqiyrva>&;q$`FZQ9MXL)fj#SR!)3L8Rr=Jna_NMIu2ON z%1A%B!c?+yz-B_^u7XC(x@VaqT&AIn-S|}8Idykk-`3BjpBR(RmM#tU%dWIwylQ_i zb_{j_&UXq~W917K)?j~-YI-QEMo3*5;nkqKrEqi&hoIE(AuAHDVXlPITr|Pa?W3U+ zxT$r2@z%nzKK5LD0`KetE}2{+F&R*^_04JGKI<=@8xJyAr^$7v^ zS&#w_YigWDFarY6s^BR4Zw=wqaSVQ7;el_B^1#Vj{S#pFh2PtPoN`;c(Ox@**Q!Ct zymdFDA}JCo)lO|C|J+`JpQn~m96k_kKxnrR{ToUU2Uywy^mAw(s#6b&hN!A+^Zm{Egy^GqKJzry=+NP zY@?VPDETyKnxHm}d#r-J#|}K;s^bm0fZxNS-iMX`inLWwSFN|`uyv!dBArk1)m9Y5 z)^gv6zlshNVm4n>n~>%j9W?b&4#cFp>VDgtpA0uFdzxXTbXPs*o`n;$==yhi@4{_T zRz8P?iLQmU&Lb>1o)?|8tety4oE*oAfx2Uu&oz@lEo+Wj-IdokOv*}@m8rOqRF3bj z;aZOk{s$mS!jo~wD!Ui9Y~(loEgx}0s6^m%z$H9urw!3Sw-Ae2Ji|d)5Z2Qywodk$ zokB{ZVL_M{+;^FRK;}}@2e^$jH_GLe4E#gOUK`mdbNoPDX2jQ27wjK0=4GT4&wUg2Otg|Nh*6qXjwn?%(qZ#OBz_aK}v2|)wHKpqd zt!u|Aef$#9e&D%Z^R(WeH;o0bg=3)q)$GK4Ls?)4k}cb?XzTxTNKP-)MQ{A`$0jdZ za*%J^2a-KAkLP(Yi>7$ZtzidNRtBKLFx+J@N3i6+V!9NRu^IcVmm2Q(|GB5bL3(!!alez9_6nETd{%(w#S7o`c$*-d z8tVT;2`U=5fhbEZSxqEE;QG1}+!N9h0q3xBj@draXQa2ej!~OzEpkr(oNEJ|tQX77 zR@*IdPK&h2r$v@nmfXU3A5Jh6H4lQOVh!hDVVKKsp)w90YeUC;h{8)YOhf(MrOWlf zE$dFauor{8<4(kj%JUG4rsZ#~JMl661Pr;?lKv60sa&uudY$U7A@;W8A^hgQZmZj( zOWhIcoi0t(d%ul@|JMwQlu6!O91+K}ESyj2W!qcs5-O?85>is*_&%5sR#Co)u7z)W z7mA7F`K4RRL$ydFh01jd&Nn9uze_=miY!R)**{iLFIXEL@+bB6-Ob zgXdH?Wm!^Mt|LmN*r6eiY>2??mL~UoZ+#kWwRh}utIhjOZkWf(Y>HQ6Ns-;R8W!ye zQF|`PN9uvh;Y4~MA*Jv7U?O={mC9pYReS1-WyKV8u)B^ZTX1hTbilzZG8u)N*uD+LiaF zaHX@}{vC0V^uDlvsM>+!M(PaK*Lx)fFqS?harvgFqz^7*Sm-7hIfshJ+Gx~%AkRvg5Di0$Ru7ew_)6&7LkxrD(73yb*}^B z8<&}+@BKw;Cw|j#ok<$+8Mw6UN|epwX$m1F?JGH<+HS`*!gu`I5q^nKrJ>465tI(s zwQ@x%YuD!>tAes&z9-;jdrkG!_uv^U+}$wE@Kr$e69BWB*w%=HK<}9OIBR?D#Q78k zzYkl(;ah308bNK?MWuxHbf7)u2H2JcDgzF01L037seEcGqCBwX)l-*}vGa_@_QpH5 z3ES&NNv2D|TIEQ$a$z4D}oNtQmOQC4}9Gp2mshX8TlmB$;J zKw9Xt@p<(ztMHXW>t1cDq7`1k5KK&HYn*o#ro!#284sK$V7h|N!l-t@)5@z%Nj}6= zH{Rq&7wuBUH6gfS+34x@q4lV4+#i*lMo%H!byB19a3v<>_OyMF^5pPHC3vG;7rv@8 zAX)-1AXeQEJa}1-Di6Qim;!_(YV?K_>Kb=}z`Ic;Z zQ7<^%>aImIohVPI^VqgU-jyoYNLIR)2%NT1my!h;XOFD4{!yudKecPmuK8vAta-2exM&_maX6*dd}UvDRe1-2sHqnR7fl_QMrnaS4JH}76vH1u&O4ku ziX*7&lyaqCyPQKD zpaz5pWnJn3YRJ)c4>>Jv=(_5-IsfCKkYM`hbWB1H4as{easRK}*-iuP+0%T_SiddY zEx>GII~4%4Z%7_%8VXZt<_k!e+QH54YU9&jx02es;IJ`|SE3eDY202%??R94)V>ad zK#0AUB9db}QwImyQ|%3C+p#^2qbMt;c*UXR!q4ng1ul~iYy3Kpeh}17>1d{}JS+&3 z4GZ3>4aMKaGWl6{s?p885ENbBt*w89S<39B#oTV9$EZ?AgQ)~D;FN}(M4D`*1Io9N z9I{AN!&XBYINZo~=-_p>$s=#OupM>u@EAYwH!59ehcMj;FW^Lh3j`OH;naA; ze~OxVp7{($>Dh*9g5feQ6A#-?RCkSlco~<)5s12J9A$Pc!7ip-Fc=pWl!CiWsi7FC z3O)d<;T~yOGeOy^G_EetM`N^y__=h$NbSqZs*~@3k)<}Cw-0E0Rh?ur;!H;ye%fJP zWbK5(xCo~?LdTxuKJd;i$ayI|5OywDEKkBIb~)Y7HFU8?I>GiKJtLF*yjNe)R-Qd) zOmg4(OC9zdzq4xhFp2kpXV04bA^}}9#jDfJFSTsV4CexjpCKPb`q&WAVjbNWH&DSw zy^4lT#)fifyu_k@_O}6x_Y4m&9>5}xvJ6<@h268dPtKfU9Drod)Rl(mKuOI7?iS@% z62DWG!mk2TIt~b}?L&S>&N24a9M4F1@4tHkB^=+;+LQ0-g)QEF_aa^@Xwp}j&22~D z!rmV5q=aL^al=yLPvF*WQ^C06`jr8VeQ_N)H!NTk0`fqpqnhtB1YEx11zghQi_cwv z`MRYg9zP--0EPvy-z^Ga05Q(^zh(S&LC{iv)>pqO-Oeb7y^cK%QnpNuw~ZboBGh;IEm z=UICBHN6O?-BOZv+!RFxG;O!1Pdh?W3F)t5fuR%-hc^^Q87U;9SRko9Sp(O)79M9u zJpX%SpZ0rxc#R^-`<5HzqHdwXwqLT zpXI%^Z7~A68RaYW*2+U-1ib&82Mjyg>Q_8ri5b)5faK<0|nBhR2!xb)AkK*tPYd(oXg$ueFf+g{vsv3pKTM~ z@94#-Gh!#o+RCsnp3ZHa;I1AF(B3#rmaC}gr>o0AD^)|*_bZQkeub0hnF{jLAs)UF zSao|ad}u*cp7pvhROO{hi&d1?U6uP_wdXL$Y@WjThmyNe3NpL3j<=o9IBw5C){bJr zr+O2wtQ~5+tW^MF>fjFlkjJ{Ac0!X29YAo!Wwxd4`-b4z;cMpktc|^AvuO_L$WHC+ zXxi{&L?8o%jE!~?1~I3Cd8!alsz)ndfuiFcNOY#P3xQ5F4t!d_HeA8qm##GHBleVJ zoFwxT-ISA0{nokTkM0G_LHR#;qh&*{-yiRtLHR`zXR|4;&CWz$dwf4nL6Z`S1-?`` z#uE2~$2A0WL-U|Oo;lkGdWJUOrjzl>;1d<}sZQqGjr$`4xu#Xlq1uFJ%!XfOc!h0- zm#iG-_%3yfmrbLgqQhAOPiRb2x$0Kxihe*6qr2yZr-p@{z~FB$jMzEF_6Ur=ec5TR zdJeTXzj-)8I-m7++RMX~MhqbQ>PwGiep$LkQ-3|Kd{7pyQ9&((#`7Gv)}HTrT)9fX z#ZX75mmfiTG$oe)A5sN7!PV8h5QeKeGftwmIAb0oFrOEFVL2#?S~e2E(0Bsw!-z?* zaSm*1g>-+RhXo4f>@6NOW}V#`g;?O9t) z0)zUiYpo5U9Yo+IHdE;c+=8IMC?g#7*R9a)BrgMbi0Kx4S^c4m!T4mj;V$~`RH_OH z|CVcwl{bXuPO3pMZ#!LPVMOJYX^)1Z84jCYHEj3h1w^2Rx0NFm$XJk3|-&oxA?;Um1KYiH( z^-Fi}gewC%$$8Yy!R_pOxTSsJ*Ahkbz~;xGQG`_R2`*in`WPP(LTI?zI+`IaC-n9p%5H%zy5~Pn)RcKQNq7 zc?Jr*s>P%EJddYYjD0!p$*+_i*>So7dDW_YGzi;u8qE#&r1F`j(Bla5EAM>$AB@Pc zT*q3KOIQ0VH?30Tw~h)n&nSenbs6}G>cOKlssfqWD8B)VqMM)*RpT6Ta-1Z{ENtg> zU^|ZjT$!GXPNgT}^h93i|{`KMbC!tX`VYN)d?C0RMj(`XvyooP;I zcFc2x=V%d7btPOcFqvZ9(nod7``|@wV%X3A{IL<{o*FORhtDUsY})b_BNhs)-nK1? z<7r|Q(%2^dJWd9T=E{Q#5`NRE96`aC1vk%l zxh=T4wimX6f|~-wbw0(5MuF|!1=o~~@epEYUo%MOro>H8(*0LxXoh40|CuhS&NZET`gs=4WUU?!)bYe8CWgJ@->FpQq7$N-vuTmDnTs zLHuQEsTlSZtgNbQ?t7&YYs`HaBEmMzHoRup>h9HFpp^ARcEG9L#b>))-K9k|OQ!g0 zFP6f_Q#WAWXhV~JsRF_{P3;7_sYF#NPt@?MMJ?O__cA!0>PX4}h78fB1Io``mKLW8 zl@`CNg)G_!vOPbic{E zK=dp0CzB0pV4uI-6o0U7q0qfh^fw<%GVF(FidUZYwQ|)sQ&0xs+2T7bB-0$)y)U^| zK4|2s6ynhOLyye%UT4=lu$-&?R=Bg*F7K@O_d-=znSL=>o2LCFQxG__P7rTx&Zp1A zUQx!#iaNAWS32bgh|je{Ge%fxs9?0D@d=Cv;LOU(YjB}eo>moI`@t8tzh%#4Xm5s5 zBs)fatr6VY%jD?KYnvQ>a(~EI37E;E8#7+ENO{+QGw`x5(~{Kz6l*F%Y63%Txf+if z7SQM%=P4d=wpN;^zYJ2}bqr3xRf}=>C-y;T&!Jr@_GdPwmmTMk*&uZWsG3GlYb8@M zDAK^pt$pr5Z*^Uot5`ArFi50jF#kt=x^%wT;k|mvfqd+8>f(M^+X&&PaN?R$A6%`= zK-C5czILIx>V}RmqYS0P*ie!%vN)a7!RZ|Gt4@R`ixY_8Pj>rK`fIjzrJLc-i+2zk zXzSX8SW8{Q>6*hwN2F^z3-2Bx01vD7DaK>QD~+Zm0X0Murl7rYuXK0?Zyl!2xQJ>F zb&%d($d1wh*4ceD@Pl^XJ%5F~)kU7=J-t}YJ8E^(cJ`cO^G)%!upzUJ{2n0y4TKYF zso*uj0f+|HtCk?b8Lru?ak*#|qgJ_x(i>=P+=@<^c$>F1zS{2EC5QfrU!XW~;pX4H z4{&=X0Y_mno2DeA^vHLvq881F54oe1<8uR-r1E{wF@9b8HS;T~zVZe04w!Va349y2 z3H|aiLj1AGPD$24k$B$UCNz)2Svs52%MJ>SZT@OoFRqxbIEb0rxk6D{S|7(dGQTE@ zPlOxBhG#EDx9bC{%DaDfsBkgst;|j1B&7jYF?hMYNxG7|E?8R_FV6_qRgSB?(y!Le zrX1OZaUB@0qGCKO^=CVoSho(rurvInXn*Ko6h>1hFROB%+$v6w6J=d_#xLP9iFVql z;hH25?s6tztvzi5U3u)#XA2HFQ5}`&pZ|QD#rNfJzIcR{xf4iTgwIvy+7<(E>qY8} zWTF`j{YdkaW}I|pGM?E%SC9cA;uhq--*8P?S(Pv}m4Q^aN;r-K4ZLySCN#C-emkju z`zd_J_Jwyob5Waj@)Iu@0qf&S^Yi#+=i(f`ZrJ=3VXyf~KpaQulwO@iuxGZba6}0w z9u!}|Di8jsxbk4D?zXE~=g@^q#qq0wWyx%Y=`$8dg!3 zgsFHHz=xs2wttWb+wF zm^kf8=F^5bje!Fs8-y-2+Dk+6KAIZ4WUC#D_mk0CBeO$jJlCUt-@1j@^{zX%OHeY+!=uY^3t{;?TUGdt0bn)O5g1ao@t%HL+^D*UrOiMwzf-W*L&XrR_dVhK74C%qw-z zgml6{dz(NiaCVICr&uJ*Xc8Rrg^ zy9SI@(>(PZfVWrl%Rr@JhkyBkIBR?xryZbQ{UhXKk*zzvb*Mm75jBI@=^2A)SQ!~0 zmIKwUctd?nJ+Ev$Y~2b$Tssxp3j!~wJzxJn1~fJ3QPia78rx)dHU#u4r#X%nZa<~Q zM;)?e74n2_$O9d|3~F4cw_+PNT33!T2mE!4YwO@@`ioZzgLA=Qb1guCPmz7?me?E*bVUO$={;6&t8dx?Jie;S_F^?O?4~){D=~&H-mMZ+b3G;8!!G{ zt76~X3+t2gjck@=)a)=#vc9Br9Mz^4+^LBI6piaLs+W=ub<~2AjcA=}XPv4(qA_G6 zS*^7+51In}cY(~mf3{5{zI_a8d6F)gEkXL9+gZ}P(vLK5W8o-p(qI6|rIC*!&_Vw!}RIQHPCL74S9D#>I&{0>VLe!;1;JAAGNS~49{ZIX5 zo7wllQJHTSFSVn;_M=aqsOP@B#qTBi;J5dHyEvI8Q+nA%zs%acPt)ZJ->?Q9R8}rL zZkWBAD^HigS1^YM>SwhS*1pjvtZmr8>dNKKP@E>2=`2116(iS)#5^JtAS2Y&g-sgKaDt-MmWN7g!^a%&eR9x;E-IP7~PP z$ZO>TTn6M`iO&aKvg6wh2_B(0C$5*2m>ls_?3{Pn6)*a zju4LPx=vLcTAky_Y=Dzjwm0L)KQacN?^-G!uX4#vyKA^-&b(jwpteIvM%{;^w6_3r zK#ad@PTO`{`G{(pT6vDA8tqnPCBP84#%pv<%o8+R$KWn4HP?QiHXby&=`*%#&N?RV zg8eL%4G~U2N}-+!xGf-xJHqXBz?!U$O0Qcsm&t|+DbzXQOIZ3#Q)|ku?}f!`PDQco z@1Di8DZbA8I!E|{fSYOp>V}V~NmM~uG3glXG~5*jRF_6}j+n0#xc??r{3+5ae{ZMT z-hf=xL1Z4Ki_Q`7>uEetk>o{>O62-Lz^NNq)g)O;cEiEe+Es}zeNoH&|LKRW9f@+I)3gcjsSSJib(f z=8*paR`64u<_tIVt}f~(XSdqdJWnWJ$adzjHgZCjbm;`f=ipvy2`YdE71U>6fF^Kx zP&Ehc`Z~0^J67=ixQ!vcaOs%74S%%k7JltVXgJZETS$U^Ald6?PUdr{98-FAW*pm} z|0CE?fkL>dRc(Tj=KMlt4w|*r-XA3-8(x`POTFTz%Xd;Tj&B{+@|n}F*~jW#>9sq; z8Nd9&IAC@%%1%b7HmpXa-c`RrM($}NnrY8F4G5yFosp8vLojDqUo&kU7%09~(e9&c>d!75g-gq;My9g<2kPN_!HAhV9eC#RnCyR?<WeRV~L}%ueUaX#>Z(6F$0;ydEhF;!GjrI2CkF=WOT>#LCS6)@-s58 z;D7%@YjvMJsz3X5S+iJv)20vJybn}+)huS|3}-J(!>n(vOjCmK^1VQMfpI;sHk!s= z1v-$}Rvu`JQkVLWqwbM&W!B;OpRu(VEAze2vS;x6A;7{j#>&L=ESe@WJMsESK51Z- z55dH7p_n)vsH75Y%PX*Ji9XoOpU>#NRu{>rlD4$%^u9G zly(DljW2lR2d@4~?SHBEYpG$BpngEVEP2of`Q+Xmlg`)iz`XvOOJL6G0CN__z}d<4 zWOq>0dEd9N*rWVB>W@uToR5E>?QZhIebCvfiZhO)B%I=FVefRiaX!|%G%DcQ0eJ~|GT*y9K-=9Tj_BUP%LcV)c6Jf)XMEqS zWdPpJWv-#C-PcX&Y*>1@kB_%$cbAKn`8!{_=^X5a*ACB`{NskmK5k!nA|l^!Gr#Zt zB?Cf zOj&u%g`B|L67En_wrRSGA5l{K@H2Lp)jD9))aAc7X%iJD(Y{W0Vk7IY?Yf>!ZB6Sg z|Jo2?fY8%}C+&F#!L?Ucj!XHb((!643_i44;F13I`JZmBwe#FD*@k*a4qyEZO2>V} zunag)dV5hNX#p;CN|Ru%hPq1=l<>0yS3$Qz7-l@i1Kr2~1Te{3!iV+7Myxgdq^y;H z#G7xVCb(|d?1RAT$1fV=gQuNrrl^%v(=?o>nH`m}%Li8wN-GEu%=Nj`h>~Vpa^sf{ zyh!5;rAyx-FrPxCx<2^t{76d%{pv?99I@?wi>fcE3wUBD6+Ul&s3^IY4rE>cvnjsX zb|Jflqd{-bj?2hzYABa;Y<=Cx;b?dLSetxxYcSR$dJ9(gp~4>!?N5-+ zX*?J>zNE(^@^l5m-6-q`VUz;B>zOsui;ln}B5{tIX`T+ph;vzo(VmCP>F%?3y8En0 zobz49p*PjKA$wc2osWg5XhYA9#-&V3mFthXE@ z%rY7;j8|wqq+NlQL)krkZM2kBRq6RkC`o`(wFx_53E;>;Yu#egXJGyR0H17mYrkm- zn^oMo=qUs~Jjz!`1$w#l7iqo+XI=n0P;e3_wJ)Ws8Taa%c{TnB7kAxM%%hQW@RowW zz${G8DQ0d(N4tv!VFsYUI{)}K^}zTSc8SO=nGX*$I#x0WZfuE1lI2}Uyjz~^%}keXGl<^eb%$biBVo_nzV3QKzA ziM}gt!>Z)Vmn^_bZl-o!-`^g%qk^YV(nwQ_3OhD$iJp&q|$kZ6r&{W&!79C4jb>6P|Tt%xN|T{3Naqe@w77k>4+ zRO^6%ykVWzIZNa6_s+tN{={qA({oe^_{ygifpzJ*zRRKPxWe<+L12(f48v3Lsq|#D zp^{FD#2fJW8T`xFFQcpzy+DL}MVL|1=Gzw2JX^WUyIR-?N77Wv(ic@DB@aZ~B9W7{ z4hr69@-PCep@XuaesyxWO&s}HvwlXiyG^bdxOW_u4hpSLr> zAvRC()ec+PH5fMVh_^wMimO|g63Ve((^bG!)z*y$;PxHi9Nk3cQM0iB>}T7Ykl*uF-#5=h8}np>Z8udq=+f${ z?zUQ#YAq2Qpa_U1sqbHBpFQ_IIcuG@_dO?}s#fkk>psR1=eOtl=l_4-|M=tCZ1yI6 z-g5qImOuIu=NNu}1wM~1o*AB7&YTX;-2Rd(3eq#Df-^5WaVCi4JPfW0uM5K@n1^AW zoO$q7Z+Ol3zV^B}J@fiEes>TA;Vd|BHe-$3@#d=@cRJ^lSu)dwO&Q{hs!&>9qE_5Dj(?b8#*7GMU zw7|;Vg3qbXTs*5DeW+jPsRI^z&zYC%>h9a`3c{d&LaaDTiXaN+c!fcf8&!F%Y< zZ~UIIJoz5wi8UpbX< z>&DZb>6#WWGFR3WcV*{Fzw%r~e>B|dRO>pIZy)V5f@Ya+hURkt-vjvk#{Y5=(0mQh z+?w4mhGw{n=BbzNq8S0rG{}oMpW{^q!7iFvvP5$R>jm^WM|!-~ekFX~8K3)YEp^?{ zPro@rc(TO8BiDfET0rw30l|}>Y>n?7gYe|L7AY$8f>4RlJe)^ay4+ud-Cwt1e<|Y{ zT^Y%k5{%b=%akXDV^k|#w-ZuwBL$P5Q8#QK#WQw1S2k4r<}E_(C;#vBCfK&G0FqDR zbLsOeWWm9Z;l4^UKvw2yJ}--4d0!=k-9*P{v(|HE<@&DTRaYycjH!j|adU`EPYS#A z*WcOSU-UY7>CeDg{{@!kKVx_4V}~j44-@T{BFX8hjtkhMxJ;6P^JBCFBO{F`9Pax} z)*P0nYg;B@j3yYRL)$`vkej8b0bxLfD8%6MhZH&;BDR!OgeSNTG$?&q+Qmps*e@%Ij{ zvanx#8264#m}K)fii_nnWUuf~!Ay7^la4k_H4eV=y7StG8B@V#2-5)q<+d)?Z)(^K zr#%`|F#*1EHGNK?z zf^?2o8ZXaI7zaxXFMkr;KgVf(4=1Q@yT);whWTC78N*s$yAF3*>-nBjJD%#?)~RvO zx~}yd28dmuy;^KP;m-*4SgpnW_?vs|-|EjMZe4Px&i{MlPQ9ha{*D8%-`AZg<2*~} zcoj)GaNP+Fhsy05Eo!flxbuwz3&yx7e9w0}*|uHRNUxUe6MEgP<3GIw(ESYEb{EZN z#p1Sm)ewAPxV-IxJSizUE23~7mQlFewn1niyAaz}bF%FX9q-C-;21EYg=kb$8<+sE zf#GYk=Wy9}o~#|^AMNp<040`SvHVxJJ(;k4(Unv7Vz6*Vzk2a;?8Q5JFkf~6nEN@S zVOfS5;aaZP)ZF?JpT=d{YESc)tJdPE?k4vYvCWkm!4)8hM)a0PB1+BoM58Wemy=Pzn4zRojnYv4}f8>)$YH3 z#B?D-6uipi)md1#^9ERLEwz@l@#;<@+VyZ|T#cBw*3zqlS8-7>&$zex>YM|(vz`U@ zG(t7y`H5^Zt9{`Dz8`(}Qvu%(^zcO+z*j^`SQc}gqMoB7ZVY(>R*rrzPhSi`7So(DmCE_jcVHuWI0;!^4O5UJs4o3u?p7as}4= zt61XuRw#g5#+JVu%4A{L$Gb2mNnqLf+>+Rz!v0{gHSmy?uesntIdETKUVLm6={3*ZKM;-V5*6|7V*EV2!KA`x-5~kVgrGqdfyVrP_mnAVJNf2lA zBn-+WOm=I$A25klGla@b1@9ORwCftUE)@se2C|4L;HKCix^`m-t?Z*0RXvyVt<@AR z$zNEVf5>5w7YN;S0784OsD$FOILPK%Tr4e4Zey|!1FFgez1=C(c0$PpmYLOxGpB{I zsiYCQh1sbOb3=`RwP6rOyc=-{zw~OdIWO%GT``8$GKRhRo&{DrL_!AM34CpwWRLL= z!`?saoXYzWd?DE|E{qa5d_px8xzOkQ7rOi5A=Euh<2+ zwC?S<&#i-yq=VZhj-#l69R@p<*)3FBm4r@PWtjG=)-VPlzh)Xvj`4Bww2>XJJgF-U z%nmy+9otCdW*h0xW;>{T$6sFv)V{k%&D#LA1h-a}%;{Aw{leJVsLLs`>RgvtT;4Uf zz&P{HX~l7}*^0Lp`{dpCJP9j)pg%f#Y{lXJD^8O<$+J0LX|g0Uvdpd+`vhl&ajmqj zRKptHxUQ=hbE?`12jZkYX99bi!rm}ecqM6#K;dbZScd1Vg9uqYBPgS&muSNTB4cbB zp3o8z_klHHklhvIN(trFH3JLTw#@foVLVnb*9|r}4o0=tgR|;aWSU#RUkt2^!oJ4{flaL;iUn=i>8K zVLj3pj3FEDx>~&`Rb*v8FYU*Llq$ShF?IDpq#KkN;wS@ZNphB@@v4b|Td9dCk^&ICw8VfWR(S z4&Kst3dnZ~;}jIz9IrT!9?NEjJ)12B&Ye-Rt9-_N2CCIa95C(R7w_8$vaSzC(#p-}pNG5k<^4vybqv}8X(f!YP2)LUQ5p{TV7MBL z=hl=fP$4E3h=(2Jxwu(z%L?X^o%5tT>8XsUBm`NrIjl>_=KKk?k@;;35e zBKJvl7u`LE$KWo4%pA_~iXv;<>@Ip2Y#X9JSTN}@m@p|DuT!4r8V?~32R=sot(H}% zR1L4~=#rhr%-n{X>e_{S@$pYQ1t7ky-&D5@f*20E7kLho7S8Ea0QA9yU3%bW z&xiN*9X+6LIRMao!=3=Py`1Bf#<7hwS5m!kiX{RY-L%3~8ni>@J8;K@Wjmr9*9#eo7l4ewdPesKTJGm4UCt9no^A#tM!G z&Td_Ck1?-ueBpXt=No+#Ip`CxD_3I8{P@L$-LFkb1h^9NucVVC7$YFg9@HgP_Nz2=h697E3Zdx61l`B!+=Ea{&c-2UdGd z(=`HWa*NZ(Tlf=(`{yhv?*cUJU9F(=v7K6%-?{O56VSPSVfi2aX`6R<=K<*KTLMz{ z2N187#Ni^dKv4z?qF&r4c}Cw>DMXN~t*fT;KO0o@qm7ziA;=Z$FODsPnesOI&f+MTBcM zDRuT+0PODryyLGq1_Sr9ajoA18wXKB2CfXtpqS%lF{t(n>4~Oh43>?tx<;_jIjnPP zxV)d{(pJa<{wymocYT z9uJ&VS5mf~!+q`x2VrH`IaF>`*M3EUHg1gSu!P7(zR}+t@_CH`&#UR){MGYe+4`8^ z*ioScud9QaBwL{bF%?jqSXWC>JdJ{(6OGn~XW4+1MeFzqTF2=arYg!*n4b=V%`$Ju z-MAm0fBdJE5_#7Fv3j;&5&3Etv^ATl2qD!ayJ)eHv7&4fZLmklk8MRWQeqj*aq6A4YWT>#gmc=sBKJe zoIBudUgAV=(TM z($q&$2}PJ`Xrpr*8qDCj3E99igDBUT2H}9NIsqq*H%xZE&np2T6RZWiT-Rw_-#>Dv zZ4An6Gbnd+<$prjg7G^Bp)3cJy|XOI5s~6m*ht|q6;5^Mx!8y}gaL-55bdR!6h=m1$c56f(62TLnC1$}`Ns7A&O zybjmxS_P`85pLH3B1BxB;!sXt9$Og51~Pls9d(iY0Wg*;3e?p*#lcrkDh~egY-bz3 z{3GO_e0z`M^AEsr-;#|aNwa8-9>gWKd5=lIr;;G06#dAm3TJPq6CkshAyL3omV z>s<*W+xUz*AI=Y zHQc|Zr%1veofpYU0!kQJ2kKMsFu)jk5^lQ$ci475L?H>E$_ED~;G?!)OFef?ZCIt@ zm--AkFdT!<0q?J?=JBb09(u-Xe3WhmJz+~(>Hp!kDGt54-)6}m^r>w?Q^Z!FDjG}!4+{~LXd19)R0;xXF5xpAG6d<$NxSE#FPR=uzHnin>nn-r zf7Q7E9*-pDXC-voIbK;d#D8eDlw1@;}c?TqOB zMmMdhoTEFN6PxCAj!V1lG1YVf@wVS z09}kfe1OFormu^D01@hYHEOt_~TEbi?HP&n<$! zyPgN`LB8n#FCiP@9?}rD3$Ms-t36&qt+f!E!&C4pzta=edg}hKPw*7hS??DY)xZDj z6T2k*?ASNRda+i!-t$)0dmj18DhyAC8{W}>G27YkU;c-bp?j*gu-`Ja=mBm$gvc7h zaNuRrCiir)^q6N%1>N32w%1x$a++P8*u`?4?>bo=^zz-i(dS5d`^d5pc0zln=rc)* zf%JCnxs)(eK{lp_m7dRK%avDAp&^WBMgPPulZPpV&JL&xNKeL_SF2J&_iH{%0q1v) zSF6VPU_v+KdFp0DufcvM3~Zy;4Yc^i(=}yqSE?aSs4;qb!)IbYlXW2Z`Gw^9w{oif zy0?eqJ(D0gJD37fR1zc*U+kR`E-#I6_6X>70r%DiD1HTI$blrK;O7}F%vU`FZV2v- zQZ4{hKy5WTa$3((_xlX_Uss134)-NIpG>l*l!nvFyp<^jRI6*0FTuqFc!O zlHCSPTf=Q<2EM1B!^H3NVvbk1;))YqK4J`UPj`+~3pt0#^=#SL|D9)eF=Gc)Dy(FWYn`v5wLE@&8OE z90u~&z>y?1j2pkH>O)z55^W|xUxMYn4xexOQ_=-*9`B7Am;1`|lrotGVG+!;AWD`w z4SRa1bPWR`;J7&0ekWR8BSdL6)B_1Fy_@AFmVm;0l{lulllTH$Cyz^sPK(N z8!P_ikL@Ix(ra2ju!r&4{=hLDs$0jq%_hOVa&zx{1$hudsKU$Uo9=Br+j)>jIY&^7 zErytbxs18%*Q-oyJ-f~ZdJ)$B>saa!-eptKzH1DI-5@_o(|!Ymw1bMMh?ZN(9;#1c z3w0#MacmC-0}PU13kaRU6)h9O0}Py33|pykg;L^ZO!6cE%as%O+^hP4|83uU&4i8g zXNxfP#^=~0IB1=dvl`10f>|DA^DNJX46+2BEnCo)j$=I6?Lp#)vf@>P{Bt`!Yg!r;XX>a`On$q`sgzyITfsUHY^u}wUUdYSOB4GDtaD1{0E+UVZ#>@?!kiw%EnJw-aA&gw zWkOR*@_}HW^%zIk>In%uqCD3(aQ__-%4tK{zRa(<2QJ9zj-(uLVleQ*i~4ksA7oSX z!}}K2_a8iHHMKV!0N8%kw~XT?nU`^ruGIal5M|VLp>>!iI0%5&AmU}x)J@w!LX+?c zSxX%TH8!F$PTe>Ne`VuT!W{7(zV{jJDzhOQNh!fZNB^crUePV%6-bGdKJqfmAfDw( zlJwnTSNhEDsX*$q;+3Zw&6Usur{_1EQ=jXmlMckndizkGi4{oVo1RbL{LODW6Luig z#J?Gzul?SVs~s+1NV0tmeO~~W#$jI0@ro=DwWpE+A%@2cCBlJX5!^A_HB{y+8{_L* zftadf)f{f#$izy9b=>T$7Kiq!zYNOrd1uCRB9h_RGjSg0c|6Cfuti&Y5+opaw=IM; zzjZY30_folwJCxU$s7g^ymh^eTN3XJ)v5cxHX%u3o%2^L=%U}ekr?9d>eYb%I^Y6S z7Oo3d;JT2+gp)~lIyoJj41*KFiE=Zxh-zjoB>|F8=wg)Q%L_HxDK5%FDhi}fZ-4K@ zaiG(BE_J(ZWlO&Sorw#yQ4&A`LFxO3%Y%|lHbZZc_wff8_5-yZ*2%=q@zllWL%(l1 z^_Lxh)_z@#;;>ADXil%(8vV07$5XQ_-gT;B44Q=S8DoB38MkX{STUuUi?H~Rn_*Aw z9KVh+BUkrT_*{8CF>(j(uwp;VqMkZQlOUesr>$e#v)ObjT;s@!gHrdXDG^cU0I33* z?rGCBRMsY-<82@MGjX%6gWGuvtM-d$Xn5Njdfcv^gxlF9corsc2+{zrY)QK$_TKyg z#fQFc8eg}-4TPrbnD2RxS$oFASfG?|W}lw1K;aLcM<~30T*XSt;lW{LnZtX)tFTe> z9up=40!rlDP4d>0S@0&}2n;e29wJh$!-3*gF z1BrxJZh8GMT8Wr1B9F83nwq9DFgTgI0$<>ORH=Mk`LgDX=d}_{oad?vOad;$u4{~8 zrg5Y`g5x#y8BL9gHgsU0y=dm~>{stL7?=$=U$A)ZHuH$GFoukRKUgKfTKXHvr)a!J zvf6XI4o04LaA7-NXxx#G%e%(sX8RDHG0tkmw6E3EL+`ep`#gDG_w}dqu0d$RVU4*c zlBk^HmD&u#!ZxX(N;XGm-*}Gp+Mj}#udpkjyy(hrg@>5a6_sBLzn1trwSQX9AxNTQ zDbV4`O-r7$z#xjzp#Pf2ahfJ`ys~tqioqJW_g{#eYiI(J=y=sa z_yk#uIEj<+sZEW`lM}_>YJ`k~g;SJU{E6=(vh8I(zBf<8 z*WMvSwn6$TGYDWS-NteY?nkL46)Li0nATOrWnH&$-30E@N_4u0#;mn5N*=0x9CO$< zykEWz_|UkY=U-qYiu(rPN^CALM2ej@k^ycPn`OSI6cDkK0`F4`2&J{cRl;kAfWVgy zt0+yM<4^c^ZCuB9AjNMV@iVa$@Zm4^a^c071{2Bc6E?AeE|v_9K)2dsYI zS#KbI5_qmq@YdWuWNI4eor45F21~Jd9@{(c`R$u_ zt$xt@8HXURN|iZ~qb!&)gluYyuSweiByEsd|P{#uonCh0uyJ zo9?owwL(*OysbK1@J&a_8lA$Q;W;_7X|+(0K_GZA*%`r(tgrjT)(UGC!d$r^?63dt z>}aK%4ghXH!akw7vvd4hX<>VI2M=g$x@qCew_4-8ahyN6@8AQy$|#?le8t!k(7|IJ z^K?1jku+G=wcgS&T7|7kQP>&mHc%2plkZF1r_zV9(SgoW$y)^J8e>XdO?83-K0 zRZqa&od4?&o=Fg$`pWqecGMSu!8HKphkj+Z%gNTT)}PwB#gH8P8qX{bi#dMUsAg|| z1C{dC%)rs+TJYMemoz(3;J?i~HvJS)d!>u9uKAO#3wY;*HRF<^eGz4pdzsmmjeC0S zLC>O*)V^#lt4yn0xPUI#V1}9BNT5K;>(a$pV*B6n=Nt?l5DKs8)vrF$8=t!;wf>zg zvi)ED?=PBF-?B3(@Tx)B%E7XpG)&_Xd>{B?J18cJ?b+&gjWAp{1_U3RMYu@H6Kjcs z2Xy92HoVI(T%@Vz*HgySEBek{M}+~R{aPT7FxXC@KEalA)o!hY!Dzp&C|2poLT#AK zOkT~KC`omt@9DRWA+e03cDmApF$CjqrN5S)6Y(jklkXtcDFjk}t6)&!D7*Zp5Ij&{ zB*Uhou-{=CbMwN};fh@M-ksR$y^~_AGmFHbFaN@BC+FF4m&Gg?9=H`GxR>X6m8%16 z&ThD9KtN(w_+Ta#g9gO~O(N3`6BRCNPqsAeoB~lPE9ok)l8*5nSNeBq!^L%uAIYKD z%ywjl^q`@ES-5l@lQQhN%nVLXY@5lRJu=YeqV`%Q5VATTc})f1vGb+h)!^EA#f{sD z4Lj4XiO=fDK=*&|Z}Y$Tr&DGle`%4q_Y41I*FW4E?l6;ugB|daq|7LvbES{Pp8hhP z;1%;6MLMxkPQ|*(uFk~%GVA2*%@!fnFP*dj{I!$Ty{A1vTp+S2;&Nr!(b;lbgJVan zom$dWoVN1}WEcM%L5`z<>PPX}5);ywvz0O6W!5vONtP0Ikq!89VDdf3^XpnOhnjiU zbyvHGv)~m!?tNeCsk}3j66h|X5l>jvpI^NjMvnAt$yR1F#93dV9i~A($Ir|%SoX{A zo3+%&qby|vI}UmEoJ(9uG)3%51zYVEKNv5-?kEAu**BA2iK-)NHLg9lik;bgBgPlGt0)5|hEd(4rp zR4Wm9cQuDk2vtYBl{%E=CmW`^om_-R@A*|4F!cTX>hB#~eK9;>C@T;g%<-ax)ZP7L zLxWG@5W*>jJ}8|^P!X#z@C03mg+A58cc5rI?&wZPp*jAE9py-c@tw3`ly$`-%KEcw zX*mDe$9d(mpgg-6IENk>07|@8=B=O2EX$e$N9t_mH(dwQrJ2z!Bthe-j`?4$&e7%D z2|z|djx0L8Vb=l5wx=fefAW31C0`@yySdFafiq0pO_}CVG{?`f7|7X0gyDE@13sBi z^Lxg@BXc6UK%Yv3zk)I?y(eUj)o1v5)7!L{3zhld`zg=)&hgTOJlNMgOm>EK1mFbm z3e#esPQg?LWT5nFhsjztOsST+8j5Pev8B4s7}9+}g&k5}_+<1pEm}T*kz@1I5AP1l z8JPl>hkJ8u!VG2%Y<(7`fz9qZdlFbBbt_$5iQLuN$IV!2?ewiJj&>5*S_w7D0*99y z+YkEN2XTn@;t$RTne9_)YO+h;4 zwYuBKH{U?<3-hxSzZ+iNmy-Uzd(nh7ziJ_j&i>s~K?VI_zvhPySo40uXpw|@RL=1# zEC69>U7^`Uvl-=E(bQt09I!xe!nF^x3{PCD%J|CEI8_p1s)PY&;HGifnDpf1I(=jN zp!%K-oh}+)P7}S}zLL%H(m|lD=boo|pSVn^-eHob1C$W=eDJSaBM9saYy8e-h{)3Zv++No-U$;PSSj^pfszlYw_8lhUSMMu#BX3UbQO=~)DTTImW=D)B7V)qZi zmkl>8Nel2xbG%kYRPAX4-d28#z@>p!U-?S6Ojf*+t%tp(8s-ZaE>05)rQ5XtRX0Z; zBu{Pwz7AJeE`pnH`)RA;-!Tc(J)MqlKL&GHvXx|`vs+o#Rl^+ZiMl0T228DK>Zay` zQm}AiNY*MCHL6{FLR-Lv>v&9Zt?QaN8{DW0^jF(4<3iI_ZY8CpO4`;`RY%#R!W@ZjfABMU!xoz% zK3|NX`0-cnPV?9r2{K2nrHMx)N+` z?W@Moid1Dy^&I{=SG-T`47IMd_3H%5hmRrt-bo*fhu|q5)7U2rgDfSPBgpL}qSVGv z0Zrnj+|!ok;Dg5Jb?5M|av3y_8x9wObfxLsTCI7mU&tFT*3@6~_HlWm2nOYiFe&;T zPe~C*L!&Yk>)VaHyfL-w(a<<0wO1?CQ0}tZHM*;01!LqLQR?6k2pqR9uFdzoZMO`2 zYuJw~g28JuPKz`x=6Gc`BG}`{(c~|ts+v*9Nop&`h^aPyO*Jc3*WwS*)FGoW*FaxW z>Kn+9lWUG2CBFYZ{K0O)@yJNSA{^xVQe;SJ;{H-#vzuO%Erfb~>f-U0}_8m4_<*M4yFm8`^>d10_CjyBDSR_BRlVkLuNjXL@TvRH& z>VL3}hVM84%Ka)8LLxwlIbKB&4TTSq%1Sk?o{PH?f^Wwg2f+l>9V`}fzU)x&3mcDVHMi?zM1D-keU zi!jy)-A%oCVf@;)&ELV?!B~D7uN{Qhj#o~0 znxckrmQcB4Fp$gTF{W#rM$rIC19l1WoNU$B;VpeNm+Rqo_73llTsvih(XiIPgVkNW za@bA{t~^`qTh+J7?OW$ZHYvZb`2zvv57gLKzVsY{d(r3`2aS?Rxpr&6r3Ujw_{9HkK7mE6cE1#kT-fGBm&SMkfHe`H9^{JDqTIM>Y{2dF|_2GM;0v7G9JzC8m zTEkiFU?2;SI(U_~?^hUE!@l(->@}~dMcdL~j)n%q!?bJaG3N{3V(T@C$Gyrpk`d9y z{Z?{E!2CJHXFv}u72Kx6Z^-rot(SB{b4Jo%OL~iu#d2s}!v(YNJ@YQM&)c@A@x4-UD#Yznfy6X@D%%e17a1 zcC+6<20*w>RO-ok+~}a{<7j|!a9GQn2J~Hx3r#pibuDXQli?vn`Id4B{ACqfr)p(NURG-~1#S;FG)7t9;Fj z*L8wOQLb2{5L;^oF3j%)<6Oz^2}$>Q(<9LJ&U!WDi`y}g;w9Hope z51Zv3GaM`S_3!T#lzi^*O&MJG%!M>BJ_UB|iqri?T@GS3EX_kzj#Gr5MY0ln?x`*5 zRK+BI38xm&qdcVzyfj83**Tcl1Ik|04Qq=oT?7nw+`c=}Z|m4m0Rt0LnYxvJ>-thd zb;q5f>(;9gF>D@=9#9J#$0t%1od`D!sEFPE4tzfUENg>r8pCIK$g;lbrohFVuB687 z=`;X#8?iZTE=_9TZR_~H0yoQWuvD#`O4W|3o`7ZyZ_-All zipzE|dd&okN_c-{jv?;C8rwYnFtD7)L+}EbFFFX}eq)qd8PH`~cn*AG1nC^?tBb!B zu-14WZdOeT#^dn{Ee|-ASc%2-BfrxdtPB62DUS7>REkb>^`Ej-R*wBQgXws2d#;Mp z@yRUO5Ls&ccQ-x{{x^y2*H(~yOmFKQWRny5$y_DjhWL_?PGxt0b)mJG&!2*C+7H_a z^CH7FVnzHt<;fsD8XD8rQS$)Lp&@@aOkVz^^5mx#eRJvyZkys*+;VKE59~WGw+iTM z4_<8?;=jHuISOcKdTe)-^+X?`ZU8idNior3H$kgY3VN{*zs%z;cQkJpB4XV(f)cAL zYKGp4$4x01)j?P8+kd&k9^Eyc!XE9882*i`sMzlN#_6+ic=BitWXpJtS7>kFJ^YH> zfM8K@X=Q6n=U1KSAjEsRYY!QYO-Br01|XhKB~Hg}SA?M^nsKngFTw5DnH@JTZ4LCE zzL{KMOEtdqSnaf2xZHTmZIxe1;mX>8dhx63P&d=WzL~#S^bFKfzH;@1{X(YZ-vWkT zj%bp5ob zc>8Di9KCn`z!YbHcP_>sU$Wa{dCZ2#`;uilb1||c&E|NeVK`vU5iL5phE(3xJ`P`{ zTP6Jp486PgD3v3ai}5E|@%9sXEJQ19DE@*F|c$6wBNeCX4^aKWsSXL|hPB>eVNDC9wug?&<7 znGIyyz!!8mcmc<)Xkba@%gKvAb^q5VWZbOdrclj0`N7#Ms1elzy&rs33zsh922Xi@ zO+A@>E%mg8-~aWMg`c;w@bh{zaWV`~oI}MXeeM6pXYJ&ln>Sf~krT^GS!P){6a{c4 zSl@Zdg_7wDM+t|fK6skfBulZzk#ge+UHc<9$zxk*yRe1pf7hQ|z{)iN+ZmNq=D3mQ zWycurQ8%?{RqIu?+g9N9je}pDTC^&#i$~s4a2-%+p5p(Dh5wtagPUZ>flW}%%D!z& z5{JP&iS0P}y=?^RnsZ3JHN(O2anW=wGf;a)<3sQOEFj5hxV2q-h%HwqLbhsezjCP{ z$gY2M3d{KPMf`o)t+q@tKLE3RW%4wPqhe04!Va3Tn(#x|NDip|uC1jnD{zinc)at# zI8qnjP505*F50kO|M+4mXZ0t$eJN+Na0rnw+_$zj+euvu^ErNI%MF#Rq#08UtD;H? z=~P`yY1y*Tm8acygADdDSEc}pKy|;|>?Xby>;6G}KJ(1kOdU`G*Tb;Spv}HBViqLx zG!NpTQaHyj-{+DuzvZ4`4q|5-PUl^0~m!7QL z@A~I@ZZ!S+6f^U{qKfU0#CfwDAANbh^tTKyeYm?+7?%h#=Xe$NScRdrGXW9uphH{7 zQu>1G$=~DvkioEd{T2%ZYGxS*ttjM*+jnE7{iW zH&iL>IyVDFv!BH0Z*AM8_!kVqn%Z`HMQ;gnFp6_Hrh{$ajP#6XWevv)hR{V|w?@OD zu~WN}@$m2tEqLZ{AD`Hpo!E^RJ=-q$n!yF<%LONpru!QZM>Q>N9Fkav>eDnaLxJ4j z20j6A8YQ&r2oLJxp?%TGic@s;*Zc4J&n9JK--w0&0JUj*mK_py?*Z%H8^x#ejfY{8 z&hs#`zV)82xE&-Lp*_yQgc^uATDcH)ID^aWIaLcMiD~ULvgOpA>l>mg?m9Q#f12$y zmbu_VyS3kACng`9FA?SmHr1S7*1OzueA=$jrfJO=xiH`uxz}}%Z6q@rUi>ftmYt3^ zOtPe5zaPgMpSDu{aAIuz%S89G_npchA~Jm`Xl40Q!4J--2KPS4et~AM9K{@g(3bs_ zs5_Wqrtr&5cdLg9#PQK1(aIHd+3kIL!#|pI#z-xl6BG|v%K45#XbMXW7QJnO*jGmL zC{I@Cv9o&ta1y0zSGS1Tm~Lv$YG_pro=)SaHOgaBG%jM2C$ty9^Ki^E<^lg)5!oNYQK?_)$;+{fhA? zU{=^V=Pz5ta!>o$M91DXIwiBmE8IVp3xN~J0eY>>&^migrqr$DtIA_l<5!LWBTdp@ zWwaxO&>-#^mp&X#cl*$vBbbv(H5gQl@{vE^twb3SI>K`0>hGC*_=`y}&!Q+Cs=<(s z;>N*AR2B4h4M_;-XwTF5Pr`%e4Ok{e9JWh7u?FLl5B9^^F8%0~#8BdHsmARSTLKt_7XByVHZe2UA;D~I!wmsU4rN7wf9px8I>R5aC zqJbVILY-LDZN2UQ4EFPLvH(KyJcI1BLYG*x{4ScfP9av;2_dSkL5xr_(g@uKku9fj zF9tt#r$CuBl3}aV!h0Mu%|^qn4UPCWFSzax{7*E%?*1NJH3V)H4RYN{5>P)!dRZf$ zS#-C^Dz%k1Oej+s?t2x@r9h10QJO--;HjT`#mZQU%Z31Xi&-$g@egcW`b~oX#gC~= z4~jCLCqbDFPF9s&2XoC>=Q~{uF#Ilh94fp1ESq3+pz_;E!szfyhf4R*eJWB`e4coVqIes%xSD^121&&Y>!u z2LM-WNW6VOk1rksVE<0;Wq(+xR5gul%9TAR_u+PPAm0k^)W(4Z zpd@9`;HT!`??7G3me;9LW0fs?q-r%*TlST1@7=O3t9r_w z)?&?A8p)E3C1Y6@!V>bnvBcdJP-ZbUge};?2MC8l2sm)S1Pq9i135qrIDrI0Aei-- zEqDckG0OM%z3+9;)9ZeH@4Pp1a?;Fw{bo7H^}VXU{{Q>_<)%Zk*@O7J_T5jI=||qm z@$KwY_&lbdFb? zM0Y=M?^oRSrZ2m?$nSpep;yyCnO%C`Y}R;+IaO)2biJljzOFR$BzG0(p6hv@uT804 zUm2x6S(Zi}Iq*l_a&&h4P58V7pX2x(J36}w-@ioPS>&@jPTqOzt+U%t-v5HLX0zLG zzW-{xZa#MBjrYIm?i+7=;9t%qf-eO)0#`4#~Jfvig@-5t8{7ByRwUufgZX?s+`+<{R3*`N|%RJKM|a7YT>+n130rq8mI9buOtb!;LN+D{!ZGOuJv(<-BNij zHejV4$8cq=7L})@qpjmr+6vF{8s{;9FwZxG@GoYw+0Wwhtofl?(Vp$u?288>3|a_} z-n|HmFi8lxY*8fhEDNG-+@fq7w-fkZQ2V8?x$hcPOV==A<)x>))+p=Ndhv5ErnSE9 zO;--D^)2_m;mvOh9tvg-R`-Wk(B+?+VX-&1i@kR5#YT%TUeKuv!#JO(VH9jHHtp=! z?3~%mDwhjpanwBb67G1C)sk0QnTm@FM{aPnv#A^4o<~-o9O{8`2%vDN4i zaC!J^A2$IP2_UY<+UGDE*(2Ar2EH1@C0OASgeh(eR3ZZ{qA#_#`p|c2~^kk5zu;@TK_nDGF zdf~-#0!R@+`Y?d_6{iE~_6Z_r^%f<*Jbj_^wjLTRpq^?UTJpb?+M=#mTUw9gT zdn-O4eb*Lvv)MI+;Dx(ha52D(lCa3;Q4%Hjw&e;t&+F{jtg0&*XJKr`B#x`K%otn4 zetoNKD!a*!>z&gPvy}uYSZsE6eG$-j3qJoQ-f~N4vlk446ZOF9b{2t?6?o6_wR5G? zU>lr|02~9?z4U}~jrB_H;V62(YPhnjHjQ_ByJ=+Cq`~I9<^(?P#y?K>H0RNlr3$k& zCQAh;Xr6`Xqm22YHRe(@ep5M4B^<7Wt0W*{5d&n=I_GdGP4d z2%9^um`$)p6v(_E0Q~ZQ!=2aq0EcI9+Z&uHN<;Dik{Hmyj_2`q3=@Ql4x#g5$)#T@ zQP#DzjkUJG)bZ zr53)Zr6Z~aR0nqj7!T%>xfI$%v}9d})wO32%w^g98Truwh0T68i&a4Sx8HgQ`~7%p zTy7fs*#x@>q`@ML@_3F{oNn*;taBJYdJbJmjLF6=nI~#rBQ~vIVnn0;l9wJR6Z{ak z(#;tIE!!{x)xhh|fXmk;6qH>z&etKh+=@W+D9s6~C`AMsL|G9IkaY0>s@m3NQwvr( z#s|0LSX^1WtbJx{F8mUIi?_DiN+!*b1Aiuxbl?1gPbV1ZwYROk1;E`y{^Dh4!!F#~ z?!8x!;kXM+MMKG^}pXs?A@VT(8#&av4ia zq20e67`z!D8=enH?%l)V&UX zEOiNjt#nLjT)%e^x9Ck=l7G9#}tTc7WE2s!cNU6-h@BzC$qZX=n9v8P= z)FS$OXHBsD|1ewbzMub=3$XhhY9W309+2*~`_eECg2kL($@cDxgAQK&d@HRXXO*ng zwXhLk@V#sIWBGBg*?vl~@GmD8;McdT(c#(6lNR5(Tw!aC(l`v~cqNODVd{?FrC^wh zwURC~1pbx5Wmj2`Ti5uu<+i1xY$K%SS$kyPpD}VN+|2R%G?4jIe6HhLgyw8^_ zHoJEM8gZDkcTpG?aOlFKyNfzwc>;G4cS@!kS1N_ehm?+*yPznvv+0`MzgQ*;*e5SnmLWH~!RC>&`uQDUPRNtHJo5AnCm-`qpk8h_p_#|p)DGzJ>T&ZwpYXbHL0yN zSj7<-P@d`Y5w`~DL(N( z&z3Cd4}6}Kvm5ttZbn$rxWH|Xui22F<9HlAvs*T@bP#`4K5l-mIv77^9mn|CDklB) z_Y?PiPrDOdF^E7q9Fs!&2;k|Fklp1PMV-e3+oUA-OK=v3t}$W32)PK@byFJwq8L{{ z0tKn+64VCB_f7Z7X+v2=n?dyjg#r+m#Il-m?#l%^4xrz``0S(Zfu+N+ip zcB%GZ#&M&8@2Gv#IN;m4XYk#D!IAc?_0P(dYP>f;GU0GtypkY(>Cd+g*WsBO!z0-J za3!R<&J#G+oh;p1o5S$R;2?p7Blr9>XWuY`ZW(^A-5~ zi(ey8=)@j2INLQOjap-zMHzY9SsX1MWsZX-WyrLsq_L$2{SU%b;G`-22?Zg4Ehk`_ zS|7(JH&yHJSh0predkkV$1eYd_6)sx5R_ro5DsdRM<7!1E;?9t64WK4PS9iuc84iY zV~UFg2C6hwqZ%ueQHo2=RnwGB2}XmTIfD9@d;We3NxjaFdvK*YegALGX2+HX^3VZ- zt1Ainq)Mfl$_1j0Yy?vc5G}PQ6~w?2_aOuT-8l4PaP}=DU>sZk+ktyQ58Mk{a8-CL zOpk`)vBlBFvEUefw@@33R`;!Tv+>V@*s^r|Uq1$TFaUTQ#4+TnI7pICYzeyC_3-&{ zUX5@7q^Y!37EXq=TsB^fsIk^HtMNVl#4kPWY8T%qgP)1x3+K!Pll^BbuneNj3BFtL z`IDz~m+$R^P!}C#5fy|m0;+sY@IETyy7Sx@N?iME5}0|!36iHs>D@b*|qQy>?6*%`{d`` za?j`Y+1I&zm7)0CKZRJ=S;aJKL&K(iqEGm>+<@aH37Y%i0E=G!bLnU!nmt{>Ew`C!Ysgdldd()Z=6cj zjms1}?X~s`JwCin;4W9mEbl+NOJ>o7YmG*dS%RVa$MI= z#WjQWW_@2O>1*~FXP=HmMPa%b_J1>5p5)K|<~caYU(#YP2eD5Ev;CqViSlHQSKN6P zQ7`@^JsSZ%vo)&}x40R_wWqVy<~8~X)jGQ%W0i)5>o+8 zmsQo3DSiY;QCrRwB5Zh2FiyOYBv>Q7Mqnsd&A~f5l~DVeC^U8?dl~ni{k^9WO8-2m zyy5Rwy2r=<`xf^&n_WH#Q#Po31mPlqrbe%#yV^QY?RD4}zzXz3jZFdh8g96>lWSqd zHpqr~@#n1~k#B#PqTSou6A_NBJlMTfDuf|gS}FvzB|bF~iZ#eZ z2+@{rP?0_+er-s#l1K9fe4cnwcT|Qwn!K0b(w1{#`2k4zj+5Wv(MVU9C3k!czmUVV zk)?auOYM6!fA#IH&i4oJzi`5SC*}AjupUOGtKQOkd)3%lw|w7Vnb4BJEZ~|B26D$s z*9ASSg^{Y{$||FU>$|oVSh^{3|G-Gd%J{aFmFro328hm8ApegO^2g8muGTlaW|HMN z2_&hY{+g}`_|X6BNCL$U$@6+ho=3dV$*?#Hk~lh+91Dt*y^H$nb#Q&!Dnap0zuzS& zzF-ercTG^t7a3SMdgaNZ3KfI4P!WTR^UA9sm%+8%7KApcA{!wo z^JB?|If&_sqWs$DUNF}(GTLkdUI_>IR&gdsSr>$PyzIE1_W<<5mcUjRR(G z%yZhT>T@iGG&`E~0FxJ9PJn&>H~7R1BZ~T7dSO>~9qxhHZc$&hKxjPA7D?ASWQUhk zGv=A9GNyuu37r-p9vpL}^d?wL^0L;6!2WO*fL!~8jyJk=42R`?8Dx1|$PngvFejI5 z+so>>ff@e$qSCc=xz$Se!t(kwRv7h+v-|QV(+Zz)(UeSSN^f-WdHa!WiTCWiM2fj0 z`U&R?{D6zaVkjxER-R)kDk2A`UpaLpL|qEaK!-R|LYb>7=K8{b@Hg7H>R=Ox_QbKD zl=q$`#rU2{rFj>xl%&rsC|JK^yzfjJ>}snC&@hYBJf7o){~KsQL-n}K@qDAIS~&2l zw5q|&`mPJds^+KNGi!`+i#NN<-nh#C{DJo#nmvD&IsDaw@Ps?FKLcX<7gQ`;#BoO; zb$K!$Ar0MDwPaKhZjGs}HcZqlA8UOo(yy%RK&ixEa7i485)3xlL-21u$xMAFO2r@b zY+L;iLmmWaKZRkfRMExi>bvB}w`u_n&u$rmJvim+3xY+IQm*JCPP)r4>P|Q=zs8|J zQ3#RPT1U@}Jr?jjx@Qrg8S6W!1?g=XJp4Q-BMDHf1}ZQ~O`n5yZ z?_f7Uo?BtsPHeT(41DkcCfv!=edfqwT*Q>={VMSWrh9Y;h2@0*Nt^*cb^-COk{i4IdU&r#ejeI5UkPD zU(@cKmkmOe4)#Bc^DKg#hgY0$-=KNcC7M!qEu1gEY#PV_5XKQdf7X@22qAUpXj2O5 zA_(-oiq-CfIB;_Y;+A{?|uEV!yHl~*Z2JLh6icUlK#PNb>D0y|@c1KY$;Z zZ+z)hZljs0WJ8*kEycd9xL^780=Hf9w6==(9$J$__b>&auf^vZ-%7mAP3>uX;TX`nD8>|S6=@I^^CAtqPF!i{^?#h& z<+(l?FyKl~n~?GoU zrU<*l(X8V{J^*)*v#OGc1X{)r?K_pjm2gDK@x@j^nRBs^t=Y#sz24!y;nFt$@dw{O zC0M_L^0={g{f zDpTpkFHPex_p$42@wM-3x6?OI(%dK(eJ=II>vdH2YEVBS zr)R-nWnY@*aZ$|iN{Vzq5%x+BI-@L^$H8kjz7_C-@rSMfEb&^k}qUi<(cb`t$tGd87c}Kc0_~g@g2O65>`_%<0utBkxGgu<&p2%X+T# zge?UR~FbxGUqC!6uf+EpOY; z`5L>bGNPy4W1&xsntJ6ajzZ<*9l=Y^|c-=}<-Hu=lP z%hR%W*G=9Qz>tiQ&+&?~N7t$?d&CQH!LfVUdBoXp9&wVjy_s?61Veemjj0%8#&>+jRjv@c(z4RNa-6G;usSzH24kC}3?xqjm^B={8CSY08wLprpwpVzB z3n`8A&ODvk9K%>sapq87wn0b@Hm3F^WBa!5eshfZqU~1nPm`<^9a|D}p7Ehh{Q8oy zb#Hly@CuiWuv#kxnX%UtBkY1aoK`E%C2r{x&jN-@LcU-M>?xxh246wjhA`&TtY*IO z`Id8YAk@OhrIsDbdzad8vsMc`arfgUs@fbdUDZo7tp*|7PBRVixNS9)6j6#Wc`;O# zWt$SPaH}<|z>_+@Uqdv+;dJ0-LsWzXJk!My>1QsSF6-R7;*>vn(Gx%@yt&yzZQ1P{uV69QY0NZ?+1hJV1$EU?P8A*F; zr?GY1O5#Xw1h7wYCUB(rqTjWx^`b!<%#)z&ZM=gcRmO*GElP{?%1Y5#X_?uV756#P zOF!SbRP`S`W5QPY1XlE$_?-2)E}VVt*owDH)V4Z02lH@I#M>+G=#hshp&O)#fc^lo zlX7q+H$E3@ovpD&_sq)^{-7P!bn&F~!&j{e-~H`ftHKu!F8a}}3gJE@il9Gh?`bfR>yHMUA=01dfx3F=>cy^Utb4GAd}2?>fA}*tz3&5!v4EyD zlYc_~<%#iB&OGZFfMruhnn94aqX@D%9LV6T1!4$?y3Ju5aWHpG2_*!a2dA$28Oh*$ z;_qKH-MM`8s-5vqibEjcUNWwM=ey53q0l}HC>J9OiadI>0={S!aH}Ef)HFo^^qX$S z66?~jmTO~$6fU?CgJ=Z*prm3Ms;wnj(`u!q)khw~XOxB8FgJq=+bLTr@w%fN3<6(t zz8NCBwg(Ar$0F((vCfe{Oqs-$fyYIhfRdh4IMcG!LV54p&&9_*&;8|3yLh@|DpnIh z&;Q%5RqqS;Sp04iLen59!g&fxE*^^aeAbrxHNq{W5k6u*xb?~!1xCqKr<*1=G2UC( z#?$9ldy{zwZG6$Iz$x;ejq;*=9^_rugB>>BdcwMNx?Cw)C8U+Q);M_}!>utOikNYj zq+ES?_Tme|#=r9)+rpdYP1;&CB9tQLi+efgdJw*#-!!82JL52?-p@lVZXAi7BwVM2 zXD&-PnoPR@k?2Y(O4+D=Nh+Dx;^rHd6-nPXsUqodK;j{Ml;2e(MSB3VlbmduC1hco zEGXGJ>2gbw?iO6oslz2`4W-&OjcPm}^0chD?^M_BFBr*&eBxaznfe{qJq|?em$zr^ zwPRQe6=)-pD`>`Z6!tQ|7G0R~K^h66;a`_dQ<8XDNvohk)lj5d-)&%-nAen^1HTKw z9e}dFu{fA#Za&c-k@AL73<)h182`|P-7$R8Ai`mH42!HKXBN?^={RY3y`7+JenCSg zX`}|eGDTI%@JzX_9oNB$l+5mr*lY&^YIf4*eDA8&ilx5SYmg45A1e}0>d;3iaEX(9T9VC z0X+Cmi7iz+4mG-`9#l*z>@^8Sp#-l050xV@-0yQb#>t!pPx_Vk{P;OtZ!urZTLaT;Xt?y%0<#VAkX2<$GKxt)7%KZ#;xd6 zi4AMG@VRjh((sR+$lgu*tIHa$AG`ZG6Hg>{CHspn+sZMYjhx72u)kmtMn&6Iu^U6O z<3s{9_!JDJsP$ad_*QY6TCWh9iQvn5ITlRc8uAH*yjBT3^p zZb{NE?2db*$=k_f#D9W?_uQ%xkbynd+lQsc8#bzS=BCg^ghHh6S>V_U=Cq&{O`}1aEAVTHIDA8 zTeduckvUpL-hq+_tw$b&MLG}rW67e9dZFQ2^>Jf;R(nvaY6CA|LXPBUR%F!s=|6v+ z`}=dVCEfIgujs7BbN5*3Zgdm0yELEY1qgrvg}Xvvt7_NxEw!&v%%!oQYxVSKvM3_t^4w_vE>i6&JNNA#i@8DK|G+2P-(R1s}lT=WRBl*Za(g2C?jsk z5y6%Ytf%XNlzWWTk#!=sTUXiYKmWVuB654>c#2I?3}&lCISJBqj#rqbgDEzG=7&&z zHH{Xr0%$>K(w^hfS;s-Whe#9-aosae(`^Zt+G&%w4TqTqg#yY_JI+4(L1P#Ah8!IU z2~<7ytv}WE3oh0JE6Cb`sxe}@I8C~K!AW{ zh{hR+rr%g{DAWr0e0fx89y*UvY3fa{Jgv5zJ*DdCdqOt)_ z#J5(73KFhuj7HGqlUCivVp`NQH!#q>NX#IoMkksSi?EuFz%ci3tP^_nNRFl$BFi-pF0H_qDv7t zK89AX+DK`;k!aL>1g$RbI@s?BwcOHgYJx#=pL@_s;6zimPJxrh8HfH0MXqV~TOF7f zYTfX@c4wV<{}eqSSlOjdy|EkpeCr@q*-pDuAlQJ=mh__g9X$yQnWfsZwU0R8)~h|4nJ*lKs0~b2<>jy8JYFTScgJ$ei0l=3I(xj)uqblRKaDw;MTNLd37TsjijTAh@KXlJ5-z7$eNPnDo;3`D}2(R z4ziixL~d;zm+Hi74BAt-XO$nGefb!Q!6{?Vf<>IogCGgJ@Fwl{S39d5q$6ZZl7c;1 zNjRB}V#<0Y^QCp50mGA!%;${8nIMLSfN*-92-bQ=qnut5&{_l1Lg4u$!0jt~Ej(W~ zh-uN!t8b~6B7~Q^2%>?YTheH0DC*L8fFq78FKf*lB~-0Jj(f^6PVF{K34TyS@5G?{ z$Pcvn8qYr(Pe6@WyFUUl=Rad_)-DbfJyAU^Ru0D;vhiR>qOEG`^wv1mN}oHRcBQ2h zGyJ)4lsID}U*EkH)ZaZxP$wft1HOLo`@4FwyT?G;&IJym_ISdrryiDB*p+D%9WWoK zNrem=T_tOH7}EOKJB$gA6IwD;H(qU_uyDT-y3(%Era9(W57tEp@j`-(YQ;!n7hLK(_JDk<1wG96`cTbtl`_3urY3jddY;dk-*`Q8wj%LifV)uyL$OJ^lPK97-O;=Rrh-@q{%wBj%KIEK{2T6hKnGDP(iOO9Y|FzDQb z2bQY3j#Nu&x)kr-b|uYRc*STRk5hp-m6(d6B8j6py?RpZsf|6f+c-3XvbIj8p7xGAW2t%yEoyc;!j1VN6^t zgk)8zT#rmDP^jInhxSQoU9s$NdSQ*O!E%dtee*H!N-F(2V9@P1*TovZn(?*##f-DTr0WI zWTypgI=6)1BRp(P$PJ)h9Of}a35S--g>(Z#)I*5uI9_AQs^0d*54dmSemtX7eu92~ zzjba95;{omc%dQQbr~HU8T$#I+HIpKA{dXNh`Uses7q}5DE=S&a5o&kb|p{;!MfKP zhkdPHF2h>QFeqvfB>WxetmE?sSJ-pF!?v0zqeT5I>k<&tZha5qS_HrD*S4Vvp^kEe zt3WJ3uV)IhvN)}o4r9S^4~!4JwRN+9a4}`f>=Uv2w~#DxvSa+RJ;2zhh%R$k(lnfh zIHa8$)y2fG11{DmZLK!7DQhJem&W46nWpi?rt$BX1C?yX-CeNaiO<(tQv+tRcoH5v zrUqnbkmhr|!l2kjq`Mlfr4e9YI7Mx!dI}dPGbJv9rYSv-?>875(!tMPS@YXwTQi6c z_^^_ny+lrUJ&oo7&OdkTO>3& zs;oeCrSO7^EkVpnRXdU<{vH4*$%d`j=Bv(vKlkfIN4&a)}I)bwTB*h4#f%A zjdnOeEHEfE20=jcq=K+Fk9({vxqq3jdL<7BA;*?F_j5gGgk9)eG1XRPupW+$H^`osqf} zMv76^vP*ZN<2qo*q~j}3BJMUI+J*E^d$!$pG_;{rA{PD)Q~-JL7JGVlcEcb-`K~ux zJKJLsB}GK}4{6$&@h%+tAf-h%bctDA2}jAwI;zr8xlG9&TSI2HG;m9Y^6X3!jBSGRN1vt57?&d>gkKO$2EgfqkWwE_EfD)8OM8?&5Fx zk$re3mT#|Peh32+D_-0q8!Sq2-N<%@1&Sa-RdAdAC%52ws(&nV@1zJ#L$ zbXZtgg36K!p5#%t> zS}vh;LOXROii z_W^6&9CumC%hF*LRl7qjrmo5w@VPa@O1C-CVIS6Ab#`3DE8sj>(fHQP}Me5_vXxzKlY_nala;*7RbS3OJtO@#ZL_z>R5?5Uk4Y&p% zj;)p)B0cDu%4@i=!U#k#vZ2gKkju3v9|PB56YA^hK64hf=*iZ6Jurw?Iw%AMq$hwR zfYpzpA?izN>!$ z+uZjZXL?He#Ip2&Uo4wskQ2CwgCL#`)CHtEp1`M{|9gl z0Ou=bY<~Y%cr(KN#=)>N7RPb4nB$dnJ*jqZzp%Sr<9KdWb1+S=09jyM$USrxaie*X zx%i8HM{RHJcOAog`-+G94*5j525)ZxyKfM%aFCJ9iev%6@Cu?q_SaP&)EP&Wp5%-s zmnjBk%5QbW#+Qw+tFmtJyRvFDL^I_&Uucc4*I}^!8rV^1)IY{QPFB|cia~7SUYSHY zls1bBVjBj=EePW&PK~W${5b&QaP^&iS#N*bg8xHp`a<%gOC}t?>kln+H-7xGtx}uW zaQ;@@bpTq#3$k8N0n>RAcBQ#Hv$r4&fIgsB=$`Ah6SQ%{T!jn2asY;7EOpmy8jkM; zrP7KsG8juUS3i5JmSLodIZk)>+YhkraE`AKED zp&F~Px1<%KkrsL!bFk|`ohv4)3f3D6@qTd!WBaU^y8Mo%L+}66lmR-?iue5O&ry%9 zH??Q+#1J~kVvzTwmewI|v!Eyz+j?Ez1v4`^rmD6|x)od~u1cETK#4NaHPmw1Z-WdtW*w9J~YT{vTNClfS6*2VOS;hCE8i|4E`Em?udu z6==s?dPKjxHVj^XZeX4&rFPK7`7B+*UUt2Be^<>Q;0Yivo)jc24ilihcZ>;?0N4V}mUo{!Imd)LG5gD8hx z^?2A;?gUwga6AvffwD@RSjM<*sIM#>+nOq$B?5F8zsGSFoSO6icV?OcOI@2-R{628 zEfBxye@?koPf{2TXnw`*PX22LVe1d>P22R2ViC=YMSpBx)|DF&$1Ip+LL1{-x2`L| z1*i=Cxlb4v1W5KCXKsV@U)7FvVJ=Id>J40!jdivWg)LdAzD0e@%UXKlk6-kx3Akp| zBXqX(Sdta4Uowbm(p@ZBTMqy_b>5qjTXg1>=5E$hHAIz%ta7CQ!nM^6W1jK>C?q6! zF&qJy6soG-12v*!j$Y4R-uGYI%jmh2CbZwQ%B_FJTeg}ej=0Q8vg@#1x}2%>ET0!N zg>%4nE+NH%8)A+DQdYWBQLhn?YY0Uy1sjeAlG?Khe_0xrorw&$iN5nX2`6%uonNF~ zf{vbq=#DYv!6L>LgjbSe11TpO5;!wlmI6|^G{Ufk;|`)xC*0Fiv~|EBr5ny@e$gt6 z>8u|;1dx`~81EbeDcv=RGT}UOpW$$x&)rjp2f@9f+Q=9HujkWx`-<{2_UJbi`!x)gkDPt`Ynlb=y zGU-|z1VOLA>-i+BahG|bt}Jykpn*f2)e?GdO#{P8RL8xdfTk4GHKO+Lufdy?XRw>g z)-&qr^hkxZMr2;UY72kKAJJAlG2V(J$p+iP2Vq3jHh6{Ih|C>5IVxB__~Z)Fv29$A zeW^e|;Uq(S&`{Qe>v+^W&BI^RMjy0=oY<3No&EYGAo*5ugKp_E6w*m(cGhuO%N3(7EmKv3fOboIi`c3s!UaV<-Y-$Gy52$>1b z7qyT}E%I0AabVVLJ#?dMN5*h|h?Lf&9F3Bhv z<>1h<%3Il{O}EWhpl~$VFyH6+N(FuJeNUOa_>pgDosKUZgr*ow@`QL1E%J0u?;!7N zdDrCTF!{TsQdW>(p*-m$UX>NXE)Ume$voKivNE7RK~t42Rd5C*y)kpXVasglQ*|Y^ zlKX`TeX5eK7qZcZ;4_-rmL6R&>hsnL?Jr@L2QjE zOPNZj1};U-bgeBo0Kyfn1gK-nv~!wpi5;`n!R2GCX70DW>(DGav}8*z8^dKQV^qC#&&kyPP!X*f&V__APGs^ zb#>eRS52DPu}7*})Vm8WyZ!v>mD^iuJ?H#wY2na5uGRBBqdm9ubUQ296_4dwFI(xz z-}S{$zMafCNK)M$6Uor z8h5448SUV|&VBUzG(L^6cw(nE4YvEq7G3&h-ll&>i!7p)pKV8dN3$R0_(po44}d;*p6r$2w8(=K;|>0AX+iLAZ2T=7SLK-Xdt} z6y|^sU*mKjr(Q}~L+{a+!KFsrYY>&x-nIJ$K)hktf5plxzT-1As!sHtIzN&;&xL)^h<#CU0{GOM#Q_{Zb zzZ{xiY>HJ^i_ab38WT2~og7^HNLPy_NMg|0NsxAzZQgB^YpKOFZWgZ;wJNn=3%^uc z`;1q)8&|}Om>O5aLDCam zy0q}a)Y8Y4P1*RBD=Lt?xCd*+p-@9IY`Evy z(@Ef*7zwPi0sjxFYG@>m{r~_UiwFb&00000{{{d;LjnMkJl(wuv?W)09(cO-=GnU_ z&<3O{?NZq)Bn~?Dt`Y{ccW<}_=!MjXmUuJlF7qfGYQ5{X2x-BO`H|7JUAwPtgr}Skc}}oHp=(cIrr}Bt6O#JoW8eZr&ga^ z-7Ue={?6Y2{{Qd$AJ-h4&5qAzv)?>1o8^za+`%7bx8U>G>Y34>&zxGEx#Q(J$@4RJ zF3#L~^2{R2qcC|vcw-WW={$+c@XR~zedm4O`?eeLuRQSJTNZd`k6bvLxvCPJ3F9~} zb6Qt;N(9lWZT*sF+V-4Rrf@cJT4HP%q?2%5v~YYuW2OCm%4iEd_JSwr?kL+|6hGB0sEVifZYbL590IL4_r9Y zkKNM&`}zZbz30p;l)n3p(+fI@c<8E&$|No0IbNAHOJ!_9h8@R=3#9M(j)FyUE9p8y zN#)7bla6+4&Rpp-r2<_E#o37`3d}OLSiT5H09f9L*C3V;z5Btx6g?QtE(DCv$LGoU zY*wyLVm<_Av9Pybm=v@}lSLWL!z4_0&tjVH;`dNz)`jL$^M(OP&Y9#I`xeKuZ8r50 z#>{(aVYv16oi{MQ?f8T(^$o0(O#J*A_Hw&n5QngTxsiEK%5X7H%5)cn#5zr1!}ow& zpRu~FjTFqsA!Kc1f=XO{cq>nOevsaJPIs+;c#0qNomllpvAUnR$gcdh2`ew6H0pLh zlF!35+C4vcX;*$>xAI22JP;m}9y3C@N;|UloQ4_Y!*i5=;4t^F56+m!*fTrFPj*PX z>?davkov^v#vaS>$$8$>ru z!5TPDP0Ot{7maBfSXta{t*Ha$8pYe@3ECh({X?9P`u3!IDF!qz1scEi50A}W_}Fb7 zQm-CFD&CE}$~X+W3qMSYa*kJ)$Gc&L-6Xf;glfTY`Di1nz>^Z&#BDs~E9LuAIEo<{ z^OUZXQTnE>qj<&wi{1vi=JX{5TNX??S6=}v-vg}L(@&l0V;|^X+Zu!|>0sM?ofCdV zo@8-6r&kv3x`x)t{v!U5jmv9?PL?tZ;n;-5jyQ&k&F)-U?_2TTa@nsOhx>Ah?8vdB zS}#J)Rw&N|ZB@evAKH5THP(9r{yQGP=NJC##aQoKI=gwx*n0PI*XXKA(mYGcIbM03 z4zLp~0&HHl#&8KTq7~9`N4WyA6R%}!R9!Kb>%%oB6WNJ%wn#z8f#U6_TATaYLC7qJ z6UQ-y4snu3^Egd*cLjoo9h5!;E8;nlJ6;_KYxN;P%milz><@^r;pHOiP@PkELOWdPLeL# zS!Bff;+5D~uiSCb!r9kgT)D4Ud^*aAa8VK{MxTvpV!sK z2+gLV_~yq}C?4yfc#KfYw&TJAdAoOvfc)$aTsi^BcLBt=pPY2PKMfeX8K3X@ z)eGQFo*rkc%B<%--+a%`#v>CRB}IwI6t@{R;sAMtz2!OJFL0W*K~Uw_tr7<0vS~KG z;3tw-vo2=rHgY^?AePgG;98%Ez8R0ha`rd@nvf|1Bs4kKNoEp*sd~Dfcr%A>Dpi z46$dPC5v#^y8?r@3lO{s6KIaht<}Dgj0IrRJ*7-rHvx2b)yS&V61pL8w+{Uo<9Z?s zT=f$-5OBqm3+#0O>YezMpSlQM!pl3~07pwbc1vgOzH1P^xaZW`V@)__X<8)nEX^#7 zkS%tDgwMjWXrbrd&~o^&#sxp8+)619x!+MZ%fapSm}GZf#d*{T_F)muGu)Q;sM?M75RR(wv9Ba^9hX-KAQi8SWL4V+K69&< zw-SGZYKWN0;j-ewRqSZ^?fvi^Ii|gh_P^cJh2->_7CjM$Z^Vymg=akh&pgfP+K5v` zOodGhh-^fD;!@Jwa4poXsavlm)sZ9obSu!I627b3A~ctc!-VSqV+nzl;&z0k_}R$D zt=pqjv8Ozv!Ba2x|1Z~dr~50{O*!44I zwv=kV_y&?L?&u8UtHvM<_m?ihG>x-xj#rXc&nL9Im@XS%ab;YD^M2a|jvq9-adF)! zBRt(!Ch&Ck>+lW17;xccg#L*YaKH2?)?q9Lfy)OqpDYPW@UBUeS~@P`T zv+ibT8{S;yL;C^$r2POc&giOVV}K0aDN(r{Wt(C0)|D>w*3VrCXYh3$CJ(NONoNhi zunfaF1m{I$ZDMG5)7L1wj=|))jJR0P_P!UWM@5B*zS2IEx|Ursg7CoMa}Af!b9_(B z+MVRXY;a2tJtIiR*~vWF4C$`}$&>ipf84U&Hw+@(4{wWTd412bEE&jckv_wv3>+fdK}2~zrxdKKahskaX4*}LsV_D&w14Aaf_&VwtW_aA)_ zd+4#3A14goI|;+HiQYKM%48l#MHmm!yownn6p&*uVPGG@G$H!M83ozv1dZ$CFBR@g zPx%e=1A%`Ht_{wslIJBCcE9H+Xx>)<;~xgBuej2B+ix9$JnUuM#N8c{gK?PW*MR^-^3c9q!>fP~>U5(D3S@cAt1K7d^`1pDekW zPc5b-xV>!U_I>Dox@4xGbKkfTSfRO}+Xw12D)TvBP=_C92Ext^cwD=!=eE9f!1z@` z9q^`cY6BmJb2u=@_ii%^5W7{dbvV!CE}zZ}-1+8j4Vi-QWVj)_aOcX2`H2rxB1fnB z96Kr`T^x7@sQy6v!h_exeNTwG0#oSLt|O|t@_ZI(7I=@(;yJAQSQ3gB$xC`jUP4N{Yu^ooaf>9$l6a?t zxt?}mE!}6ai|VEk95gAcnd{eGE-KU;R}jU(f=ZjZCi1lEJme#l3diWGo@IN-m%4ou zPfAE7v_4M&U1EhFH3(kX7k;{pQ{;0z4))j{n%vq}|67<2AawyiuFkT7f zimh{gCUW!t_|umYD))YHYW~mV_}qt>tL#X;+3e;)R5H7z7Ts~8;u1tyWnn4#+~V?C z$}tnT5jmG$<8#GWRZ9dH6__ek0~B~L0dCSm5OgNNl=oozx65*_+s|A&vHp$xx?4X< zq5Pc(z*G$SbzvSAISwIAdYTL%2Jtk2N+IDI!vM8DZpfyoTStP5Z%pd~%Ss%oa5xdM zb#A{q2q8Lgub~RCS9GWC?PGxL22pueYy!aB%1^{q~jJp8f7Ibk9zALckkCWrNgK>|U@o_&-5g);LiA5wL+k4n#$N z@Qn_@N!1?yp=YXAc~n)5kQkeo1x*81!8Cqz zzNC<$XEX-xVg9+Vb`r_gf9-+^m`A{zsW9#xlCEpuAw#kh9)9CPOs{Lll~v#{!xeWtZjNftj?v6L)E0Mj&d-g%IVGz%2WmeB zWJG&>_QLK~KQSEaTGS}}t}9c{(h|CQn1MYQk~WNLYEL;(=%ki`A@&7ivu_xrb_v!L zD!Wm_3lQucnVLRP+IZ#1x(#>xPfhU~DL3JMeEz>L9|s+MYWyaO_D?M9l3qYYgQLeQ zUW9{Jz2^vqgYFnyJX~-Ew+MbEXlait$9IjdgyXig!sTCcPu5@(k08Zk=$U#Kt)n5w zEA}A0=1DVs?Yl<%Ql!y{1d=82sECkGY+BKtBz;QU^Ib1!z#dYeE;g*M8>yMDji_1RG4TK{~vUU8Hm{-HJ zYBU_C!>(-@C0U~F^kkfFhq;U-h?Y~)W{wc;wqF2JAN_U8`@X%ii!T{MF}BqXWt67N zTKp`>nMTMQ@47-+Y%g&zEm9b%g>>+88c4p%m7oF@RX+&hwdcCo#zN&@8p3n0?+WSP z`@JuiVDf$stNv|DJ$MduLsJqsYS6!!5|b1o7l0Z6N7JBuynFv2>q&> zSBKY$;W;n9V!HqKWvt`-DA1VG8M?b$=T(F2O!qxQly(;7ab6^Iyud&0F1aT(QrT8e z;VQ%xi2JbS-idQq?uLBgwJVG9qc0+w_Pe{)R+Cn{ho)T=B`ij=C>OTPO>POchpD`q z*De$oW{fAmdT7UGfe9r3(0~mI9OJS>ySBz+`VGy(cL1ArQ$qO{c1tm5dJw8?zl5(v zzNFF;YJ^baX=+n|Eu(!Cpi;HbRlwoB*KNQdT}fy#$^^P;K}24~zkY6tz--BT!<>G5 z1=8^zNXN-cgxesgH@m!P6a5&#@GrMKtr`T%c1sH3E>HvnJ33FxawrWLZX|bnc#fL; zKG)zHJ?^)vLYU(@RjUs{Go45^{>&wv%lQ55@`)}Zh1VCpWrq?P$zX^}Tc)`TucI_u zQ0jdirbB59KBsaF!60*zOs6Y`02{H3Q4Z-!3Kw?kwpHE807NAJ@ycl>sM({A2-lFF z%k)%VdR{B;-l8;XV0bmRyY3YS;~Os!#B_NJc|Omgp1Wgjr%zzlL8NyAR&y1!;3pCC zIUw6`O!3n=9MYZe1Ml!a8?#@%o9(GzcBV(k)W7B50fqn6t7E)z456KPFOR$GD^QZD zHSTF)@qtHEbAup{xk?D(_@MtAms92y)s&xuB0Q!e^@6vbTP9Tg+@yrcZ>(Y-;6#S5gd=cPg?|0&Jr1imK`4-V^7(^nQ8gI=B6GSoO!Sx}U$w z@+5Z*tvu<~@n$hu<|0JAUqp*|p#A`Nd+WOR`YA`Cf^$oa$c*1sOgRD@!EqU@5ilG< z+0VrKgQtAq^63`k7|@D=$Zz$|OK~t-I4}9Kf)3{;jvtqLx9C#ujNgC_Rc+(pN(VH` zm&OH?A2f1fc*YJ(@7ntNzt|m?==v##rNZJrh|l|8O38@JYwOG)2;sg=$5MIDVLw9r zh#pr9yXb0RJ<8*T`G8{4dd4?Iy;llMW*{BYNQ2!2meYgNsFZ5VQD0kQ+;F;?WArM3 z_m`+jijxQVst(IH4PqJZizS`IkXUwjkTA?)xr?T?$5#_+)HbXFS>)Ed2?D3poYk<< zO)b2(fx-A6upt|MsOed+fnM@NDl8c;{Vqdz4ddyFJp6%cP~w4wVTYQ6QLsTMB-Ifk%g5 zD&dd1LBIu^C>^_CP;~u(v)DU zsQ!!xU6p?${X>N!-LSJ0rJejOtoD^ZY}FSzhQv-6!A02J0U&3IWy~^iJ$5#T?JjWw z8|23+8@4h68g&IL&t0S7kn5(wA(M>)r+u#3ZzCo>Jk_TfFL-y?VDUYZnta_&l}^-| zx>xb^t|4gBeiyke(JM+z=+M3Fe#^a{fPmU69kjJ84TC1tDtKKj)RmUlCkJ;W)2@Oo zs+Chq>B2g>8WBw`o%3JmG-{T5;Qs4nitDw%c*Pniu5bIbr$SnJxZ8L4jDZ{O&-j7p zD;DLPUZqw1?Fsw@C1#Rk@?p`r=i>@>Z~ zMR_u5ct(YvA~{4r1r_uyS07aJ=)) ze>~*QZJ2s}_e!LC@!viMTh_JkJ9cD9G8bw-^P%xE<-5|My(tCvag1@wYwl}Ysld7o z{3AsYC|V>h>mhj=kX)RMPLc={olLh28RpwDer;wR|8%w#VgC7@l$m$y_(hSX)-zd( zFhy3vIu`jN8frS#surMDLDPz$ZCg`Ir2=1=U=vg(-41KXE!0W#>G)Kyw{pv^2d^K& zXV;kwPFWGcH7nEI9hKVv;fuH&5RnHhlsXx}8V0Q8zS9IX*h9yw9oDuUYgO$Xa!%72 zt<|G*esM|X{KiYaa{^M=t@;Ec$1j=bt$RCzwmpVaxPPAj>hB!pb9xo|E@;-DeTdRI zp?HGGXc|~9Pl8aD4zzbJoW=t=Plr?es<=Bs|#fBPvH!Dzj{lZgMj zK&vZc7<5L;Q|X2Z8L>c=74y!^EU%mn0+v}rR4fl-5`wl*vR#Z)>y6w_X2`JCYY`y{ z<20>epqE{@Rn2W16s^z3J+h=c)icJyS2_%Sc~ZC9?_9ax&2;6pF#SSYOW6T_FxLsnhMnK~q_DI9K$BBJ3(#p0FpkKuV`V2qYL-SLU#99zd}k zaFF6f->bRjBhQ}BDL)z8;#aYj3q5O1UNp4Mtk*+7E0=A2;V2flZ6%P|v-1dryj9>4 ztpW}ukQ%?Fi$g^0UkgKgZpLtELX53lgvKq%XDaDi`vHSBna6)VWg36SKp@AMFnEqhFX(I7_x$QbyAS_S(CC z5Rt?p5*Ldu1WxB=vb(<$i^pfM!y!)uj1q)ei5*3~a<#KotLd?R0lgJp|C(;a7Zh6) zRb=WH@Yml@9b)e4OxLx8E6xV{1w@dKQ!4f;V7vxYWZ}SHMv&?>zTy=kG$Wrt75RB9 zV*97w0p{}9va!p}V=E8OBDTY{C?Ji}{DL$dC<1dtZQ$^6zx9NN1#8Z|0REs+O#^z4 zN_w?9)H?nH`q}pj!PX+Ycfk7C@9!j&&W;^2SiprU$SE%cq6%Xh~)U>Gpu)14T4qlNRN=R>C;72kYZ8}Bp{mBfZ_q)TRUzee6B%1x`OiR>pJ*4 zKn%{MHR9P^`dBOF;$)w_{q&OT`1GXQl_#$%F<-|ZCLNTMkd?!&l#?Vy@NWA)>`6~> zNHl@G*|wEm`5vM#)@ZMiZnHVPI59n89oL5XjeY@3{+o~NXlx^J;rFNdnO>SE@ay z76M~F+=g<-OI8h#zH&dM#l2~~94wEAN3TRM$T5vP=uJJ?Qy0cOskCSm&K2m2#!=b< z?ZX9bd0hHF>~mF97dKV8N2X>>tP5MWcNWzTynELRo(=cT%B|#I#6?M4s)*;Mm9zKs z&I(-S7|C5(xsuW;7!AUznj@ME_tABFXVF4wBHm}7G@-dfUhJKSN2L;T$obJg#y2<8 z)F8OPm3l1j7_KAHK(TPE7WWcpj;(WkCT4uEH7)O*D}C@czjO@b#BC@ zl@owa-FiZvQE_|2^H;3$Tc7n^JMBEiOj!B2{MJPomK2!V$b668Y6Vpqw4!R6lC3ax z!&wWq8vZpXBw55{en848mT!PN-Df;X|i=)`<_#IuJ4&z`CPfU0a~HlqhN`~?EZ#g z_1!C<;?DP9Hhbwc@9eOga;GJnJWY?8XRi~Qq0HJq`}duVdi{+3t%m{7x%!uxNDuTU7U(e#)vG# z?JzkRZkUut#O7_(1oJy=06s`;_D1}MQD;EQEH39|ZcEws5S!fN43Pup_!amtp3<}d zR4gr}e+Vhv6N$~wEW?G1pFhR5S*+5F|KDHQ^x_bt4iy8Zy&91{*3d9x zIHQ^^M=-CcYTVYWmiRNmE!_=lP;hp*Itoc|qBUGAtN7&VD*0#Mw^K7Pl43S6#Ic*) zun3cQj$l2G2GXJ+-)QY{?g*Sk#8y1;DA$13Zt&y6kTFE?X0%iQx;dR%#NZ?kfX-+vfj>@Y8 zrV!Jc%EcWm9aBjaup=MVGhTDia|tiMQcRx#6|E9pe(PPAz^{4h=tyFat^4xy-MkC% z^B{}pRV)T*5>AdEh(+$HN;W=qpREKUe%#WYUxAj@nr`gFt`V3>le}on>0yN0yB^pX zn?IYqUl1Zo7$h6^94Ce6 z1JnTaZkvKPj6ttCU{Z!FVTZbHmi7ehS-5f>w{Cn6i37TxFwmcI4ag%|_+85^gGeQJ?d?ajMq@P04V?Z)22eOB5gG?1 z$HnR9-#A6>_x%k@jyu!2nt#sLJ(}iLZb#{6PBz^&)Vb`%KS15jm*dD^JGk;<-yv0W zWtU|bL&_~9n|Hfso-o{NszRvR#wbVlVEVK#YQK`L7BuR@Q7UMS?^TUrM;f_IoF}|a zE!x(~YJU0;>8^R(c;|z1_^wH#5XAhPUS%>sih1xE9p>n^rjE33<3Jr2aIO(eQv;*w z5ZZ80B*oUPK>i(|aM8sRDv*1_^YXk{&H_oO<5)CQflL{u6$5eHYKnYmoNfcj*vEFO zaLnM!1YS@zt=c;DXJQ5N9sj1Y!#{Y%VuBsMmqIZh^0OD&UV`sE7%l20*mW19(cWR& zD}~w9MBkzD1D+0W^58#%+5%aK7%hO*2fq(QAs#{LQ2|gi4Ramc=%Do=2c4%b?~i|` zHqrmc=evmI8IznuYK2GRo&U44RnDgdf!=>cUx#?t1T)Md+ohwhnTR)0A%`cFk*@E< z`Iaz)fg>CynxGP%@tLon;B!I6F-J0`U~H2no7uc+U!++MvX!Y|ej(|0M?y8;bl~>vc za&i)KXScJ>sT_Bn$BQ(1Tp{41D+Fvn^f!&7PRf!RQEm`zu4}O8wMfB2G3RzCM9JY_DV(fh>KJ^<~(XN4dsPWO|!jN`Gyr>6UTY4V-Q|Mv-t6O^pw4%PYZXEsjF<`VK1`W3EzVG)9F1;LFdI>fZbTD3#o#q7b&@x1bN(D%BO|d%2F{n2JCPO1k z#k~yj97>p`*`BgdKINz?nlbGQ$GA#^`w&m$JlfIFbi++|@5*NXuRnMJkbg~Qf*u+| zJ{q>!5zW~L9Ub>6C9q7kqYRMO4Q_nML6v71wcGOG6~YgKMC;Q`BrtNs%T)-r9GcA1 zXr(0M{vq}~oc4_74n>>WdTKiGt=@DgJqUDU>wLq`sR$#AF=9KRHnT1Tb#%pr*OG_j zG(pfpt*l8VqAAM~8eH25|4@bijhXtM)A0BHs7qt}zaDwU1a9Q%D>e72uLCLm^fz=n zFc}0U9aeMGFoNGjuhOPl+YNYAH;|UeE~C%)@n+i8@I?7l4PURB(QF5ejxGPQfrunY zw>R_)p0SGDpZQ_zk>#kAV}D^F8M`G48Ewb$_J-N`RQvp9e7^l1R1)>-?g-sJ2+RIc z5mK^Mi!6qUfLBjGDQu)RqZBeFOsg0ZRNz|k#(){Bd@U+BfRo@?u5nw#)S=UqV{Umb z%A=(MHhN9+E9ijz`fhkTn>}w5Y-jH#aN|)j$IssQUF&6j=r|c6BLmF?=mTEm^TzSi z8W-kRfE#X}ut_=R-+aG~NbVe5dOnhKo+ep3$1Al}gnN??DVatwYMA55#uGHN8TOaP zgnO>>T&ev!@Eq|(rrE69x}C;A{{9Ior3|08Ua~9pN7rc}LI{^E(t!h}s7j%#SmQwm zz;#c#ZXDcD;L*6vHgLED8c`nlppl6O?0;S+aXnW}X%R!!sZ=%fJ6|PT_l={o3$l1I zJeRmA3K%AOWwzt**{ueILqIVf?vf{}##86C0kkD$M9W%p9(G5*q2u=t0Ml~-#}7Wq ziflhS2vyP(*}`XW^?QM0?aGE<) zIp7>M&6G1h5$d?lAP<3+HYQL^>x!DFK@$&LS$pTVE5W%vW8Qkd&C2C>cZwaorloa} zXUg+Lbi?z$8`oDXX;nzalMtmk+MC7|a|mqNprD-^Hn&oSfQ) zlatPc53eea9=wRIlFh-HWdbDnrYCibKu+iyLDN7Bn>hH^muWtJB6 zG%qqs-0Xb);q1hv5NQ1h6s8ck5Tv-Rsa1g`)LF7Z*3pigk z{4Vl2D6^pfaiSI;!=8g;(MZLO5kg7__YEQ-m@K1-JFP1GQgzJ`KnfVKt@HLw9T4}T zUw-!VwBD;${bBh%J54BNvy+2}+8(hm`yHZC0ppH??Ts_YtR}jk3@a^Nr>V8NA*fa3 zd0=iDU#I}TY3P^UkCtC|pB~t_Zo6NV`77_}CZb&N+2d#g0%dq4ONfGEjNhUJD3omsibFMq)HpL)ju5bf(GmvE1l zY0gn^rm&>|KT9q7T~5>ET^veZfbs*I!>U%cJfJ=lLEDwl^Oh@!K1Q<|$F>a)VQ~8N zXY{0QSd*Djj~u|5^mx_NgAm6%yD-elxZ_n9Ird;^DUH3A-)_V#9e!DWQo&rj;Pc<+iE`M;lfDfZ_59dHjF z0Nj4uNE+oun9uPl?P%t`%)e6!uK~FaT1|uPXTB6o05Os={1a8x4ekz8Lye&cQ#5K^ z(G<6%Y}&m4a}>-!ImJXoJ=Zxxue!cfTbECnL-xGY=-N+y-j1<*`PgdrNv7#i9Sab02%!qZ#J0zn~q^Vr4v8j0A_(HmZ`}N@!!;EnQ8;-K0>c1-i$d5ePa%`uDz)HjZ$gJhH z0NFoY#O33XLBlQ?6j3GOOHK)l(EEMa-e#n(K^HVF=ZGKxn+aNvyHgS+*7lIcI$Wlw zlAgW)_%g=)_@ov^?n*2E+-*ArS0`pKJOH!(wBjT$K@ZIF>fNcSJzJllDN0H>FkA>T zDk>&mptRfCt3c+uIyjfCiLvNw!;-3NfXPcK;+os$1UC=j(rd#A$(Ca897k=Q=TSD4 zaszIO9189-)F?)giappO|uU&FM=BrEJphhxsaKe-_Orc2#MX)G zU$p}43$Mj_yJlJ7_}znmjf`*w&5@OJykbjcme$`taWSGTxCp+|fQt~L>FxL%Fq$Ae zDr%pv+`tiy>(_82n3U}3voTh=KL2&7k|*B`)Hke**r$J$gsHc5vC~n3+O`NR106U( zQ`gkbS^Gjjnq!WyB+!Jw30=x_Jl~V}o1+^sWkCg?7SxM+pk73tRp8%>KI;*H^cveQ%Yf)cBX}Mcem6p5r z%AQFXf*~Aeco1k1c#Wo7MXeQt`$$G65Jor)FT^r0YQpP$H-rM)J)QJ_T+aC-?dl zPxK4N!4n-@rfu9Z1Yl<8T<-EjImE#^y>i>r- zX6XCiju5Z^#enNuvt2x_$JYy`kSdP^@BTC1V$Qz_dXpFdMO3e;?{Kk3fm_u8gzoKcj)`7fe8u}1pr zMx{zn@n*w3h;L-6;J-?@Wj+-ap3{~%xKZi4)q+&f^8K&2fZRC=kh3dV3h1}tyvWnu zFycMcg4%_9O7miYNi7@$p;lE5R1%0#EoejOL(gSg9fhr)nC`P~g+3($|Fz0izr1!3 zx#8M!TyS|zv`rQdcuRo?b6jhjDY*2ab3<7L3I|+8E9*wcwyGJ}Ro8EP{^y`Ve;rrp z#j8%0?nTyBdi@ZJ`J!iymhGHkGTpJYMWx+zj}W25E6uA`bBH2fCUE$8t?*Z%qHA*% zNI*E7($t(&=Gi&TKseax9BWEcp6nMvtku=>3PAQFG-v;~?et#_A{h4*FP2G)DV(fq zAeG3gu-m*x-G)I$ZX8xOQX0SZT;LgK&}EL+>!Gj_K4EmK&+`1!CH?hJC(&QqJM`DT zqdtlcb@;sg0DShNzp@0xMLefhnGS3>58kMzS&DEN9G3>|dWgq;P+(ntQNSdf;mW1r z^5BT$#<9b?VTR+Cs}S*{FWhNKIXpo(%gaFpBwM5lP}O*amWtgoOtFot=S0GYWtn;oJCkO5csjx*7mTg zTDy(_anBI$1jMv5UI(6VVCAGfm)$gxU0v(k%~qS`!cSwfe8+>`X1RU{i()anS>mXG z>`gCQowa8m3D-g!+=GTHjud_qR6+3Yx&RDUs3jX7n2T55)ql=+6Y!7yImTeL6d^wu zpNeI)A%AzlYEHt_KXM6n!+qn;1B!5XPC}W5NiwHbG1NQ&ygO_ylzTXv_>Dr;24-}< z^KsCI*f8VkNh_!E`tVY0i2J(@aa1sXr$j983kA1ZNyrcQjlX6x{Q-L-+KyznkkN*z z2;W*2aDM$?(!k!^#|tfrXpq#UbOeyPc%_SSpwt2ofW&oFjT@wuDv*xm53hm4q*9A@ zw!*hpCA(j}1ER)6YIu(g4!r}60Qf$*=CJH&4Wni z+*)t-BZpx_n)ITTQ1ZFYQBT9yb;Qk4AwXfclCFZd#9R+7e%ok&9RxA-fDxve|uRM6_K?md6bM^8pT+DOqqJai)jSope zx4JU2!fy;{3@E$C2~-{M#z?+(&d$jUjr%5vaF#R&oJ;&9*fjl*bgvJ#?Q_eP!6mFVtuhM3-iWz)c+m*YOU zag|s9;Dn`@VNA|MnIayWmuZ+SY&x2~J-Fk6EwpB`R-6TnTT52}71jhUGq7V|5j-P>md^R>&@r0M+)rEhUpnJg|JD@~ zAbs{~M@|(NE}Yl z)a?A+hNCxO&wl+|wlwx1`{fVoc%9TGg1V~|x7+S2SB(LBc6XI%kFq1dgv~7|C3}LBr8W)Rn9*5Rp+&eNF zu?gjo%T@*zB0h&VLgELMTc>Gw*9hP7Tn|)mpfy#Y$^dkp23dS$dvyGnIx_kjU+(f5 zZ<^00rt?!i`fnVwGuuxMqMY_xvlK;F{awt{)Na_br@b&;H#A4b7@EcFIxe^dx*w=G zv#ET?!?8y+?RZBrgnQz&mov+eM9=@pDRAAsx@w<&njG=FI;;8SF}Mb1F+^e42^z1+ z%0Q*fKU>hGV@F8DFK{(!K%jO_WfXR-sdVd5QMuqsL%HyHpg@_LpgA8-%-C(aVF6AD z8XnWD-%1BD%`K&zrJc}|Q8Egm>Oq#vYou?y#;IDcT#X~3nt4Vy8;;kW$a1~xqg_{m z|M(m+VO#mD%lK;_dkVJI`?_uQvOx&Skyc$GKyvH%3L07xSn{?FhO(Lp`ag#1RbFX#Gejc2O~yA6n$#k@GoTQM?$S?*dK{X6-?-K?GVmGEmI( z0w0%QMK-9x<~p>tpp)slb^Nd6t4=8&|Ay_9a>F26<#4BzGKm)XoL;HjHD}LX@@V*; z1ivX2VoMDjzIK>cySip9+hfB}@V@~a2Y}Ec{r~_UiwFb&00000{{{d;LjnL18|7VV ztYuYwKX-;V!OYrSl_lV1)?y)>$C3ShfS_y59%u8OG6M`F1m z2mF;A_pErK=lkg!{VV)5$da*--^o_)f9HeuJa+FDVYu?ZLw9?4M!R;5Mw~fSR$`n~&V& zjz%}{JAD0-cdT50>!U{=@KSsAH~bRuw%6M=m7^mj^5w9 z&1B_(w{qj*m1}iz`^|?u-)kSg-ES5pcEeemO?T`E-Io9S)X}J@8&{}`xzce9L8vGt zb4w|TELo;k>4j~(<^;d=%2SL~Pr{lkwu z^zPuHU~~qc{vgox_pKS&Xmn*S@@b1a3@ia(8KCCKqPzt>3j*Ms;n!<$$9aeL&e2Fp zX%r_;MVrbrK$EzPN#;n>l^3td{ zy1#X|%X-nsTX$Qv!|M-E?9gvv3DPhO$974RHDID>3e0o(YK#<(t|`}!maO0vFI?@^ zTZBLqbqJInyWAp>4Kar|VDtZoO+IXxFraqLUQ`kJfR@gv9OIV8(wJKEE zXjjw15LZ=hQR-qVqS73Yl60})!hp|v@%{)u=%Y8Z7`?d{qkKb*tXZXg9zaTM zx|seFqKrWhmriYj=31FXAZ$A&sf8w-A$GrI8?jk1@csaM=fGxsLFZ`~_hAzUQ&025 zFaadF=OyFZi@NCIPXT!n|9+~etKemhAqX&}RJCBcwqn1L-|hF#bGhB`Uw?FYfWw@E z9X^Qnsu!%o+}& z(Y2}cro!tnp@_W>3b~1|{$=d+0=(y++Rf*BtbF`r$sP2fHkb%jv|;aq9rYm zMH*si)s%uDfEG%ZO)cxvtz;t#$_T4qOPa!f04{|;IePh3dFBwpnBnJ zMx(5C#9gC@dlAp4HVG57RbH3`!8k;v*MS^NK^_5QA?ik;oe+#yjBBoVB{_8wjvb>^ z(@^+m#T|#BB612eVx(~^P1W)Ve&%8ublBeW%()iZ4}5iLfH_|VaPPwVn}2i?;{Ds& zD0f{SxXEn1pVrb|Y*F^YDD%cx;&@shA@Wa~40wLSOsO>*41BsZOt?{+kdiqK)vg1S zxvHA2tSaaEf7}6P_Xxo3a!g|s0O)kQe^W1^6T7K3#<_T{1;`u$GPokoJ){MEb~VyE zkQgBpkk?Wztf7u9 z8(A9V$lB3{5?Z)QJ5so^M15@xr)cFFSw11pyvXFuM5dSi;XI4xYtJ51iu^jzd_Uge zquBY;>smCgItH5SyZkmXrGAzp0R+*sB1yW6+)!7W?5HrJb_x*7|klK1maIs zH{4Lk8p3N{QAMb7E2WHE7>)W>@a1iK=Af3%R1puXdgrQG!F7E-ep~TID#SarU8U# z4^hxEm>udbqKK(DBMnoMDAc_To)d^w<}FBB9s)N11~|@mW(4EAu7&EsV?$->CeQjT z)^HqwR|vW)wnOWiFh1heAnKIMjKc&0SH~zy)drT>G+1j^q0|C34zojQUdFrl_-wRPTtxQ0T z+Y}o6aX5|xZ;DIQ5yrbLkyD6TGztwA@R5uZ=t*shv}-H(9?fvTPp=04OP)V(fPGvr z;Ws~c^=W8vjy3PsSK zTUV6T@sga!#3{)aYqQ@1i0;Mv={qb9yqX^m_rkPsy=7xnmIsM9&hoIUxAHDjeG-A) zC8RFO!ey>PR%Dz=+k7h!8wL#^sYGGmRi+S3R@)e$=3tn6i}~3#!0#-)e>b*ae$~(J z?!_?fY79SbBan|D#vn>MAsE1RA?Os_9v0|ycv&%xz)nkaKg>`UqMbti`@)~@fZrZy!936lX0nk%dRZ$shiRHx zeLah(CYg1mn`di{0!&0BYFZXtQ&!a_1w#Qm1+}dKxFGnnp`zZ(&U*lQS-6-XCcy16 z;Pajt^19!dXX=eS2-;MbBNIkh*yF(t;Vy8Y#u$`hg>DK1jzU+otc!{p0luPe80An6 zoh`4=1_3wg!DoHfvB3S;S9T7ty4Osy#nCq*TkJa0A{X`{mxmh;Iked#1j`eR?a~oq z@mk~Qk38f}6tCx_hOKMFIW(VIDxxZma&4_G7;OrSyN(_@aMw>KfGo`bvShiOebIs% z*m;&7v>NJJJK=}7IQS1=+73is!oPz|CTX@BnV-%evlGZH0huKrb5e_pAMf$KJ$}5H zP;}Wu5qSE5mCW8TpAyXHC<1AZFGWm|3XDvCnO6+(&cx7I?ep)Ju!_Xh&Go2>Ms4LS)uucVv-YO=D=v+Fb zDw>8chw&}kdz39WLv`V#XWo0g<&STi%eQA}@z(XsS?ndjIE$e%{*s0Gt%YcWVleEA zG*zM6P|RuwLXFTjDG8~$WR&W~Xorn`u8lhz$DBCa6Zi{u%sYY1Z2-g0y2O)GD(?kq zW~MI5t(63MJPzY&!xDF+8c*6mga-Yaa$p|~aUDgeQZ;llrYVt&7wGdu=$YA!2R_s4 zGvA=64%BC?Ap7pS*X(82=;mG+!u5h|?gvpc&cQ5CJC>{?m3Q09M}Q~bqSh#VTt_0U zyG^MZUNeTU3$=!8x0H?EhC+N^-4iS*&)Q`54Pf&4r;}}jX_`_xss=c$a!qCA<=~M~KQg%h7Qf_M^W4hc=O-OL=Um;g z>dy^ws~=+j&*1%+`*r}Io7?zvQ6D}*H#!CtwZ$jSq5!otmSk#CVb=pcY$qES^ic#~ zR^b7wj_^A)Bh8yyooQ>Y`^4*q(?gd{3cAmI)|M}~%}vi)5cRhILF9)JXs|?HpLkcg zXue3Lv3*%me8RD6kN~9}sgz*QRbj}hpm1&`J-=yE&V2W`Enc^_c-^{5ydsNNkY!-Z zvE;!tQ=?6rDq09WN@`sjtqZJ$uA#1DDcr`D=xU`~*b1;|94$<_ye-eX5R@#2-yM^3 z`RAY7Iof;CZLNph(~Doa;RIESUzmf59AnATuupQ(tOnI2q*WLksi9s8C1}a*OdX+2 z09MW*5LUoaYN2I8x1)pYh4#Q*|2;%@*i51=i7&A2@I7M& z-!m+}2eW;?zXzR7x-Z}3CwqcDzJCyZC0NX?!-*XG<-=?A;Ar$4eXxhYhAg|~lCvyL zqj8pHT@RRba_lY}6dERgY28%1QTPDe<#MUf+t_0OL?M)-%i(J4fu0u)78Gl3J@PKR z)k&w1isc7d*skt{ZR2@LTlmMhm#5h{&S9aQj@^}V-$YgGHlR*jUPIn-H6m%LC2ZCy z>zX)J9cKYIap$9btaGrKH=jQ_Q}WPDcK+xNn{Af13m;ayWn;$qc5N*saScsB1f!mF-gclH>q^6Xjsx^(FCGcUIpj&bT0R=C(aU9XOplM857)r(V zrh|D5=uCe7$RD56>SdP>DVRq<>k+)4`D9lxzp)p*XhYt;ZNWjiM>fHxX*cZ_bp_xz z@#RP(?Tlr?jW(nzYpn&4<68zolq?pugGrI`w|`}Q?$Nm?Y_cfr`UEhb=%xQ^f z^9{$dbANG|bYOJ`^Bln91in=>s9U_jpJiFY1)UPDculxzWK(kd=83{-(Jp-L$jzTT zU`G~K&-1;x7pSDyyaMo}-q;>F2zrj(6g2{rRIaMDvC@`8F@Q!3tg&IPTmK3kxw#Tx zJd6GR&TG0^g*)eAv&MKOQM5Yl7mV#BM_=?VnQ3ZQG^B=;X~`Tebmc(k(-l(?QETc7 z!V%M{N^&9i2KT zLgT1{6QxUgh6S0>ZKzbdD0vAIL^dv(d{v!r0B75Gxk+`xw(l4GS*JQ*JP$vAcMyidI{?cGLkFG%r*t`gXg9VDoa#&*f3c|Y#L_I|7BiKc3JVM_G4 zh&d&ErDTmG3b}i$@rV~BrY->#2P{K!dS^4eQcXH@=)rHt4};hPyBv2j7wd!?S`~Km zzo=Yp3m?vz;00>Nsy5VtY|~T*iLGhe}5$Ao~s=(LJ z9UjgyZ@mx^LkP{saqM@&b=~-|LmYr42v+d$OmnDQqT!4{1%(w0XdVSgvU(iJ5B#xR z;;DD8yP>6!)GbPvRSn~{V+OSS18->g`}>#dKF@n@$3W5C_7&g%!dmM->L0Dh;{LuO ziUKbl+a(TqrYvj@lTu*gXe)T(madTKUpGyo4V<#rYzy&yZ1s!3HlT&*#xO%jzb*aa z#r_zPCG2S-h+?{iYVM+RAq^soYfr`)CGF@vH3T7ADGe2?bh#qi<0S*on{6S!$lK8T z&TM(0hHl3$KKNo6n)mg>*PVQ~V+IyJ=*9@mS?Kj00Y^ii(7HEPM%T6CkVvaq2!&2e z5(iDZ5GVKu_=~Ka;YkL~7<_o5kiO%=lb}EyZq4h%efZ>Yze1XOkq3n|2jS5jDw+u_ z`%iCFb-M%FJL&3^xXaax=2t{y~od0uOGfudrZ?{JI;=7_V22`t=b{UweCAx)dEAL@4P$2^^2!{ zD4-?~gXqW&e1zsvz_G&}GZjY;$2R7~zIp_UduV zJoKZnU1D!)1RX)M-&V19ih-3iK3#iUsUA4FHSzDC_xX3aSV#Sn(W>(KlYg=*%ww&| zZ`aliBd+4De*9uxukHVCMabY(}iTx zpyF?YJ#D*f2iFFkjequV8*uG%Y}l57(>-|Iw|07z*9Tj);St)^@z69+&?sk~*EgF_ zNU6apkOtVn?wG7V=&{n>LKLEG@iS9a_rB;Q+dLm?LAbdOgm^;`R(0<<^RmoRd47`j zka@%bzgwEd0olu|+C|n?6cI>MQ!>aW5W!ulSiKDwcnl=-HiO)mlL?i-{QZ-G+{#=c zI8VIZ36(I3qdXmBiMzw2>xf_u<&M+K*|rkFn~B>WnDFA)d23gM zLCx%iW8;~omaR*D6l`NGLDZf554ybdlD#LFfRkg&j?flhp4_4mMro=c$7x+xjus_T zb;)ZbxCBu4Qdf!gMM|O!HQUQh9Q&DjTke8o!`T2_<9+<}E(z@I#eeqZz9??VuK-PX zG*dwS;u-G(&S{4dDHL>R5YQCmrR!3w;0abk%G(;%c;FfD`@hp76FxnpvbN{0?0NV% zpVgHVxAsDl&t8IJLt7Z;5Z9wL?Gc14Q4{7+#vGTiMqB#5AyrebN)QA%!zd9I@MB_| zZYCNi2p?KKi4=eOi~*SKvN|AevCZaMH=_G6o7HuKsO3^aOYuzeVbUSC+aBl>OyUn! z)5bO6ZwklIqO=Mr1PeojTt4n+o*m6#^6ainT&81%;&Pb+=0x#4BnF)~KdXm2`~;UD!~)ZMREoCiT5Mi7gjD+l@S3+zZ4E zR~oKfLG624?v1hJ-Fc&RQv%p?QESVzYkUeJ4HsK}N$drOP908w7TD#N>>(@CMUlID zH{D$)5~gi|6d|LHqqr-M^6m@w>>US9T}lTUuPg1{HOzo?BfO@xkpyLTRhLdv>8h+; z;}V8);6#kv&m-DrZzfqSyPqCZc3Vx#US$5Q%hztM*)_WS7&vZxkvSY_><8gY**#Mw zz=jZ)KSCU;o7%0J63nnfIw&8x3bW&Ab^HFHP7v3{hFwgTj zRb?LM5vocQ;xmUre^EO}N5Tb1jVMK_4Ok&XYgGvsYJwC>O7w2LLLge+;%CAm{m%gX zd@}`MF%fLO;!ke?TG}q?xGXATN8n^#px&0WsA>hL6Od?}7Ex0ey7dEb%EHz`cghTO zr?i(G1PA?niSo03k+;WN%mnR)Z$AfCPoHw^3*Yj5HrcI?6ef1MH|?(1S_d7ZbFLgt zU8f-6XB90-QPvQ#82TEiT+q`+g)Ff3&<&c{xRbP(l6~UhAt~~;lXE|BecKtMy%#(( zcajbk)_<@iNi%R$W4m;tLF?w~WJRRoh|+PLvS^sSO}qw`Kr1He#pBt;8Gkllwr(@d zxI7^X-uLmH=#Fn|opIZcp^j>t+PDTpXU!{z%c?**W$LnVj_061Q0b7_IfKm3_A0xB zetIwn)q?!N6+mYNZ!mM=^&Pzk1+&wKQPR>VcA72?rV~DSM?O6VKdVtk)t~{|JIRP+ zgtQ7Wt3?C$vY>7W&KCkR{vf5;)+=P^6;(4_)aO6f>LpKJKE(4Lo3tihI^(3#TPNkj z`})z_@FKHGZxTT;7+Y!B?+%CtGsU^Rp-Zmr03NxafFMSCk6v z3iuYOXu)_zoEq7H)vul~KbLh`@TB9tlk2*^`X5WceSaJA-qVYFlx^4(W^FZ_AYs`5 zEsr-td-*eRrKP>NppfhY0R`xmoVfUYX<-T diff --git a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/expected/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids b/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/expected/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids deleted file mode 100644 index ef20c09..0000000 --- a/examples/euk_prok_virus/.tests/unit/prefilter_reads_taxonomy/expected/temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids +++ /dev/null @@ -1,1299 +0,0 @@ -M_T0_RID0_S0_NC_030117.1:111953-112007_length:55_mod0000 -M_T0_RID0_S0_NZ_JBDYLZ010000006.1:232651-232713_length:63_mod0000 -M_T0_RID0_S0_NZ_JBDYRX010000003.1:638778-638845_length:68_mod0000 -M_T0_RID0_S0_NZ_JBDYSJ010000001.1:480453-480521_length:69_mod0000 -M_T0_RID0_S1_NC_029996.1:52049-52114_length:66_mod0000 -M_T0_RID0_S1_NC_029997.2:98154-98247_length:94_mod0001 -M_T0_RID0_S1_NC_033619.1:5054-5125_length:72_mod0000 -M_T0_RID1_S0_NZ_JBDYLZ010000006.1:89475-89546_length:72_mod0000 -M_T0_RID2_S0_NC_030240.1:124812-124864_length:53_mod0000 -M_T0_RID2_S0_NZ_JBDYLZ010000014.1:79367-79450_length:84_mod0000 -M_T0_RID2_S1_NC_029132.1:78897-78961_length:65_mod0000 -M_T0_RID3_S1_NC_029996.1:125237-125310_length:74_mod0000 -M_T0_RID3_S1_NC_030229.1:666-744_length:79_mod0000 -M_T0_RID4_S0_NZ_JBDYRX010000001.1:960749-960798_length:50_mod0000 -M_T0_RID4_S1_NZ_JBDYSJ010000003.1:80602-80671_length:70_mod0000 -M_T0_RID5_S0_NC_028371.1:3473-3533_length:61_mod0000 -M_T0_RID5_S0_NZ_JBDYLZ010000014.1:31093-31169_length:77_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000003.1:463476-463555_length:80_mod0000 -M_T0_RID5_S0_NZ_JBDYSJ010000004.1:91279-91382_length:104_mod0000 -M_T0_RID5_S1_NC_031272.1:12737-12796_length:60_mod0000 -M_T0_RID5_S1_NZ_JBDYSJ010000001.1:152930-152976_length:47_mod0000 -M_T0_RID6_S0_NC_018093.1:1833-1947_length:115_mod0000 -M_T0_RID6_S1_NZ_JBDYSJ010000001.1:525478-525555_length:78_mod0000 -M_T0_RID7_S0_NC_027121.1:14835-14908_length:74_mod0000 -M_T0_RID7_S0_NC_030117.1:123232-123357_length:126_mod0000 -M_T0_RID7_S0_NC_033733.1:1775-1866_length:92_mod0000 -M_T0_RID7_S0_NC_033757.1:335-408_length:74_mod0000 -M_T0_RID7_S0_NC_033816.1:2121-2169_length:49_mod0000 -M_T0_RID7_S0_NZ_JBDYRX010000001.1:768041-768147_length:107_mod0000 -M_T0_RID7_S1_NZ_JBDYRX010000003.1:741729-741847_length:119_mod0000 -M_T0_RID8_S0_NC_028255.1:2339-2453_length:115_mod0000 -M_T0_RID8_S0_NC_028362.1:3644-3681_length:38_mod0000 -M_T0_RID8_S0_NC_030295.1:5058-5146_length:89_mod0000 -M_T0_RID8_S0_NZ_JBDYLZ010000011.1:65064-65142_length:79_mod0000 -M_T0_RID8_S1_NC_029996.1:15385-15439_length:55_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000001.1:372140-372170_length:31_mod0000 -M_T0_RID8_S1_NZ_JBDYSJ010000002.1:184902-185028_length:127_mod0000 -M_T0_RID9_S0_NC_018175.1:751-814_length:64_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000001.1:128705-128756_length:52_mod0000 -M_T0_RID9_S0_NZ_JBDYRX010000003.1:717567-717638_length:72_mod0000 -M_T0_RID9_S1_NZ_JBDYRX010000001.1:708791-708875_length:85_mod0001 -M_T0_RID10_S1_NC_034266.1:180760-180821_length:62_mod0000 -M_T0_RID11_S0_NC_027126.1:6629-6712_length:84_mod0000 -M_T0_RID11_S0_NC_027426.1:3579-3717_length:139_mod0000 -M_T0_RID11_S1_NC_030117.1:3968-4065_length:98_mod0000 -M_T0_RID12_S0_NC_027016.1:206020-206105_length:86_mod0000 -M_T0_RID13_S0_NC_027915.1:11194-11270_length:77_mod0000 -M_T0_RID13_S1_NZ_JBDYLZ010000012.1:21748-21797_length:50_mod0000 -M_T0_RID13_S1_NZ_JBDYSJ010000002.1:219548-219618_length:71_mod0000 -M_T0_RID14_S0_NC_033816.1:7896-7995_length:100_mod0000 -M_T0_RID14_S0_NZ_JBDYRX010000001.1:272205-272307_length:103_mod0000 -M_T0_RID14_S0_NZ_JBDYSJ010000001.1:204692-204745_length:54_mod0000 -M_T0_RID14_S1_NC_031321.1:1201-1285_length:85_mod0000 -M_T0_RID14_S1_NC_034217.1:1799-1845_length:47_mod0000 -M_T0_RID15_S0_NZ_JBDYSJ010000001.1:485204-485240_length:37_mod0001 -M_T0_RID15_S1_NC_023442.1:20190-20253_length:64_mod0001 -M_T0_RID15_S1_NC_028259.1:6855-6912_length:58_mod0000 -M_T0_RID15_S1_NZ_JBDYLZ010000014.1:31347-31473_length:127_mod0000 -M_T0_RID16_S0_NC_033718.1:9155-9282_length:128_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000014.1:112132-112219_length:88_mod0000 -M_T0_RID17_S0_NZ_JBDYLZ010000018.1:30565-30632_length:68_mod0001 -M_T0_RID17_S1_NC_030658.1:888-970_length:83_mod0001 -M_T0_RID17_S1_NC_030873.1:769-848_length:80_mod0000 -M_T0_RID17_S1_NZ_JBDYRX010000004.1:479027-479133_length:107_mod0000 -M_T0_RID17_S1_NZ_JBDYSJ010000002.1:142153-142239_length:87_mod0000 -M_T0_RID18_S0_NC_033830.1:429-498_length:70_mod0000 -M_T0_RID18_S1_NC_027429.1:4469-4544_length:76_mod0000 -M_T0_RID19_S0_NC_028491.1:2563-2618_length:56_mod0000 -M_T0_RID19_S0_NC_031227.1:5693-5751_length:59_mod0000 -M_T0_RID20_S1_NC_029562.1:5000-5036_length:37_mod0000 -M_T0_RID20_S1_NZ_JBDYSJ010000004.1:235888-235979_length:92_mod0000 -M_T0_RID21_S0_NC_028242.1:2691-2737_length:47_mod0000 -M_T0_RID21_S0_NC_029052.1:6412-6494_length:83_mod0000 -M_T0_RID21_S0_NZ_JBDYSJ010000002.1:218541-218623_length:83_mod0000 -M_T0_RID21_S1_NZ_JBDYLZ010000006.1:140228-140329_length:102_mod0000 -M_T0_RID21_S1_NZ_JBDYRX010000001.1:693665-693710_length:46_mod0000 -M_T0_RID22_S0_NC_030402.1:754-835_length:82_mod0000 -M_T0_RID22_S0_NC_034216.1:12941-13048_length:108_mod0000 -M_T0_RID22_S1_NZ_JBDYRX010000001.1:435105-435213_length:109_mod0000 -M_T0_RID23_S0_NC_030701.1:5103-5151_length:49_mod0000 -M_T0_RID23_S0_NC_033762.1:10-98_length:89_mod0000 -M_T0_RID23_S0_NC_037617.1:942-1060_length:119_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000002.1:499806-499888_length:83_mod0000 -M_T0_RID23_S0_NZ_JBDYRX010000004.1:201196-201277_length:82_mod0000 -M_T0_RID23_S1_NC_031275.1:7710-7771_length:62_mod0000 -M_T0_RID24_S0_NC_030240.1:57723-57766_length:44_mod0000 -M_T0_RID24_S0_NZ_JBDYLZ010000012.1:969-1002_length:34_mod0000 -M_T0_RID24_S0_NZ_JBDYRX010000001.1:197011-197061_length:51_mod0000 -M_T0_RID24_S1_NC_027121.1:8433-8469_length:37_mod0000 -M_T0_RID24_S1_NZ_JBDYRX010000001.1:668610-668664_length:55_mod0000 -M_T0_RID25_S0_NZ_JBDYSJ010000002.1:6311-6403_length:93_mod0000 -M_T0_RID25_S1_NC_029997.2:85189-85282_length:94_mod0000 -M_T0_RID25_S1_NC_034384.1:2318-2377_length:60_mod0000 -M_T0_RID25_S1_NZ_JBDYRX010000002.1:614807-614869_length:63_mod0000 -M_T0_RID25_S1_NZ_JBDYSJ010000004.1:88035-88153_length:119_mod0000 -M_T0_RID26_S0_NC_028491.1:86460-86530_length:71_mod0000 -M_T0_RID26_S0_NZ_JBDYSJ010000003.1:64065-64167_length:103_mod0000 -M_T0_RID26_S1_NZ_JBDYSJ010000002.1:180789-180849_length:61_mod0001 -M_T0_RID27_S0_NZ_JBDYRX010000002.1:879317-879417_length:101_mod0001 -M_T0_RID27_S0_NZ_JBDYSJ010000002.1:371147-371261_length:115_mod0000 -M_T0_RID27_S1_NC_024911.1:1404-1530_length:127_mod0000 -M_T0_RID27_S1_NC_034266.1:112117-112169_length:53_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000003.1:302019-302061_length:43_mod0000 -M_T0_RID27_S1_NZ_JBDYRX010000004.1:327071-327150_length:80_mod0001 -M_T0_RID28_S0_NC_027812.1:1778-1877_length:100_mod0000 -M_T0_RID28_S0_NC_028833.1:23931-24017_length:87_mod0000 -M_T0_RID28_S0_NC_034159.1:870-906_length:37_mod0000 -M_T0_RID28_S0_NZ_JBDYSJ010000003.1:260828-260864_length:37_mod0000 -M_T0_RID29_S0_NC_027137.1:5905-5940_length:36_mod0000 -M_T0_RID29_S0_NC_027208.1:2702-2783_length:82_mod0000 -M_T0_RID29_S0_NC_029996.1:60558-60653_length:96_mod0000 -M_T0_RID29_S0_NC_033722.1:167-248_length:82_mod0000 -M_T0_RID30_S0_NC_017977.1:8983-9015_length:33_mod0000 -M_T0_RID30_S0_NC_034219.1:4140-4199_length:60_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000001.1:753768-753819_length:52_mod0000 -M_T0_RID30_S0_NZ_JBDYRX010000002.1:441798-441831_length:34_mod0000 -M_T0_RID30_S0_NZ_JBDYSJ010000001.1:878513-878614_length:102_mod0000 -M_T0_RID30_S1_NC_028492.1:144-210_length:67_mod0000 -M_T0_RID30_S1_NZ_JBDYRX010000004.1:168829-168933_length:105_mod0000 -M_T0_RID30_S1_NZ_JBDYSJ010000002.1:584020-584104_length:85_mod0000 -M_T0_RID31_S0_NZ_JBDYSJ010000002.1:273852-273897_length:46_mod0000 -M_T0_RID31_S1_NC_031450.1:2281-2311_length:31_mod0000 -M_T0_RID31_S1_NZ_JBDYSJ010000002.1:454313-454400_length:88_mod0000 -M_T0_RID32_S0_NC_023442.1:31719-31785_length:67_mod0000 -M_T0_RID32_S1_NC_028133.1:1439-1562_length:124_mod0000 -M_T0_RID32_S1_NZ_JBDYSJ010000002.1:412312-412351_length:40_mod0000 -M_T0_RID33_S1_NC_034266.1:78437-78516_length:80_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000001.1:102672-102747_length:76_mod0000 -M_T0_RID33_S1_NZ_JBDYRX010000002.1:784464-784511_length:48_mod0000 -M_T0_RID33_S1_NZ_JBDYSJ010000003.1:324967-325032_length:66_mod0000 -M_T0_RID34_S0_NC_018457.1:737-780_length:44_mod0000 -M_T0_RID34_S0_NC_028253.1:2464-2519_length:56_mod0000 -M_T0_RID34_S0_NZ_JBDYRX010000003.1:19821-19946_length:126_mod0000 -M_T0_RID34_S1_NC_029255.1:103099-103196_length:98_mod0000 -M_T0_RID34_S1_NZ_JBDYRX010000001.1:214312-214398_length:87_mod0001 -M_T0_RID35_S0_NZ_JBDYRX010000001.1:286577-286647_length:71_mod0000 -M_T0_RID35_S0_NZ_JBDYRX010000002.1:303458-303514_length:57_mod0000 -M_T0_RID35_S1_NC_028374.1:16776-16870_length:95_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:363132-363178_length:47_mod0000 -M_T0_RID35_S1_NZ_JBDYSJ010000001.1:829523-829581_length:59_mod0000 -M_T0_RID36_S0_NC_029311.1:99001-99097_length:97_mod0000 -M_T0_RID37_S0_NC_033620.1:94230-94306_length:77_mod0000 -M_T0_RID37_S0_NZ_JBDYLZ010000012.1:26095-26141_length:47_mod0000 -M_T0_RID37_S1_NC_029311.1:32048-32093_length:46_mod0000 -M_T0_RID37_S1_NZ_JBDYSJ010000001.1:902396-902441_length:46_mod0000 -M_T0_RID38_S0_NC_030691.1:6883-6932_length:50_mod0000 -M_T0_RID38_S1_NZ_JBDYRX010000004.1:200501-200575_length:75_mod0000 -M_T0_RID39_S1_NC_028136.1:1274-1340_length:67_mod0000 -M_T0_RID39_S1_NZ_JBDYSJ010000002.1:503066-503117_length:52_mod0000 -M_T0_RID40_S0_NC_030234.1:4344-4414_length:71_mod0000 -M_T0_RID41_S0_NC_031088.1:9201-9299_length:99_mod0000 -M_T0_RID41_S0_NZ_JBDYLZ010000009.1:31815-31852_length:38_mod0000 -M_T0_RID41_S1_NC_028244.1:5988-6042_length:55_mod0000 -M_T0_RID41_S1_NZ_JBDYLZ010000006.1:65238-65362_length:125_mod0000 -M_T0_RID41_S1_NZ_JBDYRX010000003.1:765215-765280_length:66_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:32817-32939_length:123_mod0000 -M_T0_RID42_S1_NZ_JBDYRX010000004.1:462782-462843_length:62_mod0000 -M_T0_RID43_S0_NZ_JBDYLZ010000008.1:49878-49973_length:96_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000001.1:889979-890062_length:84_mod0000 -M_T0_RID43_S1_NZ_JBDYRX010000004.1:406662-406696_length:35_mod0000 -M_T0_RID44_S1_NZ_JBDYLZ010000006.1:90744-90777_length:34_mod0000 -M_T0_RID45_S0_NC_027712.1:10734-10821_length:88_mod0000 -M_T0_RID45_S0_NC_029311.1:44548-44620_length:73_mod0000 -M_T0_RID45_S0_NC_030693.1:5273-5361_length:89_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000008.1:40421-40495_length:75_mod0000 -M_T0_RID45_S0_NZ_JBDYLZ010000009.1:55082-55112_length:31_mod0000 -M_T0_RID45_S1_NC_028232.1:6596-6658_length:63_mod0000 -M_T0_RID46_S0_NZ_JBDYSJ010000003.1:168383-168513_length:131_mod0000 -M_T0_RID47_S0_NC_029932.1:1175-1250_length:76_mod0000 -M_T0_RID47_S1_NC_027633.1:3344-3412_length:69_mod0000 -M_T0_RID48_S0_NC_018174.1:5223-5261_length:39_mod0000 -M_T0_RID48_S0_NC_023443.1:462-562_length:101_mod0000 -M_T0_RID48_S0_NZ_JBDYRX010000002.1:697197-697270_length:74_mod0000 -M_T0_RID49_S0_NC_029309.1:6196-6271_length:76_mod0000 -M_T0_RID49_S0_NZ_JBDYRX010000002.1:627468-627514_length:47_mod0000 -M_T0_RID49_S1_NC_028375.1:6864-6975_length:112_mod0000 -M_T0_RID50_S0_NC_027634.1:1642-1737_length:96_mod0000 -M_T0_RID50_S0_NC_030117.1:58855-58929_length:75_mod0000 -M_T0_RID50_S0_NC_030397.1:2093-2139_length:47_mod0001 -M_T0_RID50_S0_NZ_JBDYRX010000002.1:579910-579949_length:40_mod0000 -M_T0_RID50_S1_NC_028099.1:106360-106431_length:72_mod0000 -M_T0_RID50_S1_NZ_JBDYLZ010000012.1:83521-83604_length:84_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:803598-803655_length:58_mod0000 -M_T0_RID50_S1_NZ_JBDYRX010000001.1:945690-945779_length:90_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000006.1:184353-184397_length:45_mod0000 -M_T0_RID51_S0_NZ_JBDYLZ010000018.1:32304-32360_length:57_mod0000 -M_T0_RID51_S1_NZ_JBDYRX010000001.1:868994-869082_length:89_mod0000 -M_T0_RID51_S1_NZ_JBDYSJ010000003.1:168788-168850_length:63_mod0000 -M_T0_RID52_S0_NZ_JBDYRX010000002.1:889544-889674_length:131_mod0000 -M_T0_RID52_S1_NC_030801.1:2462-2542_length:81_mod0000 -M_T0_RID53_S0_NC_029053.1:3050-3132_length:83_mod0000 -M_T0_RID53_S0_NC_033792.1:955-1008_length:54_mod0000 -M_T0_RID53_S0_NZ_JBDYRX010000003.1:127692-127758_length:67_mod0000 -M_T0_RID53_S1_NC_027533.1:2013-2051_length:39_mod0000 -M_T0_RID53_S1_NC_031307.1:5253-5307_length:55_mod0000 -M_T0_RID54_S0_NC_031079.1:45-96_length:52_mod0000 -M_T0_RID54_S1_NC_027712.1:6686-6777_length:92_mod0000 -M_T0_RID54_S1_NC_029996.1:22662-22724_length:63_mod0000 -M_T0_RID55_S0_NC_030141.1:2102-2247_length:146_mod0000 -M_T0_RID55_S0_NC_031304.1:2692-2762_length:71_mod0000 -M_T0_RID55_S0_NC_033704.1:4049-4166_length:118_mod0000 -M_T0_RID55_S0_NZ_JBDYRX010000001.1:247013-247049_length:37_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:448811-448874_length:64_mod0000 -M_T0_RID55_S0_NZ_JBDYSJ010000002.1:513869-513936_length:68_mod0000 -M_T0_RID56_S0_NC_027016.1:52570-52626_length:57_mod0000 -M_T0_RID56_S0_NC_031449.1:9465-9556_length:92_mod0000 -M_T0_RID56_S0_NZ_JBDYLZ010000007.1:245259-245319_length:61_mod0001 -M_T0_RID56_S1_NZ_JBDYLZ010000007.1:103507-103590_length:84_mod0000 -M_T0_RID57_S0_NC_018070.1:8325-8447_length:123_mod0000 -M_T0_RID57_S0_NC_027426.1:3804-3851_length:48_mod0000 -M_T0_RID57_S1_NC_028099.1:83564-83601_length:38_mod0000 -M_T0_RID58_S0_NC_027121.1:14888-14980_length:93_mod0000 -M_T0_RID58_S0_NC_029550.1:232-272_length:41_mod0000 -M_T0_RID58_S1_NZ_JBDYLZ010000015.1:60370-60453_length:84_mod0000 -M_T0_RID59_S0_NZ_JBDYLZ010000011.1:108912-108996_length:85_mod0000 -M_T0_RID59_S0_NZ_JBDYRX010000004.1:15220-15308_length:89_mod0000 -M_T0_RID60_S1_NC_027641.1:1140-1184_length:45_mod0000 -M_T0_RID60_S1_NC_029085.1:8080-8154_length:75_mod0001 -M_T0_RID60_S1_NZ_JBDYRX010000001.1:262196-262266_length:71_mod0000 -M_T0_RID60_S1_NZ_JBDYSJ010000002.1:87924-88000_length:77_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:191465-191498_length:34_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000002.1:569149-569214_length:66_mod0000 -M_T0_RID61_S0_NZ_JBDYSJ010000003.1:457685-457761_length:77_mod0000 -M_T0_RID62_S0_NC_023303.1:251-301_length:51_mod0000 -M_T0_RID62_S0_NZ_JBDYRX010000001.1:304278-304333_length:56_mod0000 -M_T0_RID62_S1_NC_023427.1:835-900_length:66_mod0000 -M_T0_RID62_S1_NC_027016.1:54356-54406_length:51_mod0000 -M_T0_RID62_S1_NC_028133.1:2961-2996_length:36_mod0000 -M_T0_RID62_S1_NC_031083.1:3710-3834_length:125_mod0000 -M_T0_RID62_S1_NC_031463.1:8948-8994_length:47_mod0000 -M_T0_RID62_S1_NZ_JBDYRX010000003.1:182597-182668_length:72_mod0001 -M_T0_RID62_S1_NZ_JBDYSJ010000001.1:192588-192667_length:80_mod0001 -M_T0_RID63_S0_NC_028144.1:6011-6113_length:103_mod0000 -M_T0_RID63_S0_NC_030240.1:102727-102785_length:59_mod0000 -M_T0_RID63_S0_NC_033760.1:1443-1573_length:131_mod0000 -M_T0_RID63_S0_NZ_JBDYLZ010000020.1:7118-7208_length:91_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000002.1:745773-745875_length:103_mod0000 -M_T0_RID63_S0_NZ_JBDYRX010000003.1:142067-142124_length:58_mod0000 -M_T0_RID63_S0_NZ_JBDYSJ010000003.1:151524-151569_length:46_mod0000 -M_T0_RID63_S1_NC_031236.1:11052-11140_length:89_mod0001 -M_T0_RID64_S0_NC_030748.1:1054-1124_length:71_mod0000 -M_T0_RID64_S1_NC_031093.1:6116-6176_length:61_mod0000 -M_T0_RID66_S0_NZ_JBDYLZ010000015.1:96499-96580_length:82_mod0000 -M_T0_RID66_S0_NZ_JBDYSJ010000002.1:346193-346225_length:33_mod0000 -M_T0_RID66_S1_NC_031305.1:4622-4714_length:93_mod0000 -M_T0_RID66_S1_NZ_JBDYRX010000002.1:340389-340472_length:84_mod0000 -M_T0_RID67_S0_NC_028134.1:42-92_length:51_mod0000 -M_T0_RID67_S0_NC_030447.1:1980-2070_length:91_mod0000 -M_T0_RID67_S0_NZ_JBDYRX010000004.1:332043-332120_length:78_mod0000 -M_T0_RID67_S0_NZ_JBDYSJ010000003.1:241049-241147_length:99_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000001.1:247375-247406_length:32_mod0000 -M_T0_RID67_S1_NZ_JBDYSJ010000002.1:355091-355166_length:76_mod0000 -M_T0_RID68_S1_NC_034266.1:8834-8941_length:108_mod0000 -M_T0_RID68_S1_NZ_JBDYLZ010000016.1:69565-69646_length:82_mod0000 -M_T0_RID69_S0_NC_028368.1:19515-19575_length:61_mod0000 -M_T0_RID69_S0_NC_034266.1:30444-30515_length:72_mod0000 -M_T0_RID69_S0_NZ_JBDYLZ010000013.1:100003-100090_length:88_mod0000 -M_T0_RID69_S1_NZ_JBDYLZ010000016.1:63861-63942_length:82_mod0000 -M_T0_RID70_S0_NC_018404.1:2315-2374_length:60_mod0000 -M_T0_RID70_S1_NC_027713.1:293-401_length:109_mod0000 -M_T0_RID70_S1_NC_033830.1:3068-3146_length:79_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000007.1:118774-118860_length:87_mod0000 -M_T0_RID70_S1_NZ_JBDYLZ010000016.1:66813-66865_length:53_mod0000 -M_T0_RID71_S0_NC_033620.1:14671-14724_length:54_mod0000 -M_T0_RID71_S1_NC_029562.1:2435-2497_length:63_mod0000 -M_T0_RID72_S0_NC_033716.1:7859-7951_length:93_mod0000 -M_T0_RID72_S1_NC_030117.1:83819-83856_length:38_mod0000 -M_T0_RID72_S1_NZ_JBDYLZ010000008.1:123604-123689_length:86_mod0000 -M_T0_RID73_S0_NC_030115.1:6022-6140_length:119_mod0000 -M_T0_RID73_S0_NC_030229.1:2674-2768_length:95_mod0000 -M_T0_RID73_S0_NC_033733.1:4354-4441_length:88_mod0001 -M_T0_RID74_S0_NC_031093.1:8592-8666_length:75_mod0000 -M_T0_RID74_S0_NZ_JBDYSJ010000002.1:362489-362559_length:71_mod0000 -M_T0_RID74_S1_NC_029302.1:212-295_length:84_mod0000 -M_T0_RID75_S0_NZ_JBDYRX010000001.1:235615-235682_length:68_mod0000 -M_T0_RID75_S1_NC_030235.1:6658-6691_length:34_mod0000 -M_T0_RID75_S1_NZ_JBDYLZ010000022.1:8709-8767_length:59_mod0000 -M_T0_RID75_S1_NZ_JBDYRX010000003.1:478660-478720_length:61_mod0000 -M_T0_RID76_S0_NC_018070.1:8778-8882_length:105_mod0000 -M_T0_RID76_S0_NC_029255.1:61305-61383_length:79_mod0000 -M_T0_RID76_S1_NC_027428.1:2290-2358_length:69_mod0000 -M_T0_RID76_S1_NC_030200.1:88040-88083_length:44_mod0000 -M_T0_RID76_S1_NC_033720.1:158-194_length:37_mod0000 -M_T0_RID77_S1_NC_033730.1:7657-7785_length:129_mod0000 -M_T0_RID78_S0_NC_023442.1:36825-36879_length:55_mod0000 -M_T0_RID78_S0_NC_027016.1:111926-112014_length:89_mod0000 -M_T0_RID78_S0_NZ_JBDYRX010000003.1:310444-310522_length:79_mod0000 -M_T0_RID78_S1_NC_030871.1:4415-4481_length:67_mod0000 -M_T0_RID78_S1_NC_031220.1:5976-6009_length:34_mod0000 -M_T0_RID79_S0_NC_029997.2:83992-84041_length:50_mod0000 -M_T0_RID79_S0_NC_030240.1:97988-98049_length:62_mod0000 -M_T0_RID79_S1_NC_033792.1:2479-2556_length:78_mod0000 -M_T0_RID79_S1_NZ_JBDYRX010000003.1:341785-341851_length:67_mod0001 -M_T0_RID80_S1_NZ_JBDYLZ010000010.1:13735-13769_length:35_mod0000 -M_T0_RID80_S1_NZ_JBDYSJ010000001.1:511944-512037_length:94_mod0000 -M_T0_RID81_S1_NC_027923.1:15413-15450_length:38_mod0000 -M_T0_RID82_S0_NC_027916.2:67438-67522_length:85_mod0001 -M_T0_RID82_S0_NC_028398.1:2368-2442_length:75_mod0000 -M_T0_RID82_S0_NC_033779.1:2219-2288_length:70_mod0000 -M_T0_RID82_S0_NZ_JBDYLZ010000016.1:9019-9115_length:97_mod0000 -M_T0_RID82_S0_NZ_JBDYRX010000001.1:261558-261662_length:105_mod0001 -M_T0_RID82_S1_NC_027016.1:72621-72680_length:60_mod0000 -M_T0_RID82_S1_NC_027535.1:2160-2253_length:94_mod0000 -M_T0_RID83_S1_NC_030159.1:273-312_length:40_mod0000 -M_T0_RID83_S1_NZ_JBDYLZ010000007.1:155539-155585_length:47_mod0000 -M_T0_RID83_S1_NZ_JBDYRX010000002.1:263346-263422_length:77_mod0000 -M_T0_RID84_S0_NZ_JBDYRX010000003.1:240685-240765_length:81_mod0000 -M_T0_RID84_S1_NZ_JBDYRX010000003.1:51637-51745_length:109_mod0000 -M_T0_RID85_S0_NZ_JBDYRX010000002.1:107354-107402_length:49_mod0000 -M_T0_RID85_S1_NC_023297.1:177-263_length:87_mod0000 -M_T0_RID85_S1_NC_030201.1:3764-3811_length:48_mod0000 -M_T0_RID85_S1_NZ_JBDYRX010000002.1:35225-35277_length:53_mod0000 -M_T0_RID86_S1_NC_028137.1:1830-1905_length:76_mod0000 -M_T0_RID86_S1_NC_033828.1:2664-2773_length:110_mod0000 -M_T0_RID86_S1_NZ_JBDYSJ010000001.1:383616-383681_length:66_mod0000 -M_T0_RID87_S0_NC_027631.1:5088-5147_length:60_mod0000 -M_T0_RID87_S0_NZ_JBDYLZ010000008.1:117199-117277_length:79_mod0000 -M_T0_RID87_S1_NZ_JBDYRX010000002.1:176453-176540_length:88_mod0000 -M_T0_RID89_S0_NC_028814.1:25832-25905_length:74_mod0000 -M_T0_RID89_S0_NZ_JBDYLZ010000010.1:109306-109408_length:103_mod0000 -M_T0_RID89_S1_NC_029064.1:9889-9971_length:83_mod0000 -M_T0_RID91_S0_NC_029997.2:19677-19742_length:66_mod0000 -M_T0_RID91_S0_NZ_JBDYSJ010000002.1:541980-542048_length:69_mod0001 -M_T0_RID91_S1_NC_028636.1:131522-131574_length:53_mod0000 -M_T0_RID91_S1_NZ_JBDYLZ010000015.1:73113-73211_length:99_mod0000 -M_T0_RID91_S1_NZ_JBDYRX010000002.1:531098-531224_length:127_mod0000 -M_T0_RID91_S1_NZ_JBDYSJ010000001.1:75425-75512_length:88_mod0000 -M_T0_RID92_S0_NC_033847.1:907-971_length:65_mod0001 -M_T0_RID92_S0_NZ_JBDYRX010000001.1:204153-204204_length:52_mod0000 -M_T0_RID93_S0_NC_029131.1:6029-6095_length:67_mod0000 -M_T0_RID93_S1_NZ_JBDYRX010000002.1:30248-30359_length:112_mod0000 -M_T0_RID94_S0_NC_028142.1:627-700_length:74_mod0000 -M_T0_RID94_S0_NC_033702.1:1317-1400_length:84_mod0000 -M_T0_RID94_S0_NC_033717.1:1284-1386_length:103_mod0000 -M_T0_RID95_S0_NC_018072.1:2591-2635_length:45_mod0000 -M_T0_RID95_S0_NC_027136.1:2231-2280_length:50_mod0000 -M_T0_RID95_S0_NC_029996.1:90789-90865_length:77_mod0000 -M_T0_RID95_S0_NZ_JBDYRX010000002.1:319590-319635_length:46_mod0000 -M_T0_RID95_S1_NC_033620.1:5347-5437_length:91_mod0000 -M_T0_RID96_S0_NC_028636.1:10556-10617_length:62_mod0000 -M_T0_RID96_S1_NC_028143.1:314-390_length:77_mod0000 -M_T0_RID97_S1_NZ_JBDYRX010000001.1:866338-866401_length:64_mod0001 -M_T0_RID97_S1_NZ_JBDYRX010000003.1:178272-178304_length:33_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000013.1:5680-5725_length:46_mod0000 -M_T0_RID98_S0_NZ_JBDYLZ010000028.1:866-932_length:67_mod0000 -M_T0_RID98_S1_NC_029996.1:10631-10716_length:86_mod0000 -M_T0_RID99_S0_NC_030838.1:2068-2122_length:55_mod0000 -M_T0_RID99_S0_NC_031248.1:3321-3367_length:47_mod0000 -M_T0_RID99_S1_NC_027916.2:30126-30210_length:85_mod0000 -M_T0_RID99_S1_NC_030240.1:40035-40122_length:88_mod0000 -M_T0_RID99_S1_NC_031336.1:14128-14251_length:124_mod0001 -M_T0_RID99_S1_NZ_JBDYSJ010000001.1:396202-396267_length:66_mod0000 -M_T0_RID100_S0_NC_028376.1:14572-14682_length:111_mod0000 -M_T0_RID100_S0_NC_030697.1:970-1055_length:86_mod0000 -M_T0_RID100_S0_NZ_JBDYRX010000002.1:758402-758505_length:104_mod0000 -M_T0_RID101_S0_NZ_JBDYSJ010000001.1:645109-645147_length:39_mod0000 -M_T0_RID102_S0_NC_029255.1:63250-63323_length:74_mod0000 -M_T0_RID102_S0_NZ_JBDYSJ010000001.1:237444-237513_length:70_mod0000 -M_T0_RID103_S0_NC_028476.1:713-824_length:112_mod0000 -M_T0_RID103_S1_NC_031314.1:1276-1385_length:110_mod0000 -M_T0_RID103_S1_NC_031463.1:18479-18581_length:103_mod0000 -M_T0_RID103_S1_NZ_JBDYRX010000003.1:535271-535363_length:93_mod0000 -M_T0_RID105_S0_NC_030118.1:8503-8572_length:70_mod0000 -M_T0_RID105_S1_NC_027712.1:9939-9971_length:33_mod0000 -M_T0_RID105_S1_NC_030472.1:4177-4227_length:51_mod0000 -M_T0_RID106_S1_NC_028382.1:483-531_length:49_mod0000 -M_T0_RID106_S1_NZ_JBDYLZ010000017.1:12627-12692_length:66_mod0000 -M_T0_RID106_S1_NZ_JBDYRX010000001.1:885175-885267_length:93_mod0000 -M_T0_RID106_S1_NZ_JBDYSJ010000001.1:754603-754673_length:71_mod0000 -M_T0_RID107_S0_NZ_JBDYRX010000002.1:887203-887264_length:62_mod0000 -M_T0_RID107_S1_NC_027016.1:87956-88044_length:89_mod0000 -M_T0_RID107_S1_NC_028478.1:299-392_length:94_mod0000 -M_T0_RID107_S1_NZ_JBDYRX010000003.1:166903-166964_length:62_mod0001 -M_T0_RID107_S1_NZ_JBDYSJ010000001.1:252763-252845_length:83_mod0000 -M_T0_RID108_S1_NC_033767.1:689-744_length:56_mod0000 -M_T0_RID108_S1_NZ_JBDYSJ010000003.1:468268-468339_length:72_mod0000 -M_T0_RID109_S0_NZ_JBDYRX010000001.1:988451-988536_length:86_mod0000 -M_T0_RID110_S1_NC_028099.1:36637-36726_length:90_mod0000 -M_T0_RID110_S1_NZ_JBDYLZ010000015.1:71842-71908_length:67_mod0000 -M_T0_RID111_S0_NC_030232.1:3068-3100_length:33_mod0000 -M_T0_RID111_S0_NZ_JBDYRX010000002.1:284375-284457_length:83_mod0000 -M_T0_RID111_S1_NC_028491.1:22651-22727_length:77_mod0000 -M_T0_RID112_S1_NZ_JBDYRX010000004.1:227206-227261_length:56_mod0000 -M_T0_RID112_S1_NZ_JBDYSJ010000003.1:186720-186750_length:31_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000008.1:103905-103950_length:46_mod0000 -M_T0_RID113_S0_NZ_JBDYLZ010000017.1:43421-43530_length:110_mod0000 -M_T0_RID114_S0_NZ_JBDYSJ010000001.1:888974-889061_length:88_mod0000 -M_T0_RID114_S1_NC_028485.1:4265-4351_length:87_mod0000 -M_T0_RID114_S1_NC_030654.1:5564-5612_length:49_mod0000 -M_T0_RID114_S1_NC_033763.1:670-745_length:76_mod0000 -M_T0_RID114_S1_NZ_JBDYSJ010000001.1:20373-20432_length:60_mod0000 -M_T0_RID115_S0_NC_033781.1:4795-4906_length:112_mod0000 -M_T0_RID115_S1_NC_031236.1:618-674_length:57_mod0000 -M_T0_RID116_S0_NC_028833.1:24900-24930_length:31_mod0000 -M_T0_RID116_S0_NZ_JBDYSJ010000001.1:278209-278280_length:72_mod0000 -M_T0_RID117_S0_NC_028491.1:76819-76945_length:127_mod0000 -M_T0_RID117_S0_NC_028636.1:51360-51406_length:47_mod0000 -M_T0_RID117_S0_NZ_JBDYRX010000002.1:695385-695511_length:127_mod0000 -M_T0_RID117_S0_NZ_JBDYSJ010000004.1:214232-214301_length:70_mod0000 -M_T0_RID117_S1_NZ_JBDYSJ010000001.1:254125-254189_length:65_mod0000 -M_T0_RID118_S1_NC_017967.1:3728-3792_length:65_mod0000 -M_T0_RID118_S1_NZ_JBDYLZ010000012.1:104385-104434_length:50_mod0000 -M_T0_RID118_S1_NZ_JBDYRX010000003.1:569089-569158_length:70_mod0000 -M_T0_RID119_S0_NC_027138.1:1980-2027_length:48_mod0000 -M_T0_RID119_S0_NZ_JBDYRX010000001.1:479636-479698_length:63_mod0000 -M_T0_RID119_S1_NC_030750.1:2333-2363_length:31_mod0000 -M_T0_RID120_S0_NZ_JBDYRX010000004.1:143311-143407_length:97_mod0000 -M_T0_RID120_S0_NZ_JBDYSJ010000002.1:211897-211962_length:66_mod0000 -M_T0_RID120_S1_NC_029255.1:99346-99425_length:80_mod0000 -M_T0_RID120_S1_NZ_JBDYLZ010000008.1:182987-183039_length:53_mod0000 -M_T0_RID121_S1_NZ_JBDYRX010000003.1:22645-22773_length:129_mod0000 -M_T0_RID122_S0_NZ_JBDYSJ010000002.1:28060-28162_length:103_mod0000 -M_T0_RID122_S1_NZ_JBDYRX010000002.1:593335-593394_length:60_mod0000 -M_T0_RID123_S1_NC_029932.1:780-841_length:62_mod0000 -M_T0_RID123_S1_NZ_JBDYRX010000002.1:624572-624628_length:57_mod0000 -M_T0_RID123_S1_NZ_JBDYSJ010000003.1:205052-205133_length:82_mod0000 -M_T0_RID124_S0_NC_018105.1:1032-1078_length:47_mod0000 -M_T0_RID124_S0_NC_027016.1:37306-37377_length:72_mod0000 -M_T0_RID124_S0_NC_027430.1:2075-2124_length:50_mod0000 -M_T0_RID124_S0_NC_033751.1:1175-1283_length:109_mod0000 -M_T0_RID124_S0_NZ_JBDYLZ010000012.1:107683-107735_length:53_mod0000 -M_T0_RID124_S1_NC_029783.1:12839-12935_length:97_mod0000 -M_T0_RID125_S1_NC_024911.1:585-717_length:133_mod0000 -M_T0_RID125_S1_NZ_JBDYRX010000002.1:524061-524121_length:61_mod0000 -M_T0_RID126_S0_NZ_JBDYSJ010000003.1:204369-204435_length:67_mod0000 -M_T0_RID126_S1_NC_027136.1:6692-6786_length:95_mod0000 -M_T0_RID126_S1_NZ_JBDYLZ010000007.1:147969-148026_length:58_mod0000 -M_T0_RID126_S1_NZ_JBDYSJ010000001.1:849768-849826_length:59_mod0000 -M_T0_RID127_S0_NZ_JBDYLZ010000019.1:20624-20673_length:50_mod0000 -M_T0_RID127_S1_NC_033619.1:4029-4155_length:127_mod0000 -M_T0_RID127_S1_NZ_JBDYRX010000004.1:112527-112563_length:37_mod0000 -M_T0_RID128_S0_NC_033620.1:26172-26261_length:90_mod0000 -M_T0_RID128_S0_NZ_JBDYSJ010000001.1:127550-127596_length:47_mod0000 -M_T0_RID128_S1_NZ_JBDYLZ010000010.1:81225-81326_length:102_mod0000 -M_T0_RID129_S0_NC_028372.1:12347-12414_length:68_mod0001 -M_T0_RID129_S0_NC_030844.1:4967-5083_length:117_mod0001 -M_T0_RID129_S1_NZ_JBDYSJ010000001.1:451837-451880_length:44_mod0000 -M_T0_RID130_S0_NZ_JBDYSJ010000001.1:904477-904569_length:93_mod0000 -M_T0_RID130_S1_NC_030400.1:8920-8964_length:45_mod0000 -M_T0_RID131_S0_NC_030200.1:24540-24653_length:114_mod0000 -M_T0_RID131_S0_NZ_JBDYRX010000004.1:307376-307435_length:60_mod0001 -M_T0_RID131_S1_NZ_JBDYRX010000002.1:215925-215981_length:57_mod0000 -M_T0_RID132_S0_NC_029132.1:26524-26609_length:86_mod0000 -M_T0_RID132_S0_NZ_JBDYRX010000002.1:856095-856160_length:66_mod0000 -M_T0_RID132_S1_NC_028099.1:70003-70100_length:98_mod0000 -M_T0_RID132_S1_NC_028636.1:77454-77493_length:40_mod0000 -M_T0_RID133_S0_NC_027210.1:8798-8910_length:113_mod0000 -M_T0_RID133_S1_NZ_JBDYLZ010000014.1:82781-82835_length:55_mod0000 -M_T0_RID134_S0_NC_034266.1:203255-203287_length:33_mod0000 -M_T0_RID134_S1_NC_033705.1:7105-7262_length:158_mod0000 -M_T0_RID135_S0_NC_033733.1:6746-6806_length:61_mod0000 -M_T0_RID135_S1_NZ_JBDYSJ010000004.1:255279-255341_length:63_mod0000 -M_T0_RID136_S0_NZ_JBDYSJ010000001.1:562721-562768_length:48_mod0000 -M_T0_RID136_S1_NC_030200.1:80911-80976_length:66_mod0001 -M_T0_RID136_S1_NZ_JBDYLZ010000009.1:44314-44384_length:71_mod0000 -M_T0_RID136_S1_NZ_JBDYLZ010000018.1:9886-9961_length:76_mod0000 -M_T0_RID136_S1_NZ_JBDYRX010000001.1:825042-825123_length:82_mod0000 -M_T0_RID137_S0_NC_031083.1:11357-11420_length:64_mod0000 -M_T0_RID137_S0_NZ_JBDYSJ010000002.1:311215-311270_length:56_mod0000 -M_T0_RID137_S1_NC_034266.1:15288-15392_length:105_mod0000 -M_T0_RID137_S1_NZ_JBDYSJ010000002.1:109720-109762_length:43_mod0000 -M_T0_RID138_S0_NC_033730.1:4735-4793_length:59_mod0000 -M_T0_RID139_S0_NC_029076.1:5391-5472_length:82_mod0000 -M_T0_RID139_S0_NC_029131.1:3428-3518_length:91_mod0000 -M_T0_RID139_S1_NC_027128.1:7467-7524_length:58_mod0000 -M_T0_RID139_S1_NC_033730.1:8262-8350_length:89_mod0000 -M_T0_RID140_S0_NC_031216.1:8965-9047_length:83_mod0000 -M_T0_RID140_S1_NC_029996.1:128484-128577_length:94_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000007.1:238838-238873_length:36_mod0000 -M_T0_RID141_S0_NZ_JBDYLZ010000015.1:16859-16896_length:38_mod0000 -M_T0_RID142_S0_NC_027916.2:139729-139809_length:81_mod0001 -M_T0_RID142_S0_NC_030873.1:562-633_length:72_mod0000 -M_T0_RID142_S0_NZ_JBDYSJ010000003.1:9947-10048_length:102_mod0001 -M_T0_RID144_S0_NC_030200.1:1026-1085_length:60_mod0001 -M_T0_RID144_S0_NZ_JBDYRX010000002.1:297802-297909_length:108_mod0000 -M_T0_RID145_S0_NZ_JBDYSJ010000001.1:690815-690908_length:94_mod0000 -M_T0_RID146_S0_NC_028636.1:8587-8640_length:54_mod0000 -M_T0_RID147_S0_NC_030839.1:401-442_length:42_mod0000 -M_T0_RID147_S1_NZ_JBDYRX010000002.1:330619-330694_length:76_mod0000 -M_T0_RID148_S1_NZ_JBDYRX010000002.1:14264-14309_length:46_mod0000 -M_T0_RID149_S0_NZ_JBDYSJ010000001.1:617340-617447_length:108_mod0000 -M_T0_RID149_S1_NC_028249.1:10239-10323_length:85_mod0000 -M_T0_RID149_S1_NZ_JBDYLZ010000008.1:120921-120959_length:39_mod0000 -M_T0_RID150_S1_NZ_JBDYRX010000004.1:384747-384794_length:48_mod0000 -M_T0_RID152_S1_NZ_JBDYRX010000004.1:353714-353802_length:89_mod0000 -M_T0_RID153_S0_NZ_JBDYRX010000003.1:52603-52715_length:113_mod0000 -M_T0_RID153_S1_NC_028364.1:137-249_length:113_mod0000 -M_T0_RID154_S0_NZ_JBDYRX010000003.1:602237-602274_length:38_mod0000 -M_T0_RID154_S1_NC_028386.1:1116-1181_length:66_mod0000 -M_T0_RID154_S1_NC_033620.1:12644-12716_length:73_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000002.1:675599-675679_length:81_mod0000 -M_T0_RID154_S1_NZ_JBDYRX010000003.1:514528-514581_length:54_mod0000 -M_T0_RID155_S0_NC_033701.1:9275-9317_length:43_mod0000 -M_T0_RID156_S1_NC_023295.1:2064-2141_length:78_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000006.1:281471-281567_length:97_mod0000 -M_T0_RID157_S1_NZ_JBDYLZ010000011.1:132268-132312_length:45_mod0000 -M_T0_RID158_S1_NC_028241.1:531-607_length:77_mod0000 -M_T0_RID159_S0_NC_029311.1:69011-69045_length:35_mod0000 -M_T0_RID159_S0_NC_031216.1:6290-6405_length:116_mod0000 -M_T0_RID159_S0_NC_033620.1:32537-32621_length:85_mod0000 -M_T0_RID159_S0_NZ_JBDYSJ010000002.1:600959-600995_length:37_mod0000 -M_T0_RID161_S1_NC_030240.1:83741-83790_length:50_mod0000 -M_T0_RID162_S0_NZ_JBDYLZ010000008.1:5183-5216_length:34_mod0000 -M_T0_RID162_S1_NC_017862.1:7381-7452_length:72_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:584559-584609_length:51_mod0000 -M_T0_RID162_S1_NZ_JBDYSJ010000001.1:726659-726738_length:80_mod0000 -M_T0_RID163_S0_NC_033620.1:156883-156969_length:87_mod0000 -M_T0_RID163_S1_NC_030275.1:100083-100169_length:87_mod0000 -M_T0_RID164_S0_NZ_JBDYLZ010000018.1:17968-18030_length:63_mod0000 -M_T0_RID164_S1_NC_033620.1:130668-130713_length:46_mod0000 -M_T0_RID164_S1_NZ_JBDYRX010000004.1:519479-519563_length:85_mod0000 -M_T0_RID165_S0_NC_027917.1:1959-2051_length:93_mod0000 -M_T0_RID166_S0_NZ_JBDYRX010000004.1:59696-59805_length:110_mod0000 -M_T0_RID167_S0_NZ_JBDYLZ010000007.1:38370-38443_length:74_mod0000 -M_T0_RID168_S0_NC_030225.1:5381-5465_length:85_mod0001 -M_T0_RID168_S0_NC_030236.1:5080-5154_length:75_mod0000 -M_T0_RID169_S0_NC_028263.1:913-994_length:82_mod0000 -M_T0_RID169_S0_NZ_JBDYLZ010000007.1:16953-17017_length:65_mod0000 -M_T0_RID169_S1_NC_017970.1:7200-7322_length:123_mod0000 -M_T0_RID169_S1_NC_027016.1:84360-84421_length:62_mod0000 -M_T0_RID169_S1_NC_031295.1:1211-1283_length:73_mod0001 -M_T0_RID170_S1_NZ_JBDYRX010000001.1:71554-71642_length:89_mod0000 -M_T0_RID171_S0_NC_023429.1:1938-1983_length:46_mod0000 -M_T0_RID171_S0_NZ_JBDYRX010000001.1:944221-944313_length:93_mod0001 -M_T0_RID171_S1_NC_028891.1:8612-8645_length:34_mod0000 -M_T0_RID172_S0_NC_031455.1:2261-2316_length:56_mod0000 -M_T0_RID172_S1_NC_028383.1:1536-1621_length:86_mod0000 -M_T0_RID172_S1_NC_031293.1:5209-5302_length:94_mod0000 -M_T0_RID172_S1_NZ_JBDYSJ010000002.1:22259-22312_length:54_mod0000 -M_T0_RID173_S0_NC_033710.1:8523-8561_length:39_mod0000 -M_T0_RID173_S0_NZ_JBDYRX010000004.1:391209-391337_length:129_mod0000 -M_T0_RID173_S1_NZ_JBDYLZ010000022.1:5769-5818_length:50_mod0000 -M_T0_RID173_S1_NZ_JBDYSJ010000001.1:629973-630049_length:77_mod0000 -M_T0_RID174_S1_NC_030158.1:2752-2787_length:36_mod0000 -M_T0_RID174_S1_NC_031339.1:433-463_length:31_mod0000 -M_T0_RID174_S1_NZ_JBDYLZ010000006.1:10668-10748_length:81_mod0000 -M_T0_RID175_S0_NZ_JBDYLZ010000018.1:25042-25131_length:90_mod0000 -M_T0_RID175_S1_NZ_JBDYSJ010000001.1:899529-899569_length:41_mod0000 -M_T0_RID176_S0_NC_030200.1:58204-58287_length:84_mod0000 -M_T0_RID176_S0_NZ_JBDYRX010000002.1:668726-668775_length:50_mod0000 -M_T0_RID176_S1_NZ_JBDYSJ010000003.1:471518-471566_length:49_mod0001 -M_T0_RID177_S1_NZ_JBDYRX010000002.1:466682-466753_length:72_mod0000 -M_T0_RID178_S0_NC_028099.1:31084-31207_length:124_mod0000 -M_T0_RID178_S0_NC_033620.1:149729-149799_length:71_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000001.1:853106-853172_length:67_mod0000 -M_T0_RID178_S0_NZ_JBDYRX010000002.1:203092-203185_length:94_mod0000 -M_T0_RID179_S0_NC_023442.1:39001-39088_length:88_mod0000 -M_T0_RID179_S0_NZ_JBDYRX010000004.1:52140-52225_length:86_mod0000 -M_T0_RID179_S0_NZ_JBDYSJ010000001.1:721050-721084_length:35_mod0001 -M_T0_RID180_S0_NZ_JBDYSJ010000002.1:534591-534638_length:48_mod0000 -M_T0_RID180_S1_NC_029801.1:1212-1290_length:79_mod0000 -M_T0_RID181_S0_NC_023420.2:1575-1682_length:108_mod0000 -M_T0_RID181_S0_NZ_JBDYSJ010000001.1:400625-400659_length:35_mod0000 -M_T0_RID181_S1_NZ_JBDYLZ010000022.1:10488-10567_length:80_mod0000 -M_T0_RID182_S1_NC_030115.1:4690-4735_length:46_mod0000 -M_T0_RID183_S0_NC_029996.1:43664-43722_length:59_mod0000 -M_T0_RID185_S1_NZ_JBDYRX010000003.1:308336-308406_length:71_mod0001 -M_T0_RID185_S1_NZ_JBDYRX010000004.1:191608-191699_length:92_mod0000 -M_T0_RID187_S0_NC_029132.1:3505-3621_length:117_mod0000 -M_T0_RID187_S1_NC_028833.1:12138-12185_length:48_mod0001 -M_T0_RID187_S1_NZ_JBDYLZ010000007.1:48250-48349_length:100_mod0000 -M_T0_RID187_S1_NZ_JBDYRX010000001.1:251442-251541_length:100_mod0000 -M_T0_RID188_S0_NC_033620.1:60461-60546_length:86_mod0000 -M_T0_RID188_S0_NC_033745.1:5844-5924_length:81_mod0000 -M_T0_RID188_S1_NC_030746.1:5743-5836_length:94_mod0000 -M_T0_RID188_S1_NZ_JBDYSJ010000001.1:693404-693463_length:60_mod0000 -M_T0_RID190_S0_NC_028099.1:110295-110391_length:97_mod0000 -M_T0_RID190_S0_NC_031463.1:15502-15572_length:71_mod0000 -M_T0_RID190_S0_NZ_JBDYSJ010000002.1:205146-205255_length:110_mod0000 -M_T0_RID190_S1_NC_031291.1:89-172_length:84_mod0000 -M_T0_RID190_S1_NZ_JBDYRX010000001.1:953429-953485_length:57_mod0001 -M_T0_RID191_S0_NC_028811.1:13630-13691_length:62_mod0000 -M_T0_RID191_S0_NC_029255.1:128444-128478_length:35_mod0000 -M_T0_RID191_S1_NC_027706.1:673-702_length:30_mod0000 -M_T0_RID192_S0_NC_030202.1:1974-2037_length:64_mod0000 -M_T0_RID192_S0_NZ_JBDYSJ010000002.1:499003-499042_length:40_mod0000 -M_T0_RID192_S1_NC_028266.1:2491-2562_length:72_mod0000 -M_T0_RID192_S1_NC_029935.1:3672-3749_length:78_mod0000 -M_T0_RID193_S0_NC_030796.1:1139-1218_length:80_mod0000 -M_T0_RID193_S0_NZ_JBDYLZ010000006.1:65091-65167_length:77_mod0000 -M_T0_RID193_S1_NC_029311.1:3962-4023_length:62_mod0000 -M_T0_RID193_S1_NC_029854.1:2071-2138_length:68_mod0001 -M_T0_RID193_S1_NZ_JBDYLZ010000018.1:32241-32282_length:42_mod0000 -M_T0_RID193_S1_NZ_JBDYSJ010000004.1:33272-33325_length:54_mod0000 -M_T0_RID194_S0_NZ_JBDYRX010000001.1:29953-30068_length:116_mod0000 -M_T0_RID194_S1_NC_027117.1:4-75_length:72_mod0000 -M_T0_RID194_S1_NZ_JBDYSJ010000002.1:458031-458124_length:94_mod0000 -M_T0_RID195_S0_NC_029126.1:5551-5630_length:80_mod0000 -M_T0_RID195_S0_NC_030117.1:78912-78948_length:37_mod0000 -M_T0_RID195_S0_NZ_JBDYLZ010000010.1:56983-57024_length:42_mod0000 -M_T0_RID196_S0_NC_028891.1:12640-12710_length:71_mod0000 -M_T0_RID196_S0_NZ_JBDYSJ010000001.1:166064-166125_length:62_mod0000 -M_T0_RID196_S1_NC_029306.1:173-274_length:102_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000001.1:85071-85115_length:45_mod0000 -M_T0_RID197_S0_NZ_JBDYRX010000003.1:358250-358311_length:62_mod0001 -M_T0_RID198_S1_NZ_JBDYLZ010000012.1:46495-46566_length:72_mod0000 -M_T0_RID198_S1_NZ_JBDYSJ010000001.1:185655-185715_length:61_mod0000 -M_T0_RID199_S0_NZ_JBDYRX010000001.1:904336-904396_length:61_mod0000 -M_T0_RID200_S1_NZ_JBDYRX010000001.1:660511-660552_length:42_mod0000 -M_T0_RID201_S0_NZ_JBDYLZ010000028.1:698-764_length:67_mod0000 -M_T0_RID201_S1_NZ_JBDYSJ010000001.1:587635-587727_length:93_mod0000 -M_T0_RID202_S0_NZ_JBDYLZ010000009.1:73121-73183_length:63_mod0000 -M_T0_RID203_S1_NC_027923.1:89467-89574_length:108_mod0000 -M_T0_RID203_S1_NC_028470.1:6286-6372_length:87_mod0000 -M_T0_RID204_S0_NZ_JBDYSJ010000003.1:424711-424783_length:73_mod0000 -M_T0_RID204_S1_NZ_JBDYLZ010000009.1:157953-158008_length:56_mod0000 -M_T0_RID205_S0_NC_028806.1:14973-15042_length:70_mod0001 -M_T0_RID205_S0_NC_031336.1:5585-5707_length:123_mod0000 -M_T0_RID205_S0_NC_033710.1:1140-1174_length:35_mod0001 -M_T0_RID205_S0_NC_034377.1:309-345_length:37_mod0000 -M_T0_RID205_S0_NZ_JBDYRX010000001.1:648020-648102_length:83_mod0000 -M_T0_RID206_S0_NZ_JBDYRX010000003.1:657781-657875_length:95_mod0000 -M_T0_RID206_S1_NZ_JBDYSJ010000002.1:507837-507900_length:64_mod0000 -M_T0_RID207_S0_NC_029782.1:2571-2655_length:85_mod0000 -M_T0_RID207_S0_NC_033756.1:9757-9804_length:48_mod0000 -M_T0_RID207_S1_NC_028470.1:3881-3944_length:64_mod0000 -M_T0_RID207_S1_NC_029111.1:391-425_length:35_mod0000 -M_T0_RID208_S1_NC_028137.1:3146-3238_length:93_mod0000 -M_T0_RID209_S1_NC_027016.1:200405-200534_length:130_mod0000 -M_T0_RID209_S1_NZ_JBDYRX010000003.1:693765-693849_length:85_mod0000 -M_T0_RID211_S0_NC_030749.1:1821-1921_length:101_mod0000 -M_T0_RID211_S0_NZ_JBDYSJ010000002.1:199161-199238_length:78_mod0000 -M_T0_RID212_S0_NC_028462.1:2849-2888_length:40_mod0000 -M_T0_RID212_S0_NC_031272.1:7400-7455_length:56_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:220611-220694_length:84_mod0000 -M_T0_RID212_S0_NZ_JBDYRX010000002.1:824198-824247_length:50_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000002.1:522607-522670_length:64_mod0000 -M_T0_RID213_S0_NZ_JBDYSJ010000003.1:35532-35575_length:44_mod0000 -M_T0_RID213_S1_NC_027619.1:3998-4074_length:77_mod0000 -M_T0_RID214_S0_NC_017990.1:4036-4109_length:74_mod0000 -M_T0_RID214_S0_NZ_JBDYRX010000004.1:6306-6380_length:75_mod0000 -M_T0_RID214_S1_NZ_JBDYLZ010000016.1:26291-26346_length:56_mod0001 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:332282-332360_length:79_mod0000 -M_T0_RID215_S0_NZ_JBDYRX010000004.1:457564-457597_length:34_mod0000 -M_T0_RID215_S1_NZ_JBDYRX010000004.1:547476-547541_length:66_mod0000 -M_T0_RID217_S0_NC_030922.1:6414-6531_length:118_mod0000 -M_T0_RID217_S0_NZ_JBDYRX010000001.1:366993-367094_length:102_mod0000 -M_T0_RID217_S1_NC_017970.1:8697-8737_length:41_mod0000 -M_T0_RID217_S1_NC_018482.1:2018-2099_length:82_mod0000 -M_T0_RID219_S0_NZ_JBDYLZ010000006.1:135272-135372_length:101_mod0001 -M_T0_RID219_S1_NZ_JBDYRX010000003.1:132173-132251_length:79_mod0000 -M_T0_RID220_S0_NC_033725.1:8661-8722_length:62_mod0000 -M_T0_RID220_S1_NZ_JBDYRX010000003.1:133141-133229_length:89_mod0000 -M_T0_RID221_S0_NZ_JBDYRX010000001.1:771011-771087_length:77_mod0000 -M_T0_RID222_S0_NC_037572.1:1818-1871_length:54_mod0000 -M_T0_RID222_S1_NC_028485.1:810-872_length:63_mod0000 -M_T0_RID222_S1_NC_030793.1:2889-2992_length:104_mod0000 -M_T0_RID222_S1_NZ_JBDYRX010000001.1:301419-301533_length:115_mod0001 -M_T0_RID223_S1_NC_033620.1:157690-157751_length:62_mod0000 -M_T0_RID224_S0_NC_017937.1:2859-2949_length:91_mod0000 -M_T0_RID224_S1_NC_028388.1:2224-2291_length:68_mod0001 -M_T0_RID224_S1_NC_033700.1:22817-22886_length:70_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000001.1:692859-692944_length:86_mod0000 -M_T0_RID224_S1_NZ_JBDYRX010000004.1:483631-483701_length:71_mod0000 -M_T0_RID225_S1_NC_029311.1:72416-72523_length:108_mod0000 -M_T0_RID225_S1_NC_030240.1:91908-91984_length:77_mod0000 -M_T0_RID226_S0_NZ_JBDYRX010000001.1:678003-678073_length:71_mod0000 -M_T0_RID226_S1_NZ_JBDYRX010000001.1:984964-985038_length:75_mod0000 -M_T0_RID227_S0_NC_028636.1:35420-35507_length:88_mod0000 -M_T0_RID227_S0_NZ_JBDYLZ010000014.1:18260-18351_length:92_mod0000 -M_T0_RID227_S1_NZ_JBDYLZ010000010.1:2424-2519_length:96_mod0000 -M_T0_RID229_S0_NZ_JBDYRX010000002.1:664717-664801_length:85_mod0000 -M_T0_RID230_S0_NC_033822.1:1869-1967_length:99_mod0000 -M_T0_RID230_S0_NZ_JBDYRX010000002.1:244562-244600_length:39_mod0000 -M_T0_RID231_S0_NC_034017.1:4341-4449_length:109_mod0000 -M_T0_RID231_S0_NZ_JBDYRX010000002.1:364966-365054_length:89_mod0000 -M_T0_RID231_S1_NZ_JBDYRX010000004.1:275949-276005_length:57_mod0001 -M_T0_RID233_S0_NC_030402.1:4056-4127_length:72_mod0000 -M_T0_RID234_S0_NZ_JBDYSJ010000001.1:910286-910315_length:30_mod0000 -M_T0_RID234_S1_NZ_JBDYSJ010000003.1:84105-84229_length:125_mod0000 -M_T0_RID235_S0_NC_029997.2:52965-53016_length:52_mod0000 -M_T0_RID235_S0_NZ_JBDYRX010000004.1:469577-469661_length:85_mod0000 -M_T0_RID235_S1_NC_029993.1:68-156_length:89_mod0000 -M_T0_RID236_S0_NC_027209.1:15-106_length:92_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000001.1:879200-879251_length:52_mod0000 -M_T0_RID236_S0_NZ_JBDYRX010000002.1:665177-665206_length:30_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:172535-172571_length:37_mod0000 -M_T0_RID236_S1_NZ_JBDYRX010000001.1:365370-365448_length:79_mod0000 -M_T0_RID237_S1_NZ_JBDYRX010000003.1:311400-311455_length:56_mod0000 -M_T0_RID237_S1_NZ_JBDYSJ010000001.1:341900-342051_length:152_mod0001 -M_T0_RID237_S1_NZ_JBDYSJ010000002.1:210078-210161_length:84_mod0000 -M_T0_RID239_S1_NZ_JBDYLZ010000008.1:60180-60243_length:64_mod0000 -M_T0_RID240_S0_NC_028376.1:8889-8978_length:90_mod0000 -M_T0_RID240_S0_NZ_JBDYLZ010000011.1:107039-107086_length:48_mod0000 -M_T0_RID240_S1_NC_029255.1:88189-88282_length:94_mod0000 -M_T0_RID242_S0_NC_031275.1:6726-6767_length:42_mod0000 -M_T0_RID242_S1_NZ_JBDYRX010000003.1:456427-456495_length:69_mod0000 -M_T0_RID243_S0_NC_038232.1:593-634_length:42_mod0000 -M_T0_RID244_S0_NZ_JBDYRX010000004.1:71169-71250_length:82_mod0000 -M_T0_RID244_S1_NC_031105.1:1094-1177_length:84_mod0000 -M_T0_RID244_S1_NZ_JBDYRX010000003.1:93344-93453_length:110_mod0000 -M_T0_RID245_S1_NC_027916.2:74440-74509_length:70_mod0000 -M_T0_RID246_S0_NZ_JBDYLZ010000007.1:253179-253255_length:77_mod0000 -M_T0_RID246_S0_NZ_JBDYRX010000003.1:373773-373844_length:72_mod0000 -M_T0_RID247_S1_NC_034240.1:6159-6240_length:82_mod0000 -M_T0_RID247_S1_NZ_JBDYLZ010000006.1:319402-319479_length:78_mod0000 -M_T0_RID248_S1_NZ_JBDYLZ010000021.1:15403-15484_length:82_mod0000 -M_T0_RID248_S1_NZ_JBDYSJ010000002.1:614316-614362_length:47_mod0000 -M_T0_RID249_S1_NZ_JBDYSJ010000002.1:599779-599834_length:56_mod0000 -M_T0_RID250_S0_NC_027916.2:147626-147747_length:122_mod0000 -M_T0_RID250_S0_NC_033620.1:26136-26203_length:68_mod0000 -M_T0_RID251_S1_NZ_JBDYRX010000003.1:388429-388516_length:88_mod0001 -M_T0_RID252_S0_NZ_JBDYRX010000003.1:533554-533659_length:106_mod0000 -M_T0_RID252_S0_NZ_JBDYSJ010000004.1:89796-89871_length:76_mod0000 -M_T0_RID254_S0_NC_029312.1:1320-1415_length:96_mod0000 -M_T0_RID254_S1_NC_033722.1:1513-1562_length:50_mod0000 -M_T0_RID254_S1_NZ_JBDYRX010000003.1:600746-600803_length:58_mod0000 -M_T0_RID255_S1_NZ_JBDYLZ010000009.1:84943-85024_length:82_mod0000 -M_T0_RID256_S0_NZ_JBDYRX010000002.1:72764-72831_length:68_mod0000 -M_T0_RID256_S1_NZ_JBDYSJ010000003.1:105583-105635_length:53_mod0001 -M_T0_RID257_S0_NC_029997.2:11591-11678_length:88_mod0000 -M_T0_RID257_S0_NZ_JBDYLZ010000007.1:42813-42887_length:75_mod0000 -M_T0_RID258_S0_NC_030151.1:5275-5349_length:75_mod0000 -M_T0_RID258_S1_NC_023442.1:46718-46759_length:42_mod0000 -M_T0_RID258_S1_NC_027641.1:2606-2691_length:86_mod0000 -M_T0_RID259_S0_NZ_JBDYRX010000001.1:515399-515441_length:43_mod0000 -M_T0_RID259_S1_NC_033710.1:2139-2199_length:61_mod0001 -M_T0_RID260_S0_NZ_JBDYRX010000004.1:304887-304994_length:108_mod0000 -M_T0_RID261_S0_NC_024913.1:363-436_length:74_mod0000 -M_T0_RID261_S1_NZ_JBDYSJ010000003.1:83891-83937_length:47_mod0000 -M_T0_RID262_S0_NC_028964.1:8465-8506_length:42_mod0000 -M_T0_RID262_S1_NC_028369.1:11507-11563_length:57_mod0000 -M_T0_RID263_S1_NZ_JBDYLZ010000007.1:59938-60023_length:86_mod0000 -M_T0_RID264_S1_NC_030240.1:10284-10380_length:97_mod0000 -M_T0_RID266_S0_NZ_JBDYRX010000003.1:575037-575078_length:42_mod0000 -M_T0_RID268_S0_NZ_JBDYRX010000001.1:768153-768245_length:93_mod0000 -M_T0_RID268_S0_NZ_JBDYSJ010000001.1:798703-798770_length:68_mod0000 -M_T0_RID270_S0_NC_029132.1:95722-95798_length:77_mod0000 -M_T0_RID270_S1_NZ_JBDYSJ010000004.1:222075-222158_length:84_mod0000 -M_T0_RID271_S0_NC_033620.1:162451-162504_length:54_mod0000 -M_T0_RID272_S0_NC_033620.1:33874-33960_length:87_mod0000 -M_T0_RID273_S1_NC_030744.1:7300-7340_length:41_mod0000 -M_T0_RID273_S1_NZ_JBDYRX010000002.1:841729-841840_length:112_mod0000 -M_T0_RID274_S1_NC_037571.1:1402-1475_length:74_mod0000 -M_T0_RID274_S1_NC_037615.1:1507-1556_length:50_mod0000 -M_T0_RID274_S1_NZ_JBDYRX010000002.1:803747-803830_length:84_mod0001 -M_T0_RID276_S0_NZ_JBDYSJ010000001.1:37440-37524_length:85_mod0000 -M_T0_RID276_S1_NZ_JBDYSJ010000003.1:418336-418453_length:118_mod0000 -M_T0_RID277_S1_NZ_JBDYLZ010000010.1:25227-25303_length:77_mod0000 -M_T0_RID277_S1_NZ_JBDYRX010000004.1:42366-42442_length:77_mod0000 -M_T0_RID280_S1_NC_029255.1:110657-110707_length:51_mod0000 -M_T0_RID280_S1_NZ_JBDYLZ010000007.1:148039-148124_length:86_mod0000 -M_T0_RID280_S1_NZ_JBDYSJ010000003.1:358558-358656_length:99_mod0000 -M_T0_RID281_S0_NZ_JBDYRX010000001.1:319973-320043_length:71_mod0000 -M_T0_RID281_S1_NC_033717.1:9058-9157_length:100_mod0000 -M_T0_RID281_S1_NZ_JBDYLZ010000009.1:175718-175802_length:85_mod0000 -M_T0_RID282_S0_NZ_JBDYRX010000002.1:378265-378345_length:81_mod0001 -M_T0_RID283_S1_NC_027016.1:6355-6413_length:59_mod0000 -M_T0_RID283_S1_NC_028230.1:391-510_length:120_mod0000 -M_T0_RID285_S1_NC_034376.1:1364-1410_length:47_mod0000 -M_T0_RID286_S1_NC_027918.1:6177-6259_length:83_mod0000 -M_T0_RID287_S0_NZ_JBDYRX010000003.1:370134-370205_length:72_mod0000 -M_T0_RID289_S0_NZ_JBDYRX010000001.1:744827-744955_length:129_mod0000 -M_T0_RID289_S1_NC_028259.1:3827-3878_length:52_mod0000 -M_T0_RID290_S0_NC_030240.1:45198-45233_length:36_mod0000 -M_T0_RID290_S0_NC_030691.1:1722-1773_length:52_mod0000 -M_T0_RID290_S1_NC_029133.1:4034-4132_length:99_mod0000 -M_T0_RID291_S1_NC_028981.1:5970-6046_length:77_mod0000 -M_T0_RID291_S1_NZ_JBDYSJ010000002.1:464139-464169_length:31_mod0000 -M_T0_RID293_S1_NC_030232.1:2260-2327_length:68_mod0000 -M_T0_RID295_S1_NC_027916.2:61867-61920_length:54_mod0000 -M_T0_RID295_S1_NC_028806.1:27530-27608_length:79_mod0000 -M_T0_RID296_S0_NZ_JBDYSJ010000001.1:184354-184410_length:57_mod0000 -M_T0_RID296_S1_NC_028867.1:5870-5944_length:75_mod0000 -M_T0_RID296_S1_NC_029034.2:6068-6170_length:103_mod0000 -M_T0_RID296_S1_NC_029575.1:1786-1824_length:39_mod0000 -M_T0_RID296_S1_NC_031313.1:8320-8423_length:104_mod0000 -M_T0_RID296_S1_NZ_JBDYRX010000001.1:732093-732144_length:52_mod0000 -M_T0_RID300_S0_NC_030870.1:888-963_length:76_mod0000 -M_T0_RID300_S1_NC_028239.1:12981-13075_length:95_mod0001 -M_T0_RID301_S0_NC_027016.1:47977-48089_length:113_mod0000 -M_T0_RID301_S0_NC_029997.2:77533-77588_length:56_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000001.1:795273-795348_length:76_mod0000 -M_T0_RID301_S1_NZ_JBDYRX010000003.1:723584-723651_length:68_mod0000 -M_T0_RID302_S1_NC_033820.1:4695-4770_length:76_mod0000 -M_T0_RID303_S0_NZ_JBDYSJ010000002.1:596456-596511_length:56_mod0000 -M_T0_RID303_S1_NZ_JBDYLZ010000013.1:92895-92926_length:32_mod0000 -M_T0_RID304_S0_NC_031463.1:20675-20751_length:77_mod0000 -M_T0_RID306_S0_NC_027916.2:96621-96699_length:79_mod0000 -M_T0_RID307_S0_NC_028266.1:10941-10980_length:40_mod0000 -M_T0_RID308_S1_NZ_JBDYLZ010000010.1:103191-103276_length:86_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:370261-370296_length:36_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000001.1:387786-387861_length:76_mod0000 -M_T0_RID308_S1_NZ_JBDYRX010000003.1:389721-389777_length:57_mod0000 -M_T0_RID309_S1_NC_026944.1:4310-4395_length:86_mod0000 -M_T0_RID309_S1_NZ_JBDYSJ010000001.1:151328-151382_length:55_mod0000 -M_T0_RID311_S0_NZ_JBDYLZ010000006.1:59717-59765_length:49_mod0000 -M_T0_RID311_S1_NZ_JBDYLZ010000023.1:5604-5703_length:100_mod0000 -M_T0_RID312_S1_NC_018382.1:3769-3816_length:48_mod0000 -M_T0_RID313_S1_NZ_JBDYRX010000002.1:139751-139865_length:115_mod0000 -M_T0_RID314_S0_NZ_JBDYSJ010000004.1:132522-132621_length:100_mod0000 -M_T0_RID315_S0_NC_033823.1:7820-7860_length:41_mod0000 -M_T0_RID317_S0_NC_034214.1:5951-5996_length:46_mod0000 -M_T0_RID317_S0_NZ_JBDYLZ010000015.1:71185-71277_length:93_mod0000 -M_T0_RID317_S0_NZ_JBDYRX010000004.1:174342-174382_length:41_mod0000 -M_T0_RID317_S1_NC_030293.1:5902-5968_length:67_mod0001 -M_T0_RID318_S0_NC_028814.1:27392-27476_length:85_mod0000 -M_T0_RID318_S0_NZ_JBDYRX010000001.1:771856-771930_length:75_mod0000 -M_T0_RID318_S1_NZ_JBDYLZ010000006.1:119310-119391_length:82_mod0000 -M_T0_RID319_S0_NC_034266.1:62140-62218_length:79_mod0000 -M_T0_RID319_S1_NC_028981.1:4292-4341_length:50_mod0000 -M_T0_RID319_S1_NC_031455.1:2498-2551_length:54_mod0000 -M_T0_RID319_S1_NZ_JBDYRX010000004.1:60929-61033_length:105_mod0000 -M_T0_RID322_S1_NZ_JBDYRX010000003.1:440227-440291_length:65_mod0000 -M_T0_RID323_S0_NC_030240.1:40893-40967_length:75_mod0000 -M_T0_RID323_S0_NZ_JBDYLZ010000007.1:249215-249268_length:54_mod0000 -M_T0_RID324_S0_NC_029311.1:87639-87764_length:126_mod0000 -M_T0_RID324_S0_NZ_JBDYSJ010000002.1:545609-545688_length:80_mod0000 -M_T0_RID324_S1_NZ_JBDYSJ010000003.1:210751-210786_length:36_mod0000 -M_T0_RID325_S1_NC_031240.1:7762-7813_length:52_mod0000 -M_T0_RID326_S0_NZ_JBDYLZ010000009.1:5470-5539_length:70_mod0000 -M_T0_RID328_S1_NZ_JBDYRX010000002.1:171169-171268_length:100_mod0000 -M_T0_RID329_S0_NZ_JBDYRX010000002.1:757356-757453_length:98_mod0000 -M_T0_RID329_S1_NZ_JBDYLZ010000008.1:68972-69065_length:94_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:680879-680974_length:96_mod0000 -M_T0_RID330_S0_NZ_JBDYSJ010000001.1:706464-706551_length:88_mod0000 -M_T0_RID331_S0_NC_029255.1:77095-77131_length:37_mod0000 -M_T0_RID331_S0_NC_030240.1:62248-62311_length:64_mod0000 -M_T0_RID331_S1_NC_030126.1:1582-1653_length:72_mod0001 -M_T0_RID331_S1_NC_033707.1:5319-5406_length:88_mod0000 -M_T0_RID331_S1_NZ_JBDYLZ010000016.1:42739-42823_length:85_mod0000 -M_T0_RID332_S0_NZ_JBDYSJ010000004.1:35297-35358_length:62_mod0000 -M_T0_RID333_S0_NZ_JBDYLZ010000014.1:79014-79074_length:61_mod0000 -M_T0_RID333_S1_NC_027647.1:655-726_length:72_mod0000 -M_T0_RID333_S1_NC_033620.1:54726-54845_length:120_mod0000 -M_T0_RID334_S0_NZ_JBDYRX010000002.1:455003-455101_length:99_mod0000 -M_T0_RID335_S0_NZ_JBDYRX010000002.1:694573-694718_length:146_mod0000 -M_T0_RID335_S1_NZ_JBDYSJ010000001.1:102384-102461_length:78_mod0000 -M_T0_RID337_S0_NC_028368.1:13695-13792_length:98_mod0000 -M_T0_RID338_S0_NZ_JBDYRX010000001.1:578324-578379_length:56_mod0000 -M_T0_RID338_S1_NZ_JBDYRX010000003.1:471689-471760_length:72_mod0000 -M_T0_RID339_S1_NC_028362.1:1132-1236_length:105_mod0000 -M_T0_RID339_S1_NZ_JBDYRX010000003.1:626110-626150_length:41_mod0000 -M_T0_RID339_S1_NZ_JBDYSJ010000002.1:576422-576503_length:82_mod0000 -M_T0_RID340_S0_NC_028973.1:4682-4727_length:46_mod0000 -M_T0_RID340_S0_NC_029132.1:93532-93576_length:45_mod0000 -M_T0_RID341_S0_NC_030240.1:112206-112263_length:58_mod0000 -M_T0_RID341_S0_NC_034252.1:1229-1329_length:101_mod0000 -M_T0_RID342_S0_NZ_JBDYLZ010000011.1:111949-111982_length:34_mod0001 -M_T0_RID342_S1_NZ_JBDYLZ010000008.1:135318-135406_length:89_mod0001 -M_T0_RID343_S0_NC_029996.1:68953-69051_length:99_mod0000 -M_T0_RID344_S1_NC_030148.1:11118-11172_length:55_mod0000 -M_T0_RID345_S0_NZ_JBDYRX010000002.1:64932-64977_length:46_mod0000 -M_T0_RID346_S1_NZ_JBDYRX010000003.1:433612-433704_length:93_mod0000 -M_T0_RID347_S0_NC_036636.1:7712-7773_length:62_mod0000 -M_T0_RID347_S1_NZ_JBDYRX010000002.1:59074-59138_length:65_mod0000 -M_T0_RID347_S1_NZ_JBDYSJ010000003.1:117376-117430_length:55_mod0001 -M_T0_RID348_S0_NZ_JBDYRX010000001.1:1015831-1015930_length:100_mod0000 -M_T0_RID348_S1_NZ_JBDYRX010000001.1:141445-141557_length:113_mod0000 -M_T0_RID349_S0_NC_030391.1:4068-4155_length:88_mod0001 -M_T0_RID349_S0_NZ_JBDYRX010000001.1:226925-227009_length:85_mod0000 -M_T0_RID349_S1_NZ_JBDYRX010000003.1:358370-358434_length:65_mod0000 -M_T0_RID351_S0_NC_033753.1:4226-4317_length:92_mod0000 -M_T0_RID352_S1_NC_028259.1:56-127_length:72_mod0000 -M_T0_RID352_S1_NC_028395.1:155-248_length:94_mod0000 -M_T0_RID352_S1_NC_029931.1:9204-9241_length:38_mod0000 -M_T0_RID353_S0_NZ_JBDYLZ010000009.1:48165-48236_length:72_mod0000 -M_T0_RID354_S1_NZ_JBDYLZ010000012.1:45797-45922_length:126_mod0000 -M_T0_RID356_S0_NC_028378.1:3454-3530_length:77_mod0000 -M_T0_RID357_S0_NZ_JBDYRX010000002.1:120553-120591_length:39_mod0000 -M_T0_RID357_S1_NZ_JBDYSJ010000004.1:245908-245957_length:50_mod0000 -M_T0_RID358_S0_NC_029126.1:5901-5938_length:38_mod0000 -M_T0_RID358_S1_NC_028140.1:1554-1651_length:98_mod0000 -M_T0_RID358_S1_NZ_JBDYSJ010000002.1:580725-580785_length:61_mod0001 -M_T0_RID359_S0_NZ_JBDYRX010000001.1:601220-601298_length:79_mod0000 -M_T0_RID360_S0_NC_027916.2:77660-77740_length:81_mod0001 -M_T0_RID360_S0_NZ_JBDYLZ010000012.1:70482-70531_length:50_mod0000 -M_T0_RID360_S1_NC_017862.1:2881-2912_length:32_mod0000 -M_T0_RID360_S1_NC_028373.1:7802-7900_length:99_mod0000 -M_T0_RID361_S0_NZ_JBDYRX010000003.1:274684-274747_length:64_mod0000 -M_T0_RID362_S0_NC_029996.1:102820-102944_length:125_mod0001 -M_T0_RID362_S1_NC_027916.2:110368-110450_length:83_mod0000 -M_T0_RID362_S1_NZ_JBDYSJ010000002.1:480705-480765_length:61_mod0000 -M_T0_RID363_S0_NC_031089.1:6455-6543_length:89_mod0000 -M_T0_RID363_S0_NC_031218.1:1568-1623_length:56_mod0000 -M_T0_RID365_S1_NZ_JBDYSJ010000002.1:271975-272051_length:77_mod0000 -M_T0_RID366_S0_NZ_JBDYSJ010000001.1:487398-487484_length:87_mod0001 -M_T0_RID366_S1_NC_030843.1:4921-5005_length:85_mod0000 -M_T0_RID367_S0_NC_030127.1:2548-2589_length:42_mod0000 -M_T0_RID367_S0_NZ_JBDYLZ010000011.1:24860-24971_length:112_mod0000 -M_T0_RID367_S1_NZ_JBDYLZ010000006.1:96139-96201_length:63_mod0000 -M_T0_RID368_S0_NZ_JBDYSJ010000002.1:604782-604905_length:124_mod0001 -M_T0_RID369_S1_NC_031464.1:5161-5234_length:74_mod0000 -M_T0_RID370_S0_NC_027542.1:1019-1100_length:82_mod0000 -M_T0_RID371_S1_NC_028144.1:5011-5099_length:89_mod0000 -M_T0_RID371_S1_NZ_JBDYRX010000002.1:678499-678596_length:98_mod0000 -M_T0_RID372_S0_NZ_JBDYRX010000003.1:526040-526077_length:38_mod0000 -M_T0_RID372_S0_NZ_JBDYSJ010000002.1:283416-283463_length:48_mod0001 -M_T0_RID373_S0_NC_033705.1:55-95_length:41_mod0000 -M_T0_RID374_S0_NC_027016.1:151413-151449_length:37_mod0000 -M_T0_RID374_S0_NZ_JBDYSJ010000003.1:310288-310375_length:88_mod0000 -M_T0_RID374_S1_NZ_JBDYLZ010000012.1:57726-57851_length:126_mod0000 -M_T0_RID375_S0_NC_034377.1:6340-6385_length:46_mod0000 -M_T0_RID375_S1_NC_028099.1:112413-112504_length:92_mod0001 -M_T0_RID378_S0_NC_018448.1:5936-6007_length:72_mod0000 -M_T0_RID379_S1_NZ_JBDYRX010000001.1:727009-727109_length:101_mod0000 -M_T0_RID380_S0_NC_034253.1:5146-5187_length:42_mod0000 -M_T0_RID380_S1_NC_029905.1:2051-2094_length:44_mod0000 -M_T0_RID381_S0_NC_030240.1:103311-103373_length:63_mod0000 -M_T0_RID381_S0_NZ_JBDYLZ010000009.1:178104-178162_length:59_mod0000 -M_T0_RID382_S0_NC_027210.1:5895-5968_length:74_mod0000 -M_T0_RID382_S0_NC_029996.1:87376-87478_length:103_mod0000 -M_T0_RID382_S1_NC_027916.2:84236-84307_length:72_mod0000 -M_T0_RID383_S0_NZ_JBDYSJ010000001.1:683370-683456_length:87_mod0000 -M_T0_RID383_S1_NC_029132.1:79856-79920_length:65_mod0000 -M_T0_RID385_S0_NZ_JBDYLZ010000009.1:69071-69118_length:48_mod0000 -M_T0_RID386_S0_NC_034225.1:1556-1648_length:93_mod0000 -M_T0_RID387_S1_NC_028636.1:123682-123742_length:61_mod0000 -M_T0_RID388_S0_NZ_JBDYLZ010000008.1:71860-71983_length:124_mod0000 -M_T0_RID389_S0_NC_029051.1:9270-9318_length:49_mod0000 -M_T0_RID389_S0_NZ_JBDYLZ010000016.1:61192-61254_length:63_mod0000 -M_T0_RID390_S1_NC_028981.1:1738-1830_length:93_mod0000 -M_T0_RID391_S0_NC_028371.1:6428-6495_length:68_mod0000 -M_T0_RID391_S0_NZ_JBDYRX010000004.1:272450-272500_length:51_mod0000 -M_T0_RID391_S1_NZ_JBDYSJ010000002.1:543099-543205_length:107_mod0000 -M_T0_RID392_S0_NC_028970.1:5031-5099_length:69_mod0000 -M_T0_RID392_S1_NC_028824.1:19380-19469_length:90_mod0000 -M_T0_RID392_S1_NZ_JBDYLZ010000009.1:26519-26597_length:79_mod0000 -M_T0_RID393_S0_NZ_JBDYLZ010000015.1:66736-66802_length:67_mod0000 -M_T0_RID395_S0_NC_031304.1:4214-4304_length:91_mod0000 -M_T0_RID396_S0_NZ_JBDYSJ010000001.1:683444-683483_length:40_mod0000 -M_T0_RID397_S0_NC_028125.1:5157-5221_length:65_mod0000 -M_T0_RID398_S0_NC_028814.1:21296-21329_length:34_mod0000 -M_T0_RID398_S0_NZ_JBDYLZ010000008.1:89568-89611_length:44_mod0000 -M_T0_RID398_S1_NZ_JBDYRX010000003.1:160428-160514_length:87_mod0000 -M_T0_RID399_S1_NZ_JBDYRX010000002.1:383166-383266_length:101_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000006.1:321094-321166_length:73_mod0000 -M_T0_RID401_S0_NZ_JBDYLZ010000017.1:46480-46536_length:57_mod0000 -M_T0_RID402_S0_NC_028491.1:36087-36159_length:73_mod0000 -M_T0_RID406_S0_NC_033720.1:8569-8637_length:69_mod0000 -M_T0_RID406_S0_NZ_JBDYSJ010000002.1:605544-605617_length:74_mod0000 -M_T0_RID406_S1_NC_033620.1:71763-71841_length:79_mod0000 -M_T0_RID407_S0_NC_028491.1:95220-95304_length:85_mod0000 -M_T0_RID407_S0_NZ_JBDYRX010000004.1:531865-531922_length:58_mod0000 -M_T0_RID408_S0_NZ_JBDYLZ010000006.1:20241-20331_length:91_mod0000 -M_T0_RID408_S1_NC_030391.1:1047-1152_length:106_mod0000 -M_T0_RID409_S1_NC_029904.1:2927-3013_length:87_mod0000 -M_T0_RID410_S0_NC_028369.1:7176-7240_length:65_mod0000 -M_T0_RID410_S1_NC_027923.1:107200-107294_length:95_mod0000 -M_T0_RID411_S1_NC_027916.2:12656-12743_length:88_mod0000 -M_T0_RID412_S0_NC_028362.1:1734-1810_length:77_mod0000 -M_T0_RID414_S0_NC_027646.1:3518-3556_length:39_mod0000 -M_T0_RID415_S1_NC_033703.1:4454-4536_length:83_mod0000 -M_T0_RID415_S1_NZ_JBDYRX010000004.1:398358-398416_length:59_mod0000 -M_T0_RID419_S0_NZ_JBDYSJ010000002.1:339543-339583_length:41_mod0000 -M_T0_RID420_S0_NC_029919.1:1092-1170_length:79_mod0000 -M_T0_RID420_S1_NC_029132.1:86139-86240_length:102_mod0000 -M_T0_RID421_S0_NZ_JBDYRX010000004.1:42510-42680_length:171_mod0001 -M_T0_RID421_S1_NC_028099.1:99392-99421_length:30_mod0000 -M_T0_RID422_S0_NC_028236.1:7738-7797_length:60_mod0000 -M_T0_RID422_S0_NZ_JBDYLZ010000014.1:21662-21716_length:55_mod0000 -M_T0_RID422_S0_NZ_JBDYSJ010000002.1:476168-476219_length:52_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:131159-131244_length:86_mod0000 -M_T0_RID423_S1_NZ_JBDYRX010000004.1:465551-465658_length:108_mod0000 -M_T0_RID424_S0_NC_029132.1:124479-124602_length:124_mod0000 -M_T0_RID424_S1_NZ_JBDYLZ010000006.1:180426-180481_length:56_mod0000 -M_T0_RID424_S1_NZ_JBDYSJ010000003.1:445372-445447_length:76_mod0000 -M_T0_RID425_S0_NZ_JBDYLZ010000006.1:11120-11222_length:103_mod0000 -M_T0_RID426_S1_NZ_JBDYRX010000002.1:460851-460904_length:54_mod0000 -M_T0_RID426_S1_NZ_JBDYSJ010000001.1:882579-882628_length:50_mod0000 -M_T0_RID427_S0_NZ_JBDYSJ010000001.1:460394-460459_length:66_mod0000 -M_T0_RID428_S1_NZ_JBDYLZ010000007.1:203593-203667_length:75_mod0000 -M_T0_RID432_S1_NZ_JBDYRX010000004.1:37215-37282_length:68_mod0000 -M_T0_RID433_S0_NC_028371.1:7751-7803_length:53_mod0000 -M_T0_RID433_S0_NZ_JBDYRX010000001.1:940205-940283_length:79_mod0000 -M_T0_RID434_S0_NZ_JBDYRX010000003.1:278075-278140_length:66_mod0000 -M_T0_RID435_S1_NC_031225.1:6315-6360_length:46_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000001.1:992235-992354_length:120_mod0000 -M_T0_RID435_S1_NZ_JBDYRX010000002.1:28179-28253_length:75_mod0000 -M_T0_RID436_S0_NZ_JBDYRX010000004.1:193926-194033_length:108_mod0000 -M_T0_RID438_S0_NZ_JBDYRX010000004.1:427488-427551_length:64_mod0000 -M_T0_RID441_S1_NC_028486.1:4288-4332_length:45_mod0000 -M_T0_RID441_S1_NC_031135.1:1215-1254_length:40_mod0000 -M_T0_RID441_S1_NC_033620.1:171185-171273_length:89_mod0000 -M_T0_RID441_S1_NZ_JBDYRX010000001.1:944430-944505_length:76_mod0000 -M_T0_RID442_S1_NZ_JBDYSJ010000001.1:795030-795132_length:103_mod0000 -M_T0_RID444_S1_NC_029927.1:739-780_length:42_mod0000 -M_T0_RID445_S0_NC_030400.1:9136-9237_length:102_mod0000 -M_T0_RID445_S1_NC_037578.1:3062-3107_length:46_mod0000 -M_T0_RID446_S0_NC_029996.1:10622-10695_length:74_mod0000 -M_T0_RID446_S1_NC_034266.1:27796-27894_length:99_mod0000 -M_T0_RID447_S1_NC_031259.1:1711-1781_length:71_mod0000 -M_T0_RID450_S0_NZ_JBDYRX010000003.1:719829-719908_length:80_mod0000 -M_T0_RID451_S0_NC_027214.1:8775-8830_length:56_mod0000 -M_T0_RID451_S0_NC_028367.1:5391-5502_length:112_mod0000 -M_T0_RID451_S1_NZ_JBDYRX010000002.1:31090-31200_length:111_mod0000 -M_T0_RID452_S1_NC_030205.1:1725-1812_length:88_mod0000 -M_T0_RID453_S0_NC_033761.1:8903-9009_length:107_mod0001 -M_T0_RID455_S0_NC_027799.1:284-375_length:92_mod0000 -M_T0_RID455_S1_NZ_JBDYLZ010000014.1:95838-95936_length:99_mod0000 -M_T0_RID455_S1_NZ_JBDYSJ010000002.1:210490-210557_length:68_mod0000 -M_T0_RID456_S0_NZ_JBDYLZ010000007.1:109571-109660_length:90_mod0000 -M_T0_RID456_S1_NC_030240.1:55430-55543_length:114_mod0000 -M_T0_RID457_S1_NZ_JBDYLZ010000009.1:123168-123262_length:95_mod0000 -M_T0_RID457_S1_NZ_JBDYSJ010000004.1:21364-21417_length:54_mod0000 -M_T0_RID458_S1_NC_034266.1:128171-128258_length:88_mod0000 -M_T0_RID458_S1_NZ_JBDYLZ010000008.1:129533-129587_length:55_mod0000 -M_T0_RID458_S1_NZ_JBDYRX010000002.1:29087-29147_length:61_mod0000 -M_T0_RID459_S0_NZ_JBDYRX010000001.1:1023086-1023182_length:97_mod0000 -M_T0_RID459_S1_NC_023442.1:114262-114356_length:95_mod0000 -M_T0_RID460_S0_NC_029052.1:1193-1273_length:81_mod0000 -M_T0_RID462_S1_NZ_JBDYRX010000001.1:1005315-1005420_length:106_mod0000 -M_T0_RID463_S0_NC_028372.1:9914-9999_length:86_mod0000 -M_T0_RID463_S1_NZ_JBDYSJ010000004.1:218365-218453_length:89_mod0000 -M_T0_RID465_S0_NZ_JBDYSJ010000001.1:787887-787945_length:59_mod0000 -M_T0_RID465_S1_NC_029311.1:1797-1831_length:35_mod0000 -M_T0_RID466_S0_NZ_JBDYRX010000003.1:730520-730588_length:69_mod0000 -M_T0_RID470_S1_NC_033820.1:3073-3102_length:30_mod0000 -M_T0_RID471_S1_NZ_JBDYLZ010000008.1:35202-35290_length:89_mod0000 -M_T0_RID472_S0_NZ_JBDYLZ010000011.1:10802-10846_length:45_mod0000 -M_T0_RID472_S1_NZ_JBDYRX010000001.1:652634-652707_length:74_mod0000 -M_T0_RID474_S0_NC_030225.1:5289-5336_length:48_mod0000 -M_T0_RID475_S0_NZ_JBDYLZ010000006.1:151548-151631_length:84_mod0000 -M_T0_RID475_S0_NZ_JBDYRX010000002.1:464041-464153_length:113_mod0000 -M_T0_RID476_S0_NZ_JBDYLZ010000015.1:62860-62918_length:59_mod0000 -M_T0_RID477_S0_NC_027214.1:4315-4391_length:77_mod0000 -M_T0_RID477_S0_NC_030231.1:4362-4445_length:84_mod0000 -M_T0_RID477_S1_NC_027926.1:5336-5385_length:50_mod0000 -M_T0_RID479_S0_NC_034240.1:10006-10105_length:100_mod0000 -M_T0_RID479_S0_NC_034377.1:6973-7006_length:34_mod0000 -M_T0_RID479_S1_NC_029309.1:1183-1291_length:109_mod0000 -M_T0_RID479_S1_NZ_JBDYRX010000004.1:294593-294685_length:93_mod0000 -M_T0_RID480_S0_NC_030148.1:14092-14146_length:55_mod0000 -M_T0_RID481_S1_NC_027920.1:4910-4956_length:47_mod0000 -M_T0_RID481_S1_NC_028252.1:1447-1525_length:79_mod0000 -M_T0_RID481_S1_NC_029038.1:3990-4034_length:45_mod0000 -M_T0_RID482_S0_NC_031287.1:3748-3826_length:79_mod0000 -M_T0_RID483_S0_NC_029311.1:111589-111673_length:85_mod0000 -M_T0_RID484_S0_NZ_JBDYRX010000001.1:874633-874662_length:30_mod0000 -M_T0_RID484_S1_NZ_JBDYRX010000002.1:457659-457735_length:77_mod0000 -M_T0_RID487_S0_NC_023339.1:3452-3542_length:91_mod0000 -M_T0_RID488_S1_NC_030800.1:3767-3843_length:77_mod0000 -M_T0_RID490_S1_NC_028249.1:6706-6755_length:50_mod0000 -M_T0_RID490_S1_NC_033815.1:382-420_length:39_mod0000 -M_T0_RID491_S0_NC_029549.1:1543-1601_length:59_mod0000 -M_T0_RID491_S1_NC_023442.1:106362-106456_length:95_mod0001 -M_T0_RID491_S1_NZ_JBDYSJ010000002.1:433503-433622_length:120_mod0000 -M_T0_RID492_S1_NC_017967.1:4737-4790_length:54_mod0000 -M_T0_RID497_S1_NC_028231.1:2435-2530_length:96_mod0000 -M_T0_RID498_S1_NC_028368.1:10324-10389_length:66_mod0000 -M_T0_RID498_S1_NC_031088.1:10285-10350_length:66_mod0000 -M_T0_RID499_S0_NZ_JBDYLZ010000012.1:63930-64011_length:82_mod0000 -M_T0_RID500_S0_NZ_JBDYSJ010000003.1:369722-369827_length:106_mod0000 -M_T0_RID501_S0_NC_034214.1:4534-4626_length:93_mod0000 -M_T0_RID503_S1_NZ_JBDYLZ010000014.1:65584-65643_length:60_mod0001 -M_T0_RID504_S0_NC_033727.1:6181-6283_length:103_mod0000 -M_T0_RID504_S0_NC_037572.1:353-481_length:129_mod0000 -M_T0_RID506_S0_NZ_JBDYSJ010000001.1:230782-230869_length:88_mod0000 -M_T0_RID506_S1_NZ_JBDYRX010000001.1:155361-155441_length:81_mod0000 -M_T0_RID507_S0_NZ_JBDYRX010000001.1:64196-64251_length:56_mod0001 -M_T0_RID507_S0_NZ_JBDYRX010000002.1:311911-312021_length:111_mod0000 -M_T0_RID508_S1_NC_028382.1:618-664_length:47_mod0000 -M_T0_RID509_S0_NZ_JBDYRX010000002.1:83623-83710_length:88_mod0000 -M_T0_RID509_S0_NZ_JBDYSJ010000002.1:32694-32813_length:120_mod0000 -M_T0_RID512_S0_NC_031301.1:7499-7600_length:102_mod0000 -M_T0_RID512_S0_NZ_JBDYSJ010000001.1:497297-497384_length:88_mod0001 -M_T0_RID512_S1_NC_023299.1:173-222_length:50_mod0000 -M_T0_RID514_S0_NC_028144.1:1039-1130_length:92_mod0000 -M_T0_RID515_S1_NC_028239.1:1870-1935_length:66_mod0000 -M_T0_RID516_S0_NC_028099.1:69736-69811_length:76_mod0000 -M_T0_RID518_S0_NZ_JBDYSJ010000002.1:172879-172954_length:76_mod0000 -M_T0_RID518_S1_NC_028374.1:22488-22593_length:106_mod0000 -M_T0_RID519_S0_NZ_JBDYSJ010000004.1:83804-83909_length:106_mod0000 -M_T0_RID519_S1_NC_023442.1:37132-37228_length:97_mod0000 -M_T0_RID520_S1_NC_033821.1:5336-5462_length:127_mod0000 -M_T0_RID521_S1_NC_028362.1:8323-8409_length:87_mod0000 -M_T0_RID521_S1_NC_033620.1:165922-166009_length:88_mod0000 -M_T0_RID526_S0_NZ_JBDYLZ010000008.1:191196-191301_length:106_mod0000 -M_T0_RID527_S0_NZ_JBDYRX010000001.1:664374-664450_length:77_mod0000 -M_T0_RID530_S1_NC_029255.1:118676-118738_length:63_mod0000 -M_T0_RID531_S0_NC_030240.1:18050-18083_length:34_mod0000 -M_T0_RID535_S0_NZ_JBDYRX010000003.1:273784-273814_length:31_mod0000 -M_T0_RID535_S0_NZ_JBDYSJ010000001.1:408974-409045_length:72_mod0000 -M_T0_RID536_S1_NZ_JBDYLZ010000007.1:187492-187559_length:68_mod0001 -M_T0_RID537_S0_NC_031106.1:5925-5990_length:66_mod0000 -M_T0_RID539_S0_NC_023442.1:25605-25715_length:111_mod0000 -M_T0_RID539_S0_NC_030922.1:6177-6250_length:74_mod0000 -M_T0_RID539_S1_NC_033732.1:488-545_length:58_mod0000 -M_T0_RID539_S1_NZ_JBDYRX010000003.1:428710-428748_length:39_mod0000 -M_T0_RID540_S1_NC_028636.1:8122-8203_length:82_mod0000 -M_T0_RID540_S1_NC_033777.1:478-533_length:56_mod0000 -M_T0_RID541_S0_NZ_JBDYLZ010000009.1:17788-17882_length:95_mod0000 -M_T0_RID543_S0_NZ_JBDYLZ010000006.1:137222-137319_length:98_mod0000 -M_T0_RID545_S1_NC_033620.1:141319-141407_length:89_mod0000 -M_T0_RID547_S0_NC_029901.1:2272-2382_length:111_mod0000 -M_T0_RID548_S0_NC_027916.2:50899-50962_length:64_mod0000 -M_T0_RID549_S0_NZ_JBDYRX010000003.1:184280-184329_length:50_mod0000 -M_T0_RID549_S1_NC_027016.1:166476-166540_length:65_mod0001 -M_T0_RID552_S0_NC_031244.1:259-371_length:113_mod0000 -M_T0_RID552_S1_NZ_JBDYSJ010000001.1:904809-904898_length:90_mod0000 -M_T0_RID555_S0_NC_029255.1:86976-87025_length:50_mod0000 -M_T0_RID555_S0_NC_033700.1:23881-23958_length:78_mod0000 -M_T0_RID555_S1_NZ_JBDYSJ010000003.1:459317-459387_length:71_mod0000 -M_T0_RID556_S0_NC_029800.1:2415-2467_length:53_mod0000 -M_T0_RID556_S0_NZ_JBDYRX010000003.1:269557-269627_length:71_mod0000 -M_T0_RID556_S1_NC_018151.1:436-524_length:89_mod0000 -M_T0_RID556_S1_NC_029997.2:2602-2635_length:34_mod0000 -M_T0_RID560_S0_NC_030691.1:8709-8769_length:61_mod0000 -M_T0_RID563_S0_NZ_JBDYSJ010000001.1:279557-279665_length:109_mod0000 -M_T0_RID563_S1_NC_029255.1:16285-16387_length:103_mod0000 -M_T0_RID563_S1_NC_030651.1:8044-8106_length:63_mod0000 -M_T0_RID564_S1_NC_030380.1:905-947_length:43_mod0000 -M_T0_RID566_S0_NZ_JBDYRX010000002.1:228758-228796_length:39_mod0000 -M_T0_RID566_S1_NC_027916.2:158878-158953_length:76_mod0000 -M_T0_RID568_S0_NC_033718.1:5028-5099_length:72_mod0000 -M_T0_RID569_S1_NZ_JBDYSJ010000002.1:4445-4500_length:56_mod0000 -M_T0_RID571_S1_NC_030200.1:53402-53457_length:56_mod0000 -M_T0_RID571_S1_NC_031291.1:6265-6343_length:79_mod0000 -M_T0_RID573_S0_NZ_JBDYSJ010000001.1:821929-821988_length:60_mod0000 -M_T0_RID573_S1_NZ_JBDYRX010000002.1:420333-420420_length:88_mod0000 -M_T0_RID578_S0_NC_028389.1:883-929_length:47_mod0000 -M_T0_RID578_S1_NC_027920.1:2737-2802_length:66_mod0000 -M_T0_RID578_S1_NZ_JBDYRX010000001.1:125147-125264_length:118_mod0000 -M_T0_RID579_S1_NC_028636.1:80919-81006_length:88_mod0000 -M_T0_RID579_S1_NZ_JBDYRX010000003.1:600760-600842_length:83_mod0000 -M_T0_RID579_S1_NZ_JBDYSJ010000001.1:621908-622008_length:101_mod0000 -M_T0_RID580_S0_NC_031236.1:9639-9701_length:63_mod0000 -M_T0_RID580_S0_NC_033620.1:115666-115748_length:83_mod0000 -M_T0_RID584_S1_NZ_JBDYRX010000003.1:30143-30232_length:90_mod0000 -M_T0_RID587_S1_NC_030236.1:1921-2018_length:98_mod0000 -M_T0_RID588_S0_NZ_JBDYRX010000004.1:487902-487980_length:79_mod0000 -M_T0_RID592_S0_NZ_JBDYRX010000004.1:290162-290207_length:46_mod0000 -M_T0_RID596_S0_NC_028491.1:22873-22918_length:46_mod0000 -M_T0_RID597_S0_NZ_JBDYRX010000004.1:248380-248414_length:35_mod0000 -M_T0_RID598_S0_NZ_JBDYLZ010000013.1:99135-99225_length:91_mod0000 -M_T0_RID598_S0_NZ_JBDYRX010000004.1:521129-521194_length:66_mod0000 -M_T0_RID598_S1_NC_027781.1:1542-1623_length:82_mod0000 -M_T0_RID598_S1_NC_033828.1:1452-1571_length:120_mod0000 -M_T0_RID599_S0_NZ_JBDYLZ010000018.1:17132-17215_length:84_mod0000 -M_T0_RID601_S1_NZ_JBDYRX010000004.1:64749-64831_length:83_mod0000 -M_T0_RID601_S1_NZ_JBDYSJ010000004.1:72990-73054_length:65_mod0000 -M_T0_RID603_S1_NZ_JBDYRX010000003.1:148174-148218_length:45_mod0000 -M_T0_RID606_S1_NZ_JBDYRX010000004.1:81494-81540_length:47_mod0000 -M_T0_RID608_S1_NZ_JBDYLZ010000006.1:54120-54159_length:40_mod0000 -M_T0_RID608_S1_NZ_JBDYSJ010000003.1:75571-75624_length:54_mod0000 -M_T0_RID609_S0_NZ_JBDYLZ010000017.1:21746-21833_length:88_mod0000 -M_T0_RID610_S1_NZ_JBDYRX010000004.1:416636-416711_length:76_mod0000 -M_T0_RID617_S1_NZ_JBDYLZ010000013.1:81956-82016_length:61_mod0000 -M_T0_RID618_S0_NZ_JBDYRX010000001.1:154047-154079_length:33_mod0000 -M_T0_RID619_S0_NZ_JBDYRX010000001.1:929162-929284_length:123_mod0000 -M_T0_RID620_S1_NZ_JBDYRX010000004.1:231083-231194_length:112_mod0000 -M_T0_RID622_S0_NC_029117.1:1274-1341_length:68_mod0000 -M_T0_RID625_S1_NZ_JBDYRX010000003.1:351246-351297_length:52_mod0000 -M_T0_RID626_S0_NZ_JBDYRX010000003.1:54224-54264_length:41_mod0000 -M_T0_RID627_S1_NZ_JBDYRX010000002.1:425465-425547_length:83_mod0000 -M_T0_RID629_S1_NC_028264.1:4326-4405_length:80_mod0000 -M_T0_RID630_S0_NZ_JBDYSJ010000002.1:388835-388868_length:34_mod0000 -M_T0_RID633_S1_NZ_JBDYRX010000003.1:253941-254012_length:72_mod0000 -M_T0_RID634_S1_NC_033815.1:2695-2865_length:171_mod0000 -M_T0_RID635_S1_NC_033700.1:17426-17511_length:86_mod0000 -M_T0_RID636_S0_NC_029086.1:7004-7042_length:39_mod0000 -M_T0_RID638_S1_NZ_JBDYSJ010000001.1:82298-82352_length:55_mod0000 -M_T0_RID640_S0_NC_033756.1:5658-5786_length:129_mod0001 -M_T0_RID641_S0_NC_027706.1:187-292_length:106_mod0000 -M_T0_RID642_S0_NC_034266.1:154137-154203_length:67_mod0000 -M_T0_RID642_S0_NZ_JBDYRX010000003.1:290122-290229_length:108_mod0000 -M_T0_RID643_S0_NC_017937.1:1077-1164_length:88_mod0000 -M_T0_RID643_S0_NZ_JBDYRX010000002.1:527817-527928_length:112_mod0000 -M_T0_RID645_S0_NC_030799.1:4650-4688_length:39_mod0000 -M_T0_RID645_S1_NZ_JBDYLZ010000008.1:186276-186348_length:73_mod0000 -M_T0_RID651_S1_NC_033733.1:2956-3039_length:84_mod0001 -M_T0_RID651_S1_NZ_JBDYRX010000001.1:479171-479229_length:59_mod0000 -M_T0_RID653_S1_NC_029311.1:77186-77261_length:76_mod0000 -M_T0_RID654_S0_NZ_JBDYSJ010000001.1:904727-904802_length:76_mod0000 -M_T0_RID655_S0_NZ_JBDYSJ010000001.1:482269-482365_length:97_mod0000 -M_T0_RID655_S1_NZ_JBDYRX010000002.1:520330-520420_length:91_mod0000 -M_T0_RID656_S0_NC_028259.1:1542-1591_length:50_mod0000 -M_T0_RID656_S0_NZ_JBDYLZ010000019.1:6097-6185_length:89_mod0000 -M_T0_RID660_S1_NC_034266.1:157401-157477_length:77_mod0000 -M_T0_RID664_S0_NC_027916.2:59946-59993_length:48_mod0000 -M_T0_RID664_S0_NZ_JBDYLZ010000015.1:82686-82741_length:56_mod0000 -M_T0_RID664_S0_NZ_JBDYSJ010000003.1:87421-87503_length:83_mod0000 -M_T0_RID668_S0_NZ_JBDYRX010000004.1:18573-18663_length:91_mod0000 -M_T0_RID670_S0_NC_027920.1:1301-1393_length:93_mod0000 -M_T0_RID673_S1_NC_033703.1:545-616_length:72_mod0000 -M_T0_RID673_S1_NZ_JBDYRX010000001.1:644803-644895_length:93_mod0000 -M_T0_RID679_S0_NZ_JBDYRX010000002.1:605076-605139_length:64_mod0000 -M_T0_RID679_S1_NC_033703.1:1306-1364_length:59_mod0000 -M_T0_RID680_S0_NZ_JBDYRX010000002.1:632837-632879_length:43_mod0000 -M_T0_RID681_S1_NZ_JBDYSJ010000002.1:496144-496188_length:45_mod0000 -M_T0_RID682_S0_NZ_JBDYSJ010000001.1:116469-116509_length:41_mod0000 -M_T0_RID683_S0_NZ_JBDYRX010000001.1:675311-675352_length:42_mod0000 -M_T0_RID683_S0_NZ_JBDYSJ010000004.1:71365-71456_length:92_mod0000 -M_T0_RID683_S1_NC_029255.1:7610-7675_length:66_mod0000 -M_T0_RID686_S0_NC_027429.1:2932-2966_length:35_mod0000 -M_T0_RID686_S1_NC_027923.1:107955-107999_length:45_mod0000 -M_T0_RID686_S1_NC_029132.1:95050-95160_length:111_mod0000 -M_T0_RID689_S1_NZ_JBDYSJ010000004.1:138231-138318_length:88_mod0000 -M_T0_RID691_S1_NC_033710.1:3870-3926_length:57_mod0000 -M_T0_RID692_S1_NC_027531.1:1508-1612_length:105_mod0000 -M_T0_RID695_S0_NC_030200.1:124072-124139_length:68_mod0000 -M_T0_RID697_S0_NC_028921.1:5390-5470_length:81_mod0000 -M_T0_RID699_S0_NC_031083.1:4910-4975_length:66_mod0000 -M_T0_RID699_S1_NZ_JBDYLZ010000010.1:101894-101946_length:53_mod0000 -M_T0_RID700_S1_NZ_JBDYSJ010000001.1:915360-915453_length:94_mod0000 -M_T0_RID702_S1_NC_028099.1:63829-63929_length:101_mod0000 -M_T0_RID706_S0_NC_027210.1:7432-7505_length:74_mod0000 -M_T0_RID707_S1_NZ_JBDYRX010000002.1:367432-367522_length:91_mod0001 -M_T0_RID707_S1_NZ_JBDYSJ010000004.1:260063-260128_length:66_mod0000 -M_T0_RID709_S1_NZ_JBDYRX010000003.1:29327-29484_length:158_mod0000 -M_T0_RID710_S1_NC_033720.1:7987-8089_length:103_mod0000 -M_T0_RID711_S0_NZ_JBDYLZ010000006.1:173182-173278_length:97_mod0000 -M_T0_RID711_S1_NC_033700.1:20537-20567_length:31_mod0000 -M_T0_RID711_S1_NZ_JBDYSJ010000001.1:181184-181271_length:88_mod0000 -M_T0_RID714_S0_NC_037612.1:3005-3122_length:118_mod0000 -M_T0_RID715_S0_NC_027788.1:468-551_length:84_mod0000 -M_T0_RID715_S1_NZ_JBDYLZ010000006.1:219162-219260_length:99_mod0000 -M_T0_RID717_S0_NC_030654.1:1669-1721_length:53_mod0000 -M_T0_RID719_S1_NZ_JBDYSJ010000001.1:826609-826678_length:70_mod0000 -M_T0_RID722_S1_NC_027923.1:41169-41259_length:91_mod0001 -M_T0_RID727_S0_NC_029997.2:28478-28523_length:46_mod0000 -M_T0_RID728_S0_NZ_JBDYRX010000002.1:879157-879230_length:74_mod0000 -M_T0_RID729_S1_NZ_JBDYLZ010000008.1:194207-194253_length:47_mod0000 -M_T0_RID731_S1_NC_030117.1:17286-17318_length:33_mod0000 -M_T0_RID736_S0_NZ_JBDYRX010000001.1:178466-178588_length:123_mod0000 -M_T0_RID737_S0_NC_028491.1:18226-18284_length:59_mod0000 -M_T0_RID739_S1_NZ_JBDYLZ010000011.1:127333-127376_length:44_mod0000 -M_T0_RID743_S0_NC_037573.1:1169-1247_length:79_mod0000 -M_T0_RID747_S1_NZ_JBDYRX010000002.1:430138-430204_length:67_mod0000 -M_T0_RID749_S1_NZ_JBDYRX010000003.1:71924-71986_length:63_mod0000 -M_T0_RID752_S0_NC_031336.1:9006-9046_length:41_mod0000 -M_T0_RID753_S0_NZ_JBDYSJ010000003.1:446526-446575_length:50_mod0000 -M_T0_RID757_S0_NC_028136.1:1312-1355_length:44_mod0000 -M_T0_RID757_S1_NC_027016.1:202899-202969_length:71_mod0000 -M_T0_RID757_S1_NZ_JBDYRX010000004.1:461576-461693_length:118_mod0000 -M_T0_RID759_S1_NC_029691.1:3622-3733_length:112_mod0000 -M_T0_RID763_S1_NC_027916.2:99012-99086_length:75_mod0000 -M_T0_RID763_S1_NC_028265.1:10302-10344_length:43_mod0000 -M_T0_RID763_S1_NC_030798.1:7132-7233_length:102_mod0000 -M_T0_RID763_S1_NZ_JBDYLZ010000015.1:37189-37249_length:61_mod0000 -M_T0_RID765_S0_NC_028261.1:4356-4443_length:88_mod0000 -M_T0_RID767_S1_NC_027916.2:86943-87045_length:103_mod0000 -M_T0_RID768_S0_NC_028491.1:2854-2933_length:80_mod0000 -M_T0_RID768_S0_NC_030200.1:40203-40312_length:110_mod0000 -M_T0_RID771_S0_NZ_JBDYLZ010000019.1:13804-13871_length:68_mod0000 -M_T0_RID778_S1_NC_031275.1:5153-5201_length:49_mod0000 -M_T0_RID781_S1_NZ_JBDYRX010000003.1:540287-540355_length:69_mod0000 -M_T0_RID783_S1_NZ_JBDYLZ010000010.1:89260-89349_length:90_mod0000 -M_T0_RID785_S1_NC_027199.1:11719-11818_length:100_mod0000 -M_T0_RID786_S1_NZ_JBDYLZ010000008.1:173777-173859_length:83_mod0000 -M_T0_RID788_S0_NC_030922.1:1394-1483_length:90_mod0000 -M_T0_RID793_S0_NZ_JBDYRX010000003.1:539904-539954_length:51_mod0001 -M_T0_RID797_S1_NZ_JBDYRX010000004.1:414620-414694_length:75_mod0000 -M_T0_RID807_S1_NC_030117.1:45331-45378_length:48_mod0000 -M_T0_RID810_S0_NC_028491.1:85062-85136_length:75_mod0001 -M_T0_RID811_S1_NC_030697.1:295-351_length:57_mod0000 -M_T0_RID813_S1_NC_027016.1:91244-91325_length:82_mod0000 -M_T0_RID817_S1_NC_030240.1:108663-108730_length:68_mod0001 -M_T0_RID823_S0_NC_033620.1:158427-158465_length:39_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000003.1:241332-241406_length:75_mod0000 -M_T0_RID824_S1_NZ_JBDYRX010000004.1:228843-228928_length:86_mod0000 -M_T0_RID827_S0_NZ_JBDYSJ010000004.1:239871-239973_length:103_mod0000 -M_T0_RID832_S0_NZ_JBDYLZ010000015.1:88774-88854_length:81_mod0000 -M_T0_RID833_S0_NZ_JBDYSJ010000001.1:590978-591039_length:62_mod0000 -M_T0_RID837_S1_NZ_JBDYRX010000001.1:656888-656964_length:77_mod0000 -M_T0_RID840_S0_NC_028396.1:529-621_length:93_mod0000 -M_T0_RID844_S1_NZ_JBDYLZ010000007.1:237741-237786_length:46_mod0000 -M_T0_RID847_S0_NZ_JBDYRX010000003.1:703429-703507_length:79_mod0000 -M_T0_RID852_S0_NC_030240.1:105292-105367_length:76_mod0000 -M_T0_RID856_S0_NZ_JBDYRX010000003.1:28070-28132_length:63_mod0000 -M_T0_RID856_S1_NC_027644.1:3712-3804_length:93_mod0000 -M_T0_RID858_S0_NZ_JBDYSJ010000003.1:197400-197485_length:86_mod0000 -M_T0_RID858_S1_NZ_JBDYSJ010000004.1:175908-175948_length:41_mod0000 -M_T0_RID859_S0_NC_033777.1:2010-2066_length:57_mod0000 -M_T0_RID862_S1_NC_030799.1:1806-1881_length:76_mod0000 -M_T0_RID865_S1_NZ_JBDYSJ010000002.1:326035-326087_length:53_mod0000 -M_T0_RID873_S1_NC_028119.1:2502-2583_length:82_mod0000 -M_T0_RID880_S0_NC_033620.1:55069-55148_length:80_mod0000 -M_T0_RID882_S0_NZ_JBDYRX010000002.1:484332-484416_length:85_mod0000 -M_T0_RID882_S1_NC_034266.1:103121-103153_length:33_mod0000 -M_T0_RID885_S0_NZ_JBDYRX010000003.1:244205-244252_length:48_mod0000 -M_T0_RID885_S1_NC_036636.1:5051-5143_length:93_mod0000 -M_T0_RID887_S0_NC_029132.1:58239-58309_length:71_mod0000 -M_T0_RID895_S1_NZ_JBDYRX010000004.1:290403-290535_length:133_mod0000 -M_T0_RID900_S0_NZ_JBDYRX010000003.1:442650-442708_length:59_mod0000 -M_T0_RID903_S0_NC_029994.1:1129-1161_length:33_mod0000 -M_T0_RID910_S1_NC_030801.1:531-591_length:61_mod0000 -M_T0_RID913_S1_NZ_JBDYSJ010000001.1:289314-289350_length:37_mod0000 -M_T0_RID923_S1_NC_028374.1:1835-1919_length:85_mod0000 -M_T0_RID930_S0_NC_033727.1:5848-5935_length:88_mod0000 -M_T0_RID941_S0_NZ_JBDYLZ010000020.1:17961-18008_length:48_mod0000 -M_T0_RID951_S0_NZ_JBDYLZ010000007.1:258088-258169_length:82_mod0000 -M_T0_RID960_S1_NZ_JBDYRX010000001.1:365497-365549_length:53_mod0000 -M_T0_RID963_S0_NZ_JBDYSJ010000002.1:471116-471242_length:127_mod0000 -M_T0_RID967_S0_NC_028145.1:2423-2491_length:69_mod0000 -M_T0_RID969_S1_NC_027917.1:3392-3477_length:86_mod0000 -M_T0_RID973_S1_NC_028243.1:233-298_length:66_mod0000 -M_T0_RID975_S0_NZ_JBDYLZ010000006.1:262785-262833_length:49_mod0000 -M_T0_RID977_S0_NC_029311.1:110890-110930_length:41_mod0000 -M_T0_RID978_S1_NC_033707.1:4471-4569_length:99_mod0000 -M_T0_RID978_S1_NZ_JBDYLZ010000011.1:12262-12308_length:47_mod0000 -M_T0_RID987_S1_NZ_JBDYRX010000002.1:268856-268924_length:69_mod0000 -M_T0_RID993_S0_NZ_JBDYSJ010000002.1:495946-496025_length:80_mod0000 -M_T0_RID997_S0_NC_029303.1:1692-1771_length:80_mod0000 -M_T0_RID1003_S0_NZ_JBDYSJ010000001.1:678727-678783_length:57_mod0000 -M_T0_RID1022_S1_NC_030746.1:3635-3726_length:92_mod0000 -M_T0_RID1023_S1_NZ_JBDYLZ010000006.1:264893-265013_length:121_mod0000 -M_T0_RID1048_S0_NZ_JBDYLZ010000008.1:126930-127042_length:113_mod0000 -M_T0_RID1070_S0_NZ_JBDYRX010000003.1:112054-112158_length:105_mod0000 diff --git a/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_extract.py b/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_extract.py deleted file mode 100644 index aa089a3..0000000 --- a/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_extract.py +++ /dev/null @@ -1,60 +0,0 @@ -""" -Rule test code for unit testing of rules generated with Snakemake 9.24.0. -""" - -import os -import sys -import shutil -import tempfile -from pathlib import Path -from subprocess import check_output - -sys.path.insert(0, os.path.dirname(__file__)) - - -def test_prefilter_reads_extract(conda_prefix): - - with tempfile.TemporaryDirectory() as tmpdir: - workdir = Path(tmpdir) / "workdir" - config_path = Path(".tests/unit/prefilter_reads_extract/config") - data_path = Path(".tests/unit/prefilter_reads_extract/data") - expected_path = Path(".tests/unit/prefilter_reads_extract/expected") - - # Copy config to the temporary workdir. - shutil.copytree(config_path, workdir) - - # Copy data to the temporary workdir. - shutil.copytree(data_path, workdir, dirs_exist_ok=True) - - # Run the test job. - check_output( - [ - "python", - "-m", - "snakemake", - "results/reads/prefilter/extract/Lib_LVsim1_collapsed.fastq.gz", - "--snakefile", - "../../workflow/Snakefile", - "-f", - "--notemp", - "--show-failed-logs", - "-j1", - "--target-files-omit-workdir-adjustment", - "--allowed-rules", - "prefilter_reads_extract", - "--configfile", - "config/config.yaml", - "--software-deployment-method", - "conda", - "--directory", - workdir, - ] - + conda_prefix - ) - - # Check the output byte by byte using cmp/zmp/bzcmp/xzcmp. - # To modify this behavior, you can inherit from common.OutputChecker in here - # and overwrite the method `compare_files(generated_file, expected_file), - # also see common.py. - import common - common.OutputChecker(data_path, expected_path, workdir).check() diff --git a/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_merge.py b/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_merge.py deleted file mode 100644 index 2983b14..0000000 --- a/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_merge.py +++ /dev/null @@ -1,60 +0,0 @@ -""" -Rule test code for unit testing of rules generated with Snakemake 9.24.0. -""" - -import os -import sys -import shutil -import tempfile -from pathlib import Path -from subprocess import check_output - -sys.path.insert(0, os.path.dirname(__file__)) - - -def test_prefilter_reads_merge(conda_prefix): - - with tempfile.TemporaryDirectory() as tmpdir: - workdir = Path(tmpdir) / "workdir" - config_path = Path(".tests/unit/prefilter_reads_merge/config") - data_path = Path(".tests/unit/prefilter_reads_merge/data") - expected_path = Path(".tests/unit/prefilter_reads_merge/expected") - - # Copy config to the temporary workdir. - shutil.copytree(config_path, workdir) - - # Copy data to the temporary workdir. - shutil.copytree(data_path, workdir, dirs_exist_ok=True) - - # Run the test job. - check_output( - [ - "python", - "-m", - "snakemake", - "temp/reads/prefilter/merge/Lib_LVsim1_collapsed.read_ids", - "--snakefile", - "../../workflow/Snakefile", - "-f", - "--notemp", - "--show-failed-logs", - "-j1", - "--target-files-omit-workdir-adjustment", - "--allowed-rules", - "prefilter_reads_merge", - "--configfile", - "config/config.yaml", - "--software-deployment-method", - "conda", - "--directory", - workdir, - ] - + conda_prefix - ) - - # Check the output byte by byte using cmp/zmp/bzcmp/xzcmp. - # To modify this behavior, you can inherit from common.OutputChecker in here - # and overwrite the method `compare_files(generated_file, expected_file), - # also see common.py. - import common - common.OutputChecker(data_path, expected_path, workdir).check() diff --git a/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_taxonomy.py b/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_taxonomy.py deleted file mode 100644 index 7a46c47..0000000 --- a/examples/euk_prok_virus/.tests/unit/test_prefilter_reads_taxonomy.py +++ /dev/null @@ -1,60 +0,0 @@ -""" -Rule test code for unit testing of rules generated with Snakemake 9.24.0. -""" - -import os -import sys -import shutil -import tempfile -from pathlib import Path -from subprocess import check_output - -sys.path.insert(0, os.path.dirname(__file__)) - - -def test_prefilter_reads_taxonomy(conda_prefix): - - with tempfile.TemporaryDirectory() as tmpdir: - workdir = Path(tmpdir) / "workdir" - config_path = Path(".tests/unit/prefilter_reads_taxonomy/config") - data_path = Path(".tests/unit/prefilter_reads_taxonomy/data") - expected_path = Path(".tests/unit/prefilter_reads_taxonomy/expected") - - # Copy config to the temporary workdir. - shutil.copytree(config_path, workdir) - - # Copy data to the temporary workdir. - shutil.copytree(data_path, workdir, dirs_exist_ok=True) - - # Run the test job. - check_output( - [ - "python", - "-m", - "snakemake", - "temp/reads/prefilter/taxonomy/Lib_LVsim1_collapsed.read_ids", - "--snakefile", - "../../workflow/Snakefile", - "-f", - "--notemp", - "--show-failed-logs", - "-j1", - "--target-files-omit-workdir-adjustment", - "--allowed-rules", - "prefilter_reads_taxonomy", - "--configfile", - "config/config.yaml", - "--software-deployment-method", - "conda", - "--directory", - workdir, - ] - + conda_prefix - ) - - # Check the output byte by byte using cmp/zmp/bzcmp/xzcmp. - # To modify this behavior, you can inherit from common.OutputChecker in here - # and overwrite the method `compare_files(generated_file, expected_file), - # also see common.py. - import common - common.OutputChecker(data_path, expected_path, workdir).check() diff --git a/examples/euk_prok_virus/config/config.yaml b/examples/euk_prok_virus/config/config.yaml index ae3df34..8dfa2ba 100644 --- a/examples/euk_prok_virus/config/config.yaml +++ b/examples/euk_prok_virus/config/config.yaml @@ -41,9 +41,7 @@ derep: ############# ### ALIGN ### ############# -prefilter: - taxa: "Bacteria,Archaea,Viruses" - +taxon: taxonomy: nodes: "data/taxdump/nodes.dmp" names: "data/taxdump/names.dmp" @@ -52,7 +50,7 @@ prefilter: prok: n_shards: 2 path: "data/prok.{n_shard}-of-2.fas.gz" - map: + map: &map_prok_bowtie2 tool: bowtie2 params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal -N 1" bt2l: False @@ -61,43 +59,12 @@ prefilter: n_shards: 1 path: "data/virus.1-of-1.fas.gz" map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False + <<: *map_prok_bowtie2 acc2taxid: "data/virus.acc2taxid.gz" - - filter: - saturated_reads: - activate: true - n_alns: 10 - - unicorn: - refstats: - params: "--minrefl 1 --minreads 1 --rank genus" - taxstats: - params: "-k 17 --minrefl 1 --minreads 1 --minmani 0 --minalnas -Inf --maxdust 100" - - metadmg: - damage: - params: "--print_length 15" - - lca: - params: "--fix_ncbi 0 --how_many 25 --weight_type 1 --edit_dist_max 10000 --lca_rank genus" - - dfit: - params: "--nopt 5 --showfits 2" - - -euk: - taxonomy: - nodes: "data/taxdump/nodes.dmp" - names: "data/taxdump/names.dmp" - - ref: mitoch: n_shards: 1 path: "data/mitoch.1-of-1.fas.gz" - map: + map: &map_euk_bowtie2 tool: bowtie2 params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" bt2l: False @@ -106,9 +73,7 @@ euk: n_shards: 1 path: "data/plastid.1-of-1.fas.gz" map: - tool: bowtie2 - params: "-k 10 -L 22 -i S,1,1.15 --mp 1,1 --rdg 0,1 --rfg 0,1 --score-min L,0,-0.1 --no-unal" - bt2l: False + <<: *map_prok_bowtie2 acc2taxid: "data/plastid.acc2taxid.gz" filter: diff --git a/examples/euk_prok_virus/dag.svg b/examples/euk_prok_virus/dag.svg index 876bf67..28bd6c7 100644 --- a/examples/euk_prok_virus/dag.svg +++ b/examples/euk_prok_virus/dag.svg @@ -1,2348 +1,1896 @@ - - - + + snakemake_dag - + 0 - -multiqc_taxon_upload + +multiqc_taxon_upload 1 - -multiqc_taxon + +multiqc_taxon 1->0 - - + + 2 - -trim_fastqc_raw + +trim_fastqc_raw - + 2->1 - - + + 3 - -trim_get_fastq_raw -lane: L001 -library: LVsim2 -read_type_raw: R2 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim1 +read_type_raw: R2 +sample: Lib - + 3->2 - - + + - - -15 - -trim_adapterremoval_fastq_pe + + +16 + +trim_adapterremoval_fastq_pe - - -3->15 - - + + +3->16 + + 4 - -trim_fastqc_raw + +trim_fastqc_raw - + 4->1 - - + + 5 - -trim_get_fastq_raw -lane: L002 -library: LVsim1 -read_type_raw: R1 -sample: Lib + +trim_get_fastq_raw +lane: L002 +library: LVsim1 +read_type_raw: R1 +sample: Lib - + 5->4 - - + + 14 - -trim_adapterremoval_fastq_pe + +trim_adapterremoval_fastq_pe - + 5->14 - - + + 6 - -trim_fastqc_raw + +trim_fastqc_raw - + 6->1 - - + + 7 - -trim_get_fastq_raw -lane: L001 -library: LVsim1 -read_type_raw: R2 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim1 +read_type_raw: R1 +sample: Lib - + 7->6 - - - - - -16 - -trim_adapterremoval_fastq_pe + + - + 7->16 - - + + 8 - -trim_fastqc_raw + +trim_fastqc_raw - + 8->1 - - + + 9 - -trim_get_fastq_raw -lane: L001 -library: LVsim1 -read_type_raw: R1 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim2 +read_type_raw: R1 +sample: Lib - + 9->8 - - + + - - -9->16 - - + + +15 + +trim_adapterremoval_fastq_pe + + + +9->15 + + 10 - -trim_fastqc_raw + +trim_fastqc_raw - + 10->1 - - + + 11 - -trim_get_fastq_raw -lane: L001 -library: LVsim2 -read_type_raw: R1 -sample: Lib + +trim_get_fastq_raw +lane: L001 +library: LVsim2 +read_type_raw: R2 +sample: Lib - + 11->10 - - + + - + 11->15 - - + + 12 - -trim_fastqc_raw + +trim_fastqc_raw - + 12->1 - - + + 13 - -trim_get_fastq_raw -lane: L002 -library: LVsim1 -read_type_raw: R2 -sample: Lib + +trim_get_fastq_raw +lane: L002 +library: LVsim1 +read_type_raw: R2 +sample: Lib - + 13->12 - - + + - + 13->14 - - + + - + 14->1 - - + + - - -20 - -trim_fastqc_trim -read_type_trim: collapsedtrunc + + +17 + +trim_fastqc_trim +read_type_trim: R1 - - -14->20 - - + + +14->17 + + - - -21 - -trim_fastqc_trim -read_type_trim: collapsed + + +18 + +trim_fastqc_trim +read_type_trim: collapsedtrunc - - -14->21 - - + + +14->18 + + - - -23 - -trim_fastqc_trim -read_type_trim: R2 + + +28 + +trim_fastqc_trim +read_type_trim: collapsed - - -14->23 - - + + +14->28 + + - - -24 - -trim_fastqc_trim -read_type_trim: R1 + + +29 + +trim_fastqc_trim +read_type_trim: R2 - - -14->24 - - + + +14->29 + + - - -26 - -trim_fastqc_trim -read_type_trim: singleton + + +30 + +trim_fastqc_trim +read_type_trim: singleton - - -14->26 - - + + +14->30 + + 33 - -derep_merge_lanes -read_type_trim: collapsed + +derep_merge_lanes +read_type_trim: collapsed - + 14->33 - - + + - + 15->1 - - - - - -17 - -trim_fastqc_trim -read_type_trim: collapsed - - - -15->17 - - + + 19 - -trim_fastqc_trim -read_type_trim: R2 + +trim_fastqc_trim +read_type_trim: R1 - + 15->19 - - + + - - -22 - -trim_fastqc_trim -read_type_trim: collapsedtrunc + + +20 + +trim_fastqc_trim +read_type_trim: R2 - - -15->22 - - + + +15->20 + + - - -29 - -trim_fastqc_trim -read_type_trim: singleton + + +23 + +trim_fastqc_trim +read_type_trim: collapsed - - -15->29 - - + + +15->23 + + + + + +25 + +trim_fastqc_trim +read_type_trim: singleton + + + +15->25 + + 31 - -trim_fastqc_trim -read_type_trim: R1 + +trim_fastqc_trim +read_type_trim: collapsedtrunc - + 15->31 - - + + 35 - -derep_merge_lanes -read_type_trim: collapsed + +derep_merge_lanes +read_type_trim: collapsed - + 15->35 - - + + - + 16->1 - - + + - - -18 - -trim_fastqc_trim -read_type_trim: R1 + + +21 + +trim_fastqc_trim +read_type_trim: collapsedtrunc - - -16->18 - - + + +16->21 + + - - -25 - -trim_fastqc_trim -read_type_trim: R2 + + +22 + +trim_fastqc_trim +read_type_trim: R1 - - -16->25 - - + + +16->22 + + + + + +24 + +trim_fastqc_trim +read_type_trim: singleton + + + +16->24 + + + + + +26 + +trim_fastqc_trim +read_type_trim: R2 + + + +16->26 + + 27 - -trim_fastqc_trim -read_type_trim: collapsedtrunc + +trim_fastqc_trim +read_type_trim: collapsed - + 16->27 - - - - - -28 - -trim_fastqc_trim -read_type_trim: singleton - - - -16->28 - - - - - -30 - -trim_fastqc_trim -read_type_trim: collapsed - - - -16->30 - - + + - + 16->33 - - + + - + 17->1 - - + + - + 18->1 - - + + - + 19->1 - - + + - + 20->1 - - + + - + 21->1 - - + + - + 22->1 - - + + - + 23->1 - - + + - + 24->1 - - + + - + 25->1 - - + + - + 26->1 - - + + - + 27->1 - - + + - + 28->1 - - + + - + 29->1 - - + + - + 30->1 - - + + - + 31->1 - - + + 32 - -derep_fastqc -tool: merge_lanes + +derep_fastqc +tool: merge_lanes - + 32->1 - - + + - + 33->32 - - + + - - -39 - -derep_nonpareil_infer -tool: merge_lanes + + +37 + +derep_nonpareil_infer +tool: merge_lanes - - -33->39 - - + + +33->37 + + 41 - -derep_seqkit + +derep_seqkit - + 33->41 - - + + 34 - -derep_fastqc -tool: merge_lanes + +derep_fastqc +tool: merge_lanes - + 34->1 - - + + - + 35->34 - - + + - - -37 - -derep_nonpareil_infer -tool: merge_lanes + + +39 + +derep_nonpareil_infer +tool: merge_lanes - - -35->37 - - + + +35->39 + + 43 - -derep_seqkit + +derep_seqkit - + 35->43 - - + + 36 - -derep_nonpareil_plot + +derep_nonpareil_plot - + 36->1 - - + + - + 37->36 - - + + 38 - -derep_nonpareil_plot + +derep_nonpareil_plot - + 38->1 - - + + - + 39->38 - - + + 40 - -derep_fastqc -tool: derep + +derep_fastqc +tool: derep - + 40->1 - - + + - + 41->40 - - + + 47 - -derep_low_complexity + +derep_low_complexity - + 41->47 - - + + 42 - -derep_fastqc -tool: derep + +derep_fastqc +tool: derep - + 42->1 - - + + - + 43->42 - - + + 45 - -derep_low_complexity + +derep_low_complexity - + 43->45 - - + + 44 - -derep_fastqc -tool: low_complexity + +derep_fastqc +tool: low_complexity - + 44->1 - - + + - + 45->44 - - + + - - -67 - -prefilter_reads_extract + + +48 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: mitoch +tot_shards: 1 + + + +45->48 + + - - -45->67 - - + + +50 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: prok +tot_shards: 2 + + + +45->50 + + - - -73 - -taxon_prefilter_shard_bowtie2 -n_shard: 1 -read_type_map: collapsed -ref: virus -tot_shards: 1 - - - -45->73 - - + + +51 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: plastid +tot_shards: 1 + + + +45->51 + + - - -76 - -taxon_prefilter_shard_bowtie2 -n_shard: 2 -read_type_map: collapsed -ref: prok -tot_shards: 2 - - - -45->76 - - + + +52 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: virus +tot_shards: 1 + + + +45->52 + + - - -78 - -taxon_prefilter_shard_bowtie2 -n_shard: 1 -read_type_map: collapsed -ref: prok -tot_shards: 2 - - - -45->78 - - - - - -129 - -taxon_prefilter_shard_saturated_reads_extract - - - -45->129 - - - - - -133 - -taxon_shard_saturated_reads_extract - - - -45->133 - - + + +56 + +taxon_shard_bowtie2 +n_shard: 2 +read_type_map: collapsed +ref: prok +tot_shards: 2 + + + +45->56 + + + + + +105 + +taxon_shard_saturated_reads_extract + + + +45->105 + + 46 - -derep_fastqc -tool: low_complexity + +derep_fastqc +tool: low_complexity - + 46->1 - - + + - + 47->46 - - + + 49 - -prefilter_reads_extract + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: virus +tot_shards: 1 - + 47->49 - - + + + + + +53 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: plastid +tot_shards: 1 + + + +47->53 + + + + + +54 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: mitoch +tot_shards: 1 + + + +47->54 + + 55 - -taxon_prefilter_shard_bowtie2 -n_shard: 1 -read_type_map: collapsed -ref: virus -tot_shards: 1 + +taxon_shard_bowtie2 +n_shard: 2 +read_type_map: collapsed +ref: prok +tot_shards: 2 - + 47->55 - - + + - - -58 - -taxon_prefilter_shard_bowtie2 -n_shard: 2 -read_type_map: collapsed -ref: prok -tot_shards: 2 - - - -47->58 - - + + +57 + +taxon_shard_bowtie2 +n_shard: 1 +read_type_map: collapsed +ref: prok +tot_shards: 2 + + + +47->57 + + - - -60 - -taxon_prefilter_shard_bowtie2 -n_shard: 1 -read_type_map: collapsed -ref: prok -tot_shards: 2 - - - -47->60 - - - - - -128 - -taxon_prefilter_shard_saturated_reads_extract - - - -47->128 - - - - - -132 - -taxon_shard_saturated_reads_extract - - - -47->132 - - + + +104 + +taxon_shard_saturated_reads_extract - - -48 - -prefilter_fastqc + + +47->104 + + - + 48->1 - - + + - - -49->48 - - + + +82 + +taxon_shard_count_alns - - -96 - -taxon_shard_bowtie2 -n_shard: 1 -ref: mitoch -tot_shards: 1 + + +48->82 + + - - -49->96 - - + + +87 + +taxon_shard_saturated_reads_remove - - -99 - -taxon_shard_bowtie2 -n_shard: 1 -ref: plastid -tot_shards: 1 + + +48->87 + + - - -49->99 - - + + +49->1 + + - - -50 - -prefilter_reads_merge + + +67 + +taxon_shard_count_alns - - -50->49 - - + + +49->67 + + - - -51 - -prefilter_reads_taxonomy + + +75 + +taxon_shard_saturated_reads_remove - - -51->50 - - + + +49->75 + + - - -52 - -taxon_prefilter_align_merge + + +50->1 + + - - -52->51 - - + + +79 + +taxon_shard_saturated_reads_remove + + + +50->79 + + + + + +83 + +taxon_shard_count_alns + + + +50->83 + + + + + +51->1 + + 84 - -taxon_prefilter_align_samtools_stats + +taxon_shard_count_alns - - -52->84 - - - - - -87 - -taxon_prefilter_align_sort_taxon - - - -52->87 - - + + +51->84 + + 91 - -taxon_prefilter_metadmg_lca + +taxon_shard_saturated_reads_remove - - -52->91 - - - - - -130 - -taxon_prefilter_metadmg_damage - - - -52->130 - - + + +51->91 + + - - -53 - -taxon_prefilter_shard_unicorn_refstats + + +52->1 + + - - -53->52 - - + + +85 + +taxon_shard_count_alns - - -54 - -taxon_prefilter_shard_saturated_reads_remove + + +52->85 + + - - -54->53 - - + + +93 + +taxon_shard_saturated_reads_remove - - -55->1 - - + + +52->93 + + - - -55->54 - - + + +53->1 + + - - -61 - -taxon_prefilter_shard_count_alns + + +66 + +taxon_shard_count_alns - + + +53->66 + + + + + +73 + +taxon_shard_saturated_reads_remove + + -55->61 - - +53->73 + + - - -56 - -taxon_prefilter_shard_saturated_reads_filter + + +54->1 + + - - -56->50 - - + + +64 + +taxon_shard_count_alns - - -56->54 - - + + +54->64 + + + + + +69 + +taxon_shard_saturated_reads_remove + + + +54->69 + + + + + +55->1 + + 63 - -taxon_prefilter_shard_saturated_reads_remove + +taxon_shard_count_alns - - -56->63 - - + + +55->63 + + + + + +71 + +taxon_shard_saturated_reads_remove + + + +55->71 + + + + + +56->1 + + + + + +81 + +taxon_shard_count_alns + + + +56->81 + + + + + +89 + +taxon_shard_saturated_reads_remove + + + +56->89 + + + + + +57->1 + + + + + +61 + +taxon_shard_saturated_reads_remove + + + +57->61 + + 65 - -taxon_prefilter_shard_saturated_reads_remove - - - -56->65 - - + +taxon_shard_count_alns - - -56->128 - - - - - -57 - -taxon_prefilter_shard_count_alns + + +57->65 + + - - -57->56 - - + + +58 + +taxon_align_samtools_stats - + 58->1 - - - - - -58->57 - - - - - -58->63 - - + + 59 - -taxon_prefilter_shard_count_alns + +taxon_align_merge - - -59->56 - - + + +59->58 + + - - -60->1 - - + + +95 + +taxon_align_sort_taxon + + + +59->95 + + + + + +99 + +taxon_metadmg_lca + + + +59->99 + + + + + +106 + +taxon_metadmg_damage + + + +59->106 + + + + + +60 + +taxon_shard_unicorn_refstats - + 60->59 - - - - - -60->65 - - + + - - -61->56 - - + + +61->60 + + 62 - -taxon_prefilter_shard_unicorn_refstats + +taxon_shard_saturated_reads_filter - - -62->52 - - + + +62->61 + + - - -63->62 - - + + +62->69 + + - - -64 - -taxon_prefilter_shard_unicorn_refstats + + +62->71 + + - - -64->52 - - + + +62->73 + + - + -65->64 - - +62->75 + + - - -66 - -prefilter_fastqc - - - -66->1 - - + + +62->104 + + - - -67->66 - - + + +63->62 + + - - -97 - -taxon_shard_bowtie2 -n_shard: 1 -ref: mitoch -tot_shards: 1 + + +64->62 + + - - -67->97 - - + + +65->62 + + - - -98 - -taxon_shard_bowtie2 -n_shard: 1 -ref: plastid -tot_shards: 1 + + +66->62 + + - - -67->98 - - + + +67->62 + + 68 - -prefilter_reads_merge - - - -68->67 - - + +taxon_shard_unicorn_refstats - - -69 - -prefilter_reads_taxonomy + + +68->59 + + - + 69->68 - - + + 70 - -taxon_prefilter_align_merge - - - -70->69 - - - - - -85 - -taxon_prefilter_align_samtools_stats - - - -70->85 - - - - - -89 - -taxon_prefilter_align_sort_taxon - - - -70->89 - - - - - -93 - -taxon_prefilter_metadmg_lca - - - -70->93 - - - - - -131 - -taxon_prefilter_metadmg_damage - - - -70->131 - - + +taxon_shard_unicorn_refstats - - -71 - -taxon_prefilter_shard_unicorn_refstats + + +70->59 + + - + 71->70 - - + + 72 - -taxon_prefilter_shard_saturated_reads_remove - - - -72->71 - - + +taxon_shard_unicorn_refstats - - -73->1 - - + + +72->59 + + - + 73->72 - - - - - -79 - -taxon_prefilter_shard_count_alns - - - -73->79 - - + + 74 - -taxon_prefilter_shard_saturated_reads_filter - - - -74->68 - - - - - -74->72 - - - - - -81 - -taxon_prefilter_shard_saturated_reads_remove - - - -74->81 - - - - - -83 - -taxon_prefilter_shard_saturated_reads_remove - - - -74->83 - - - - - -74->129 - - + +taxon_shard_unicorn_refstats - - -75 - -taxon_prefilter_shard_count_alns + + +74->59 + + - + 75->74 - - + + + + + +76 + +taxon_align_samtools_stats - + 76->1 - - - - - -76->75 - - - - - -76->81 - - + + 77 - -taxon_prefilter_shard_count_alns + +taxon_align_merge - - -77->74 - - + + +77->76 + + - - -78->1 - - + + +97 + +taxon_align_sort_taxon + + + +77->97 + + + + + +101 + +taxon_metadmg_lca + + + +77->101 + + + + + +107 + +taxon_metadmg_damage + + + +77->107 + + + + + +78 + +taxon_shard_unicorn_refstats - + 78->77 - - + + - - -78->83 - - - - - -79->74 - - + + +79->78 + + 80 - -taxon_prefilter_shard_unicorn_refstats + +taxon_shard_saturated_reads_filter - - -80->70 - - + + +80->79 + + + + + +80->87 + + + + + +80->89 + + + + + +80->91 + + + + + +80->93 + + + + + +80->105 + + - + 81->80 - - - - - -82 - -taxon_prefilter_shard_unicorn_refstats + + - + -82->70 - - +82->80 + + - - -83->82 - - + + +83->80 + + - - -84->1 - - + + +84->80 + + - - -85->1 - - + + +85->80 + + 86 - -taxon_prefilter_align_unicorn_taxstats + +taxon_shard_unicorn_refstats - - -86->1 - - + + +86->77 + + - + 87->86 - - + + 88 - -taxon_prefilter_align_unicorn_taxstats + +taxon_shard_unicorn_refstats - - -88->1 - - + + +88->77 + + - + 89->88 - - + + 90 - -taxon_prefilter_metadmg_dfit + +taxon_shard_unicorn_refstats - - -90->1 - - - - - -94 - -taxon_prefilter_metadmg_aggregate - - - -90->94 - - + + +90->77 + + - + 91->90 - - - - - -91->94 - - + + 92 - -taxon_prefilter_metadmg_dfit - - - -92->1 - - - - - -95 - -taxon_prefilter_metadmg_aggregate + +taxon_shard_unicorn_refstats - - -92->95 - - + + +92->77 + + - + 93->92 - - - - - -93->95 - - + + - - -94->0 - - + + +94 + +taxon_align_unicorn_taxstats - + 94->1 - - + + - - -95->0 - - + + +95->94 + + - - -95->1 - - + + +96 + +taxon_align_unicorn_taxstats - + 96->1 - - + + - - -103 - -taxon_shard_saturated_reads_remove + + +97->96 + + - - -96->103 - - + + +98 + +taxon_metadmg_dfit - - -106 - -taxon_shard_count_alns + + +98->1 + + - - -96->106 - - + + +102 + +taxon_metadmg_aggregate - - -97->1 - - - - - -112 - -taxon_shard_saturated_reads_remove - - - -97->112 - - - - - -115 - -taxon_shard_count_alns - - - -97->115 - - + + +98->102 + + - - -98->1 - - - - - -114 - -taxon_shard_count_alns - - - -98->114 - - - - - -117 - -taxon_shard_saturated_reads_remove - - - -98->117 - - - - - -99->1 - - + + +99->98 + + - - -105 - -taxon_shard_count_alns - - - -99->105 - - - - - -108 - -taxon_shard_saturated_reads_remove - - - -99->108 - - + + +99->102 + + 100 - -taxon_align_samtools_stats + +taxon_metadmg_dfit - + 100->1 - - + + - - -101 - -taxon_align_merge + + +103 + +taxon_metadmg_aggregate + + + +100->103 + + - + 101->100 - - - - - -119 - -taxon_align_sort_taxon - - - -101->119 - - - - - -123 - -taxon_metadmg_lca - - - -101->123 - - - - - -134 - -taxon_metadmg_damage - - - -101->134 - - - - - -102 - -taxon_shard_unicorn_refstats - - - -102->101 - - - - - -103->102 - - + + - - -104 - -taxon_shard_saturated_reads_filter - - - -104->103 - - - - - -104->108 - - - - - -104->132 - - - - - -105->104 - - - - - -106->104 - - + + +101->103 + + - - -107 - -taxon_shard_unicorn_refstats - - - -107->101 - - - - - -108->107 - - - - - -109 - -taxon_align_samtools_stats - - - -109->1 - - - - - -110 - -taxon_align_merge - - - -110->109 - - - - - -121 - -taxon_align_sort_taxon - - - -110->121 - - - - - -125 - -taxon_metadmg_lca - - - -110->125 - - - - - -135 - -taxon_metadmg_damage - - - -110->135 - - - - - -111 - -taxon_shard_unicorn_refstats - - - -111->110 - - - - - -112->111 - - - - - -113 - -taxon_shard_saturated_reads_filter - - - -113->112 - - - - - -113->117 - - - - - -113->133 - - - - - -114->113 - - - - - -115->113 - - - - - -116 - -taxon_shard_unicorn_refstats - - - -116->110 - - - - - -117->116 - - - - - -118 - -taxon_align_unicorn_taxstats - - - -118->1 - - - - - -119->118 - - - - - -120 - -taxon_align_unicorn_taxstats - - - -120->1 - - - - - -121->120 - - - - - -122 - -taxon_metadmg_dfit - - - -122->1 - - - - - -126 - -taxon_metadmg_aggregate - - - -122->126 - - - - - -123->122 - - - - - -123->126 - - - - - -124 - -taxon_metadmg_dfit - - - -124->1 - - - - - -127 - -taxon_metadmg_aggregate - - - -124->127 - - - - - -125->124 - - - - - -125->127 - - - - - -126->0 - - + + +102->0 + + - - -126->1 - - + + +102->1 + + - - -127->0 - - + + +103->0 + + - - -127->1 - - + + +103->1 + + - + -128->0 - - +104->0 + + - + -129->0 - - +105->0 + + - + -130->0 - - +106->0 + + - + -131->0 - - - - - -132->0 - - - - - -133->0 - - - - - -134->0 - - - - - -135->0 - - +107->0 + + diff --git a/examples/euk_prok_virus/filegraph.svg b/examples/euk_prok_virus/filegraph.svg index 4eb65e6..2549712 100644 --- a/examples/euk_prok_virus/filegraph.svg +++ b/examples/euk_prok_virus/filegraph.svg @@ -1,1357 +1,826 @@ - - - + + snakemake_dag - + 0 -multiqc_taxon_upload - -↪ input - -reports/multiqc.taxon.html -reports/multiqc_data.taxon.zip -reports/multiqc_data.taxon.zip -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/prefilter_reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/prefilter_reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/prefilter_reads/saturated/Lib_LVsim2_collapsed.fastq.gz -results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz -results/reads/saturated/Lib_LVsim2_collapsed.fastq.gz -stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/metadmg/damage/Lib_LVsim2_collapsed.stat.gz -stats/prefilter_metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/prefilter_metadmg/damage/Lib_LVsim1_collapsed.stat.gz -stats/prefilter_metadmg/damage/Lib_LVsim2_collapsed.stat.gz - -output → - -stats/reports/multiqc_taxon.upload.flag - - - +multiqc_taxon_upload + +↪ input + +reports/multiqc.taxon.html +reports/multiqc_data.taxon.zip +reports/multiqc_data.taxon.zip +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz +results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz +results/reads/saturated/Lib_LVsim1_collapsed.fastq.gz +results/reads/saturated/Lib_LVsim2_collapsed.fastq.gz +stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz +stats/metadmg/damage/Lib_LVsim1_collapsed.stat.gz +stats/metadmg/damage/Lib_LVsim2_collapsed.stat.gz + +output → + +stats/reports/multiqc_taxon.upload.flag + + + 1 -multiqc_taxon - -↪ input - -/maps/projects/caeg/people/lnc113/workflows/aeDNA/aeDNA/workflow/resources/multiqc_config.yaml -logs/prefilter_shards/bowtie2/Lib_LVsim1_collapsed.prok.1-of-2.log -logs/prefilter_shards/bowtie2/Lib_LVsim1_collapsed.prok.2-of-2.log -logs/prefilter_shards/bowtie2/Lib_LVsim1_collapsed.virus.1-of-1.log -logs/prefilter_shards/bowtie2/Lib_LVsim2_collapsed.prok.1-of-2.log -logs/prefilter_shards/bowtie2/Lib_LVsim2_collapsed.prok.2-of-2.log -logs/prefilter_shards/bowtie2/Lib_LVsim2_collapsed.virus.1-of-1.log -logs/shards/bowtie2/Lib_LVsim1_collapsed.mitoch.1-of-1.log -logs/shards/bowtie2/Lib_LVsim1_collapsed.plastid.1-of-1.log -logs/shards/bowtie2/Lib_LVsim2_collapsed.mitoch.1-of-1.log -logs/shards/bowtie2/Lib_LVsim2_collapsed.plastid.1-of-1.log -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz -results/prefilter_metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz -results/prefilter_metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/prefilter_metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz -results/prefilter_metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz -stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt -stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt -stats/aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv -stats/aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv -stats/aligns/unicorn/taxstats/Lib_LVsim2_collapsed.tsv -stats/prefilter_aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools/stats/Lib_LVsim1_collapsed.txt -stats/prefilter_aligns/samtools/stats/Lib_LVsim2_collapsed.txt -stats/prefilter_aligns/samtools/stats/Lib_LVsim2_collapsed.txt -stats/prefilter_aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv -stats/prefilter_aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv -stats/prefilter_aligns/unicorn/taxstats/Lib_LVsim2_collapsed.tsv -stats/reads/fastqc/derep/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/derep/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/low_complexity/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/low_complexity/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/merge_lanes/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/merge_lanes/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/prefilter/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/prefilter/Lib_LVsim1_collapsed_fastqc.zip -stats/reads/fastqc/prefilter/Lib_LVsim2_collapsed_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L001_R1.html -stats/reads/fastqc/raw/Lib_LVsim1_L001_R1_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L001_R2.html -stats/reads/fastqc/raw/Lib_LVsim1_L001_R2_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L002_R1.html -stats/reads/fastqc/raw/Lib_LVsim1_L002_R1_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim1_L002_R2.html -stats/reads/fastqc/raw/Lib_LVsim1_L002_R2_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim2_L001_R1.html -stats/reads/fastqc/raw/Lib_LVsim2_L001_R1_fastqc.zip -stats/reads/fastqc/raw/Lib_LVsim2_L001_R2.html -stats/reads/fastqc/raw/Lib_LVsim2_L001_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_R1.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_R1_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_R2.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton.html -stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_R1.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_R1_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_R2.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton.html -stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_R1.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_R1_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_R2.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_R2_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc_fastqc.zip -stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton.html -stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton_fastqc.zip -stats/reads/nonpareil/merge_lanes/Lib_LVsim1_collapsed.json -stats/reads/nonpareil/merge_lanes/Lib_LVsim2_collapsed.json -stats/reads/trim/Lib_LVsim1_L001_pe.settings -stats/reads/trim/Lib_LVsim1_L002_pe.settings -stats/reads/trim/Lib_LVsim2_L001_pe.settings - -output → - -reports/multiqc.taxon.html -reports/multiqc_data.taxon.zip - - - +multiqc_taxon + +↪ input + +/maps/projects/caeg/people/lnc113/workflows/aeDNA/aeDNA/workflow/resources/multiqc_config.yaml +logs/shards/bowtie2/Lib_LVsim1_collapsed.mitoch.1-of-1.log +logs/shards/bowtie2/Lib_LVsim1_collapsed.plastid.1-of-1.log +logs/shards/bowtie2/Lib_LVsim1_collapsed.prok.1-of-2.log +logs/shards/bowtie2/Lib_LVsim1_collapsed.prok.2-of-2.log +logs/shards/bowtie2/Lib_LVsim1_collapsed.virus.1-of-1.log +logs/shards/bowtie2/Lib_LVsim2_collapsed.mitoch.1-of-1.log +logs/shards/bowtie2/Lib_LVsim2_collapsed.plastid.1-of-1.log +logs/shards/bowtie2/Lib_LVsim2_collapsed.prok.1-of-2.log +logs/shards/bowtie2/Lib_LVsim2_collapsed.prok.2-of-2.log +logs/shards/bowtie2/Lib_LVsim2_collapsed.virus.1-of-1.log +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim1_collapsed.stat.gz +results/metadmg/aggregate/Lib_LVsim2_collapsed.stat.gz +results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz +results/metadmg/dfit/Lib_LVsim1_collapsed.dfit.gz +results/metadmg/dfit/Lib_LVsim2_collapsed.dfit.gz +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim1_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/samtools/stats/Lib_LVsim2_collapsed.txt +stats/aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv +stats/aligns/unicorn/taxstats/Lib_LVsim1_collapsed.tsv +stats/aligns/unicorn/taxstats/Lib_LVsim2_collapsed.tsv +stats/reads/fastqc/derep/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/derep/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/low_complexity/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/low_complexity/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/merge_lanes/Lib_LVsim1_collapsed_fastqc.zip +stats/reads/fastqc/merge_lanes/Lib_LVsim2_collapsed_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L001_R1.html +stats/reads/fastqc/raw/Lib_LVsim1_L001_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L001_R2.html +stats/reads/fastqc/raw/Lib_LVsim1_L001_R2_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L002_R1.html +stats/reads/fastqc/raw/Lib_LVsim1_L002_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim1_L002_R2.html +stats/reads/fastqc/raw/Lib_LVsim1_L002_R2_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim2_L001_R1.html +stats/reads/fastqc/raw/Lib_LVsim2_L001_R1_fastqc.zip +stats/reads/fastqc/raw/Lib_LVsim2_L001_R2.html +stats/reads/fastqc/raw/Lib_LVsim2_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_R1.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_R2.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton.html +stats/reads/fastqc/trim/Lib_LVsim1_L001_singleton_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_R1.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_R2.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton.html +stats/reads/fastqc/trim/Lib_LVsim1_L002_singleton_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_R1.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_R1_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_R2.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_R2_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsed_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_collapsedtrunc_fastqc.zip +stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton.html +stats/reads/fastqc/trim/Lib_LVsim2_L001_singleton_fastqc.zip +stats/reads/nonpareil/merge_lanes/Lib_LVsim1_collapsed.json +stats/reads/nonpareil/merge_lanes/Lib_LVsim2_collapsed.json +stats/reads/trim/Lib_LVsim1_L001_pe.settings +stats/reads/trim/Lib_LVsim1_L002_pe.settings +stats/reads/trim/Lib_LVsim2_L001_pe.settings + +output → + +reports/multiqc.taxon.html +reports/multiqc_data.taxon.zip + + + - + 1->0 - - + + 2 -trim_fastqc_raw - -↪ input - -results/reads/raw/{sample}_{library}_{lane}_{read_type_raw}.fastq.gz - -output → - -stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.html -stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}_fastqc.zip - - - +trim_fastqc_raw + +↪ input + +results/reads/raw/{sample}_{library}_{lane}_{read_type_raw}.fastq.gz + +output → + +stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.html +stats/reads/fastqc/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}_fastqc.zip + + + - + 2->1 - - + + 3 -trim_get_fastq_raw - -↪ input - -<input function> - -output → - -results/reads/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.fastq.gz - - - +trim_get_fastq_raw + +↪ input + +<input function> + +output → + +results/reads/raw/{sample}_{library}_{lane}_{read_type_raw,R2|R1}.fastq.gz + + + - + 3->2 - - + + 4 -trim_adapterremoval_fastq_pe - -↪ input - -<input function> - -output → - -results/reads/trim/{sample}_{library}_{lane}_R1.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_R2.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_collapsed.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_collapsedtrunc.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_discarded.fastq.gz -results/reads/trim/{sample}_{library}_{lane}_singleton.fastq.gz -stats/reads/trim/{sample}_{library}_{lane}_pe.settings - - - +trim_adapterremoval_fastq_pe + +↪ input + +<input function> + +output → + +results/reads/trim/{sample}_{library}_{lane}_R1.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_R2.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_collapsed.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_collapsedtrunc.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_discarded.fastq.gz +results/reads/trim/{sample}_{library}_{lane}_singleton.fastq.gz +stats/reads/trim/{sample}_{library}_{lane}_pe.settings + + + - + 3->4 - - + + 4->1 - - + + 5 -trim_fastqc_trim - -↪ input - -results/reads/trim/{sample}_{library}_{lane}_{read_type_trim}.fastq.gz - -output → - -stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,collapsed|R2|R1|singleton|collapsedtrunc}.html -stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,collapsed|R2|R1|singleton|collapsedtrunc}_fastqc.zip - - - +trim_fastqc_trim + +↪ input + +results/reads/trim/{sample}_{library}_{lane}_{read_type_trim}.fastq.gz + +output → + +stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,singleton|collapsed|collapsedtrunc|R2|R1}.html +stats/reads/fastqc/trim/{sample}_{library}_{lane}_{read_type_trim,singleton|collapsed|collapsedtrunc|R2|R1}_fastqc.zip + + + - + 4->5 - - + + 7 -derep_merge_lanes - -↪ input - -<input function> - -output → - -temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz - - - +derep_merge_lanes + +↪ input + +<input function> + +output → + +temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz + + + - + 4->7 - - + + - + 5->1 - - + + 6 -derep_fastqc - -↪ input - -<input function> - -output → - -stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}.html -stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}_fastqc.zip - - - +derep_fastqc + +↪ input + +<input function> + +output → + +stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}.html +stats/reads/fastqc/{tool,merge_lanes|extend/tadpole|derep|represent/grep|low_complexity}/{sample}_{library}_{read_type_trim}_fastqc.zip + + + - + 6->1 - - + + - + 7->6 - - + + 9 -derep_nonpareil_infer - -↪ input - -<input function> - -output → - -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.log -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npa -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npc -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo - - - +derep_nonpareil_infer + +↪ input + +<input function> + +output → + +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.log +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npa +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npc +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo + + + - + 7->9 - - + + 10 -derep_seqkit - -↪ input - -temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz - -output → - -stats/reads/derep/{sample}_{library}_{read_type_trim}.dup.tsv -temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz - - - +derep_seqkit + +↪ input + +temp/reads/merge_lanes/{sample}_{library}_{read_type_trim}.fastq.gz + +output → + +stats/reads/derep/{sample}_{library}_{read_type_trim}.dup.tsv +temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz + + + - + 7->10 - - + + 8 -derep_nonpareil_plot - -↪ input - -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo - -output → - -reports/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.pdf -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.json -stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.tsv - - - +derep_nonpareil_plot + +↪ input + +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.npo + +output → + +reports/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.pdf +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.json +stats/reads/nonpareil/{tool}/{sample}_{library}_{read_type_trim}.tsv + + + - + 8->1 - - + + - + 9->8 - - + + - + 10->6 - - + + 11 -derep_low_complexity - -↪ input - -temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz - -output → - -results/reads/low_complexity/{sample}_{library}_{read_type_trim}.fastq.gz -stats/reads/low_complexity/{sample}_{library}_{read_type_trim}.txt -temp/reads/low_complexity/{sample}_{library}_{read_type_trim}.discarded.fastq.gz - - - +derep_low_complexity + +↪ input + +temp/reads/derep/{sample}_{library}_{read_type_trim}.fastq.gz + +output → + +results/reads/low_complexity/{sample}_{library}_{read_type_trim}.fastq.gz +stats/reads/low_complexity/{sample}_{library}_{read_type_trim}.txt +temp/reads/low_complexity/{sample}_{library}_{read_type_trim}.discarded.fastq.gz + + + - + 10->11 - - + + - + 11->6 - - - - - -13 -prefilter_reads_extract - -↪ input - -<input function> -temp/reads/prefilter/merge/{sample}_{library}_{read_type_map}.read_ids - -output → - -results/reads/prefilter/extract/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.fastq.gz - - - - - - -11->13 - - - - - -19 -taxon_prefilter_shard_bowtie2 - -↪ input - -<input function> -<input function> - -output → - -temp/prefilter_shards/bowtie2/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -11->19 - - - - - -40 -taxon_prefilter_shard_saturated_reads_extract - -↪ input - -<input function> -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -results/prefilter_reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz - - - - - - -11->40 - - - - - -42 -taxon_shard_saturated_reads_extract - -↪ input - -<input function> -temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -results/reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz - - - - - - -11->42 - - + + 12 -prefilter_fastqc - -↪ input - -results/reads/prefilter/extract/{sample}_{library}_{read_type_map}.fastq.gz - -output → - -stats/reads/fastqc/prefilter/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.html -stats/reads/fastqc/prefilter/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}_fastqc.zip - - - +taxon_shard_bowtie2 + +↪ input + +<input function> +<input function> + +output → + +temp/shards/bowtie2/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +11->12 + + + + + +24 +taxon_shard_saturated_reads_extract + +↪ input + +<input function> +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv + +output → + +results/reads/saturated/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.fastq.gz + + + + + + +11->24 + + - + 12->1 - - + + - - -13->12 - - - - - -28 -taxon_shard_bowtie2 - -↪ input - -<input function> -<input function> - -output → - -temp/shards/bowtie2/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -13->28 - - + + +16 +taxon_shard_saturated_reads_remove + +↪ input + +<input function> +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv + +output → + +temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + + + + +12->16 + + + + + +18 +taxon_shard_count_alns + +↪ input + +<input function> + +output → + +temp/shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv + + + + + + +12->18 + + + + + +13 +taxon_align_samtools_stats + +↪ input + +results/aligns/merge/{sample}_{library}_{read_type_map}.bam + +output → + +stats/aligns/samtools/stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt + + + + + + +13->1 + + 14 -prefilter_reads_merge - -↪ input - -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv -temp/reads/prefilter/taxonomy/{sample}_{library}_{read_type_map}.read_ids - -output → - -temp/reads/prefilter/merge/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.read_ids - - - +taxon_align_merge + +↪ input + +<input function> + +output → + +results/aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam + + + - + 14->13 - - + + + + + +20 +taxon_align_sort_taxon + +↪ input + +results/aligns/merge/{sample}_{library}_{read_type_map}.bam + +output → + +temp/aligns/sort_taxon/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam + + + + + + +14->20 + + + + + +22 +taxon_metadmg_lca + +↪ input + +<function <lambda> at 0x7f19482f3270> +data/mitoch.acc2taxid.gz +data/plastid.acc2taxid.gz +data/prok.acc2taxid.gz +data/taxdump/names.dmp +data/taxdump/nodes.dmp +data/virus.acc2taxid.gz + +output → + +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.family.bam +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz +results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.used.bam +stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz +stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +14->22 + + + + + +25 +taxon_metadmg_damage + +↪ input + +<function <lambda> at 0x7f19482f3530> + +output → + +results/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz +stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz +stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +14->25 + + 15 -prefilter_reads_taxonomy - -↪ input - -data/prok.acc2taxid.gz -data/taxdump/names.dmp -data/taxdump/nodes.dmp -data/virus.acc2taxid.gz -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -temp/reads/prefilter/taxonomy/{sample,Lib}_{library,LVsim1|LVsim2}_{read_type_map}.read_ids - - - +taxon_shard_unicorn_refstats + +↪ input + +<input function> +data/taxdump/names.dmp +data/taxdump/nodes.dmp +temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam + +output → + +stats/shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv +temp/shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam + + + - + 15->14 - - - - - -16 -taxon_prefilter_align_merge - -↪ input - -<input function> - -output → - -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam - - - + + - + 16->15 - - - - - -22 -taxon_prefilter_align_samtools_stats - -↪ input - -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -stats/prefilter_aligns/samtools/stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt - - - - - - -16->22 - - - - - -24 -taxon_prefilter_align_sort_taxon - -↪ input - -results/prefilter_aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -temp/prefilter_aligns/sort_taxon/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam - - - - - - -16->24 - - - - - -26 -taxon_prefilter_metadmg_lca - -↪ input - -<function <lambda> at 0x7f59c911b7e0> -data/prok.acc2taxid.gz -data/taxdump/names.dmp -data/taxdump/nodes.dmp -data/virus.acc2taxid.gz - -output → - -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.family.bam -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.used.bam -stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -16->26 - - - - - -41 -taxon_prefilter_metadmg_damage - -↪ input - -<function <lambda> at 0x7f59c911b600> - -output → - -results/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -stats/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/prefilter_metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -16->41 - - + + 17 -taxon_prefilter_shard_unicorn_refstats - -↪ input - -<input function> -data/taxdump/names.dmp -data/taxdump/nodes.dmp -temp/prefilter_shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam - -output → - -stats/prefilter_shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv -temp/prefilter_shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - +taxon_shard_saturated_reads_filter + +↪ input + +temp/shards/count_alns/{sample}_{library}_collapsed.mitoch.1-of-1.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.plastid.1-of-1.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.prok.1-of-2.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.prok.2-of-2.tsv +temp/shards/count_alns/{sample}_{library}_collapsed.virus.1-of-1.tsv + +output → + +temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv + + + - + 17->16 - - + + - - -18 -taxon_prefilter_shard_saturated_reads_remove - -↪ input - -<input function> -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -temp/prefilter_shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - + + +17->24 + + - + 18->17 - - + + + + + +19 +taxon_align_unicorn_taxstats + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +temp/aligns/sort_taxon/{sample}_{library}_{read_type_map}.bam + +output → + +stats/aligns/unicorn/taxstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv + + + - + 19->1 - - + + - - -19->18 - - + + +20->19 + + 21 -taxon_prefilter_shard_count_alns - -↪ input - -<input function> - -output → - -temp/prefilter_shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv - - - - - - -19->21 - - - - - -20 -taxon_prefilter_shard_saturated_reads_filter - -↪ input - -temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.prok.1-of-2.tsv -temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.prok.2-of-2.tsv -temp/prefilter_shards/count_alns/{sample}_{library}_collapsed.virus.1-of-1.tsv - -output → - -temp/prefilter_shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv - - - - - - -20->14 - - - - - -20->18 - - - - - -20->40 - - - - - -21->20 - - - - - -22->1 - - +taxon_metadmg_dfit + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz + +output → + +results/metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz + + + + + + +21->1 + + 23 -taxon_prefilter_align_unicorn_taxstats - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -temp/prefilter_aligns/sort_taxon/{sample}_{library}_{read_type_map}.bam - -output → - -stats/prefilter_aligns/unicorn/taxstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv - - - - - - -23->1 - - +taxon_metadmg_aggregate + +↪ input + +data/taxdump/names.dmp +data/taxdump/nodes.dmp +results/metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz +results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz +stats/metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz + +output → + +results/metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz + + + + + + +21->23 + + - - -24->23 - - + + +22->21 + + - - -25 -taxon_prefilter_metadmg_dfit - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz - -output → - -results/prefilter_metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz - - - - - - -25->1 - - - - - -27 -taxon_prefilter_metadmg_aggregate - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -results/prefilter_metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz -results/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz -stats/prefilter_metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz - -output → - -results/prefilter_metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -25->27 - - - - - -26->25 - - - - - -26->27 - - - - - -27->0 - - + + +22->23 + + - - -27->1 - - + + +23->0 + + - - -28->1 - - - - - -32 -taxon_shard_saturated_reads_remove - -↪ input - -<input function> -temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map}.tsv - -output → - -temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -28->32 - - - - - -34 -taxon_shard_count_alns - -↪ input - -<input function> - -output → - -temp/shards/count_alns/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv - - - - - - -28->34 - - - - - -29 -taxon_align_samtools_stats - -↪ input - -results/aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -stats/aligns/samtools/stats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.txt - - - - - - -29->1 - - - - - -30 -taxon_align_merge - -↪ input - -<input function> - -output → - -results/aligns/merge/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam - - - - - - -30->29 - - - - - -36 -taxon_align_sort_taxon - -↪ input - -results/aligns/merge/{sample}_{library}_{read_type_map}.bam - -output → - -temp/aligns/sort_taxon/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bam - - - - - - -30->36 - - - - - -38 -taxon_metadmg_lca - -↪ input - -<function <lambda> at 0x7f59c913b9c0> -data/mitoch.acc2taxid.gz -data/plastid.acc2taxid.gz -data/taxdump/names.dmp -data/taxdump/nodes.dmp - -output → - -results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.family.bam -results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.lca.gz -results/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.used.bam -stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/metadmg/lca/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -30->38 - - - - - -43 -taxon_metadmg_damage - -↪ input - -<function <lambda> at 0x7f59c913ba60> - -output → - -results/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.bdamage.gz -stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.rlens.gz -stats/metadmg/damage/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -30->43 - - - - - -31 -taxon_shard_unicorn_refstats - -↪ input - -<input function> -data/taxdump/names.dmp -data/taxdump/nodes.dmp -temp/shards/saturated_reads/remove/{sample}_{library}_{read_type_map}.{ref}.{n_shard}-of-{tot_shards}.bam - -output → - -stats/shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.tsv -temp/shards/unicorn/refstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.{ref}.{n_shard}-of-{tot_shards}.bam - - - - - - -31->30 - - - - - -32->31 - - - - - -33 -taxon_shard_saturated_reads_filter - -↪ input - -temp/shards/count_alns/{sample}_{library}_collapsed.mitoch.1-of-1.tsv -temp/shards/count_alns/{sample}_{library}_collapsed.plastid.1-of-1.tsv - -output → - -temp/shards/saturated_reads/filter/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv - - - - - - -33->32 - - - - - -33->42 - - - - - -34->33 - - - - - -35 -taxon_align_unicorn_taxstats - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -temp/aligns/sort_taxon/{sample}_{library}_{read_type_map}.bam - -output → - -stats/aligns/unicorn/taxstats/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.tsv - - - - - + -35->1 - - - - - -36->35 - - - - - -37 -taxon_metadmg_dfit - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz - -output → - -results/metadmg/dfit/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.dfit.gz - - - - - - -37->1 - - - - - -39 -taxon_metadmg_aggregate - -↪ input - -data/taxdump/names.dmp -data/taxdump/nodes.dmp -results/metadmg/dfit/{sample}_{library}_{read_type_map}.dfit.gz -results/metadmg/lca/{sample}_{library}_{read_type_map}.bdamage.gz -stats/metadmg/lca/{sample}_{library}_{read_type_map}.stat.gz - -output → - -results/metadmg/aggregate/{sample}_{library}_{read_type_map,pe|se|singleton|collapsed}.stat.gz - - - - - - -37->39 - - - - - -38->37 - - - - - -38->39 - - - - - -39->0 - - - - - -39->1 - - - - - -40->0 - - - - - -41->0 - - - - - -42->0 - - +23->1 + + - + -43->0 - - +24->0 + + + + + +25->0 + + diff --git a/examples/euk_prok_virus/rulegraph.svg b/examples/euk_prok_virus/rulegraph.svg index d3534ce..ec6216a 100644 --- a/examples/euk_prok_virus/rulegraph.svg +++ b/examples/euk_prok_virus/rulegraph.svg @@ -1,721 +1,421 @@ - - - + + snakemake_dag - + 0 - -multiqc_taxon_upload + +multiqc_taxon_upload 1 - -multiqc_taxon + +multiqc_taxon - + 1->0 - - + + 2 - -trim_fastqc_raw + +trim_fastqc_raw - + 2->1 - - + + 3 - -trim_get_fastq_raw + +trim_get_fastq_raw - + 3->2 - - + + 4 - -trim_adapterremoval_fastq_pe + +trim_adapterremoval_fastq_pe - + 3->4 - - + + - + 4->1 - - + + 5 - -trim_fastqc_trim + +trim_fastqc_trim - + 4->5 - - + + 7 - -derep_merge_lanes + +derep_merge_lanes - + 4->7 - - + + - + 5->1 - - + + 6 - -derep_fastqc + +derep_fastqc - + 6->1 - - + + - + 7->6 - - + + 9 - -derep_nonpareil_infer + +derep_nonpareil_infer - + 7->9 - - + + 10 - -derep_seqkit + +derep_seqkit - + 7->10 - - + + 8 - -derep_nonpareil_plot + +derep_nonpareil_plot - + 8->1 - - + + - + 9->8 - - + + - + 10->6 - - + + 11 - -derep_low_complexity + +derep_low_complexity - + 10->11 - - + + - + 11->6 - - - - - -13 - -prefilter_reads_extract - - - -11->13 - - - - - -19 - -taxon_prefilter_shard_bowtie2 - - - -11->19 - - - - - -40 - -taxon_prefilter_shard_saturated_reads_extract - - - -11->40 - - - - - -42 - -taxon_shard_saturated_reads_extract - - - -11->42 - - + + 12 - -prefilter_fastqc + +taxon_shard_bowtie2 + + + +11->12 + + + + + +24 + +taxon_shard_saturated_reads_extract + + + +11->24 + + - + 12->1 - - + + - - -13->12 - - - - - -28 - -taxon_shard_bowtie2 - - - -13->28 - - + + +16 + +taxon_shard_saturated_reads_remove + + + +12->16 + + + + + +18 + +taxon_shard_count_alns + + + +12->18 + + + + + +13 + +taxon_align_samtools_stats + + + +13->1 + + 14 - -prefilter_reads_merge + +taxon_align_merge - + 14->13 - - + + + + + +20 + +taxon_align_sort_taxon + + + +14->20 + + + + + +22 + +taxon_metadmg_lca + + + +14->22 + + + + + +25 + +taxon_metadmg_damage + + + +14->25 + + 15 - -prefilter_reads_taxonomy + +taxon_shard_unicorn_refstats - + 15->14 - - - - - -16 - -taxon_prefilter_align_merge + + - + 16->15 - - - - - -22 - -taxon_prefilter_align_samtools_stats - - - -16->22 - - - - - -24 - -taxon_prefilter_align_sort_taxon - - - -16->24 - - - - - -26 - -taxon_prefilter_metadmg_lca - - - -16->26 - - - - - -41 - -taxon_prefilter_metadmg_damage - - - -16->41 - - + + 17 - -taxon_prefilter_shard_unicorn_refstats + +taxon_shard_saturated_reads_filter - + 17->16 - - + + - - -18 - -taxon_prefilter_shard_saturated_reads_remove + + +17->24 + + - + 18->17 - - + + + + + +19 + +taxon_align_unicorn_taxstats - + 19->1 - - + + - - -19->18 - - + + +20->19 + + 21 - -taxon_prefilter_shard_count_alns - - - -19->21 - - - - - -20 - -taxon_prefilter_shard_saturated_reads_filter + +taxon_metadmg_dfit - - -20->14 - - - - - -20->18 - - - - - -20->40 - - - - - -21->20 - - - - - -22->1 - - + + +21->1 + + 23 - -taxon_prefilter_align_unicorn_taxstats - - - -23->1 - - - - - -24->23 - - - - - -25 - -taxon_prefilter_metadmg_dfit - - - -25->1 - - - - - -27 - -taxon_prefilter_metadmg_aggregate - - - -25->27 - - - - - -26->25 - - - - - -26->27 - - - - - -27->0 - - + +taxon_metadmg_aggregate - - -27->1 - - + + +21->23 + + - - -28->1 - - - - - -32 - -taxon_shard_saturated_reads_remove - - - -28->32 - - - - - -34 - -taxon_shard_count_alns - - - -28->34 - - - - - -29 - -taxon_align_samtools_stats - - - -29->1 - - - - - -30 - -taxon_align_merge - - - -30->29 - - - - - -36 - -taxon_align_sort_taxon - - - -30->36 - - - - - -38 - -taxon_metadmg_lca - - - -30->38 - - - - - -43 - -taxon_metadmg_damage - - - -30->43 - - - - - -31 - -taxon_shard_unicorn_refstats - - - -31->30 - - - - - -32->31 - - - - - -33 - -taxon_shard_saturated_reads_filter - - - -33->32 - - - - - -33->42 - - - - - -34->33 - - - - - -35 - -taxon_align_unicorn_taxstats - - - -35->1 - - - - - -36->35 - - - - - -37 - -taxon_metadmg_dfit - - - -37->1 - - - - - -39 - -taxon_metadmg_aggregate - - - -37->39 - - - - - -38->37 - - - - - -38->39 - - - - - -39->0 - - + + +22->21 + + - - -39->1 - - + + +22->23 + + - - -40->0 - - + + +23->0 + + - - -41->0 - - + + +23->1 + + - + -42->0 - - +24->0 + + - - -43->0 - - + + +25->0 + + diff --git a/workflow/Snakefile b/workflow/Snakefile index 1e1e16d..82020fd 100644 --- a/workflow/Snakefile +++ b/workflow/Snakefile @@ -33,27 +33,11 @@ module workflow_derep: use rule * from workflow_derep as derep_* -module workflow_taxon_prefilter: - pathvars: - reads="prefilter_reads", - shards="prefilter_shards", - aligns="prefilter_aligns", - metadmg="prefilter_metadmg", - reports="prefilter_reports", - snakefile: - github("GeoGenetics/ngs-taxon", path="workflow/Snakefile", tag="v0.12.0") - config: - {"units": units, "cfg": config["prefilter"]} - - -use rule * from workflow_taxon_prefilter as taxon_prefilter_* - - module workflow_taxon: snakefile: github("GeoGenetics/ngs-taxon", path="workflow/Snakefile", tag="v0.12.0") config: - {"units": units, "cfg": config["euk"]} + {"units": units, "cfg": config["taxon"]} use rule * from workflow_taxon as taxon_* @@ -66,9 +50,6 @@ pathvars: shards="shards", -include: "rules/prefilter.smk" - - onsuccess: print("aeDNA workflow finished successfully!") @@ -211,13 +192,6 @@ use rule multiqc_derep as multiqc_taxon with: input: rules.trim_multiqc.input, rules.derep_multiqc.input, - # FastQC of prefiltered read - expand( - rules.prefilter_fastqc.output.zip, - zip, - **units.assign(read_type_map="collapsed").to_dict("list"), - ), - rules.taxon_prefilter_multiqc.input, rules.taxon_multiqc.input, config=base_dir / "resources/multiqc_config.yaml", output: @@ -233,7 +207,6 @@ rule target_taxon: default_target: True input: rules.multiqc_taxon.output, - rules.taxon_prefilter_all.input.res, rules.taxon_all.input.res, message: "Taxonomic assignment finished successfully!" diff --git a/workflow/envs/metadmg.yaml b/workflow/envs/metadmg.yaml deleted file mode 100644 index 07e0781..0000000 --- a/workflow/envs/metadmg.yaml +++ /dev/null @@ -1,6 +0,0 @@ -channels: - - conda-forge - - bioconda - - nodefaults -dependencies: - - metadmg =0.4.1 diff --git a/workflow/rules/prefilter.smk b/workflow/rules/prefilter.smk deleted file mode 100644 index a096d73..0000000 --- a/workflow/rules/prefilter.smk +++ /dev/null @@ -1,122 +0,0 @@ - -rule prefilter_reads_taxonomy: - input: - bam=rules.taxon_prefilter_align_merge.output.bam, - names=rules.taxon_prefilter_metadmg_lca.input.names, - nodes=rules.taxon_prefilter_metadmg_lca.input.nodes, - acc2taxid=rules.taxon_prefilter_metadmg_lca.input.acc2taxid, - output: - read_id=temp( - "//prefilter/taxonomy/{sample}_{library}_{read_type_map}.read_ids" - ), - log: - "//prefilter/taxonomy/{sample}_{library}_{read_type_map}.log", - benchmark: - "//prefilter/taxonomy/{sample}_{library}_{read_type_map}.jsonl" - conda: - urlunparse( - baseurl._replace(path=str(Path(baseurl.path) / "envs" / "metadmg.yaml")) - ) - threads: 1 - resources: - mem=lambda w, input, attempt: f"{10* attempt} GiB", - runtime=lambda w, input, attempt: f"{(0.05* input.size_gb+0.5)* attempt} h", - params: - extra="-taxnames {}".format(config["prefilter"]["taxa"]), - shell: - "(extract_reads bytaxid -hts {input.bam} -names {input.names} -nodes {input.nodes} -acc2tax <(cat {input.acc2taxid}) {params.extra} -strict 1 -forcedump 1 -out - -type sam | awk '!/^@/' | cut -f 1 | uniq > {output.read_id}) 2> {log}" - - -rule prefilter_reads_merge: - input: - taxonomy=rules.prefilter_reads_taxonomy.output.read_id, - saturated=rules.taxon_prefilter_shard_saturated_reads_filter.output.read_id, - output: - read_id=temp( - "//prefilter/merge/{sample}_{library}_{read_type_map}.read_ids" - ), - log: - "//prefilter/merge/{sample}_{library}_{read_type_map}.log", - benchmark: - "//prefilter/merge/{sample}_{library}_{read_type_map}.jsonl" - localrule: True - threads: 1 - resources: - mem=lambda w, attempt: f"{1* attempt} GiB", - runtime=lambda w, attempt: f"{30* attempt} m", - shell: - "cat {input} > {output} 2> {log}" - - -rule prefilter_reads_extract: - input: - fastq=workflow_taxon_prefilter.get_data, - pattern=branch( - is_activated("prefilter/filter/saturated_reads"), - then=rules.prefilter_reads_merge.output.read_id, - otherwise=rules.prefilter_reads_taxonomy.output.read_id, - ), - output: - fq="//prefilter/extract/{sample}_{library}_{read_type_map}.fastq.gz", - log: - "//prefilter/extract/{sample}_{library}_{read_type_map}.log", - benchmark: - "//prefilter/extract/{sample}_{library}_{read_type_map}.jsonl" - threads: 2 - resources: - mem=lambda w, input, attempt: f"{5* attempt} GiB", - runtime=lambda w, input, attempt: f"{(0.06* input.size_gb+1)* attempt} h", - params: - command="grep", - extra="--invert-match --delete-matched", - wrapper: - "v9.15.0/bio/seqkit" - - -def get_data_prefilter(wildcards): - return [rules.prefilter_reads_extract.output.fq] - - -workflow_taxon.get_data = get_data_prefilter - - -use rule shard_bowtie2 from workflow_taxon as taxon_shard_bowtie2 with: - input: - sample=get_data_prefilter, - idx=workflow_taxon.get_bowtie2_index, - - -use rule shard_bwa_aln from workflow_taxon as taxon_shard_shard_bwa_aln with: - input: - fastq=get_data_prefilter, - idx=lambda w: multiext( - config["ref"][w.ref]["path"], ".amb", ".ann", ".bwt", ".pac", ".sa" - ), - - -use rule shard_dragen from workflow_taxon as taxon_shard_dragen with: - input: - sample=get_data_prefilter, - - -########## -### QC ### -########## - - -rule prefilter_fastqc: - input: - rules.prefilter_reads_extract.output.fq, - output: - html="//fastqc/prefilter/{sample}_{library}_{read_type_map}.html", - zip="//fastqc/prefilter/{sample}_{library}_{read_type_map}_fastqc.zip", - log: - "//fastqc/prefilter/{sample}_{library}_{read_type_map}.log", - benchmark: - "//fastqc/prefilter/{sample}_{library}_{read_type_map}.jsonl" - threads: 4 - resources: - mem=lambda w, attempt: f"{3* attempt} GiB", - runtime=lambda w, attempt: f"{2* attempt} h", - wrapper: - "v9.15.0/bio/fastqc" diff --git a/workflow/schemas/config.schema.yaml b/workflow/schemas/config.schema.yaml index 7203198..befa7a4 100644 --- a/workflow/schemas/config.schema.yaml +++ b/workflow/schemas/config.schema.yaml @@ -17,15 +17,7 @@ properties: derep: type: object - prefilter: - type: object - properties: - taxa: - type: string - required: - - taxa - - euk: + taxon: type: object report: @@ -42,6 +34,5 @@ properties: required: - trim - derep - - prefilter - - euk + - taxon - report